Nghiên cứu xây dựng quy trình chuyển gen vào cây hoa loa kèn (Lilium longiflorum) bằng vi khuẩn Agrobacterium tumefaciens

BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG NGHIỆP HÀ NỘI ----------eêf---------- LƯƠNG HỒNG HẠNH NGHIÊN CỨU XÂY DỰNG QUY TRÌNH CHUYỂN GEN VÀO CÂY HOA LOA KÈN “Lilium longiflorum” BẰNG VI KHUẨN Agrobacterium tumefaciens LUẬN VĂN THẠC SĨ NÔNG NGHIỆP Chuyên ngành: TRỒNG TRỌT Mã số: 60.62.01 Người hướng dẫn khoa học: PGS.TS. NGUYỄN THỊ LÝ ANH HÀ NỘI - 2009 LỜI CAM ĐOAN Tôi xin cam đoan rằng số liệu và kết quả nghiên cứu trong luận văn này là hoàn toàn trung thực và chưa được sử dụng để

doc92 trang | Chia sẻ: huyen82 | Ngày: 09/12/2013 | Lượt xem: 1541 | Lượt tải: 10download
Tóm tắt tài liệu Nghiên cứu xây dựng quy trình chuyển gen vào cây hoa loa kèn (Lilium longiflorum) bằng vi khuẩn Agrobacterium tumefaciens, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
bảo vệ một học vị nào. Mọi sự giúp đỡ cho việc hoàn thành luận văn này đều đã được cảm ơn. Các thông tin, tài liệu trong luận văn này đã được ghi rõ nguồn gốc. Tác giả Lương Hồng Hạnh LỜI CẢM ƠN Sau một quá trình thực hiện đề tài tốt nghiệp tại Viện Sinh học Nông nghiệp, Trường Đại học Nông Nghiệp Hà Nội, được sự giúp đỡ tận tình của các thầy cô giáo, các cán bộ của Viện cùng với sự nỗ lực và cố gắng của bản thân, đến nay tôi đã hoàn thành xong đề tài tốt nghiệp của mình. - Trước tiên tôi xin gửi lời cảm ơn chân thành và sâu sắc tới PGS.TS Nguyễn Thị Lý Anh - Viện trưởng Viện Sinh học Nông nghiệp, Trường Đại học Nông Nghiệp Hà Nội, người đã trực tiếp hướng dẫn và giúp đỡ tôi rất nhiều trong suốt thời gian tôi thực hiện đề tài tốt nghiệp, cũng như thời gian tôi hoàn thành bản luận văn này. - Tôi xin chân thành cảm ơn các thầy cô giáo trong bộ môn CNSH Thực vật - SHPT và CN Vi sinh đã đóng góp nhiều ý kiến giúp tôi thực hiện đề tài. - Tôi xin chân thành cảm ơn Ks. Nguyễn Thị Thanh Phương, Ks. Hồ Thị Thu Thanh và toàn thể các cán bộ của Viện Sinh học Nông nghiệp – Trường Đại học Nông nghiệp Hà Nội đã luôn giúp đỡ tôi khi tôi thực hiện đề tài tại Viện. Nhân đây tôi xin trân trọng cảm ơn ban chủ nhiệm khoa Nông học, Viện Đào tạo Sau đại học cùng tất cả các thầy cô giáo, gia đình và bạn bè đã giúp tôi hoàn thành đề tài này. Hà Nội, tháng 09 năm 2009 Tác giả Lương Hồng Hạnh MỤC LỤC Lời cam đoan i Lời cảm ơn ii Mục lục iii Danh mục các chữ viết tắt và ký hiệu v Danh mục bảng vi Danh mục hình vii DANH MỤC CÁC CHỮ VIẾT TẮT VÀ KÝ HIỆU CT Công thức 2,4 D 2,4-Dichlorophenoxyacetic acid BA 6-Benzyllamino purine AS Acetosyringone TNC Tiền nuôi cấy ĐNC Đồng nuôi cấy MS Murashige & Skoog, 1962 PPT DL - Phosphinotricine DANH MỤC BẢNG STT Tên bảng Trang 4.1. Đánh giá ảnh hưởng của nguồn mẫu đến khả năng chuyển gen của vi khuẩn A.tumefaciens qua biểu hiện của gen Gus (sau 3 tuần). 40 4.2. Đánh giá ảnh hưởng của nguồn mẫu cấy đến khả năng chuyển gen của vi khuẩn A.tumefaciens qua biểu hiện của gen Bar (sau 8 tuần ) 43 4.3. Đánh giá ảnh hưởng của thời gian tiền nuôi cấy đến khả năng chuyển gen của vi khuẩn A.tumefaciens qua biểu hiện gen Gus (sau 3 tuần) 45 4.4. Ảnh hưởng của thời gian tiền nuôi cấy đến khả năng chuyển gen của vi khuẩn A.tumefaciens qua biểu hiện của gen Bar (sau 8 tuần) 47 4.5. Đánh giá ảnh hưởng của phương pháp lây nhiễm mẫu đến khả năng chuyển gen của vi khuẩn A.tumefaciens qua biểu hiện của gen Gus (sau 3 tuần). 50 4.6. Đánh giá ảnh hưởng của phương pháp lây nhiễm mẫu tới khả năng chuyển gen của vi khuẩn A.tumefaciens qua biểu hiện của gen Bar (sau 8 tuần) 53 4.7. Đánh giá ảnh hưởng của thời gian ĐNC đến khả năng chuyển gen của vi khuẩn A.tumefaciens qua biểu hiện gen Gus (sau 3 tuần). 55 4.8. Đánh giá ảnh hưởng của thời gian ĐNC đến khả năng chuyển gen của vi khuẩn A.tumefaciens qua biểu hiện của gen Bar (sau 8 tuần). 57 4.9. Đánh giá tác động của tổ hợp các công thức tối ưu tới khả năng chuyển gen của vi khuẩn A.tumefaciens qua sự biểu hiện của gen Gus (sau 3 tuần) 59 DANH MỤC HÌNH STT Tên hình Trang 2.2. Chuyển gen cây trồng 7 2.3. Một số khối u do vi khuẩn Agrobacterium tumefaciens tạo ra trên thân cây hoa hồng (A) và trên thân cây nho (B). 9 2.4. Cấu trúc Ti- Plasmid 12 2.5. Mô hình chuyển gen nhờ Agrobacterium 13 3.1. Callus loa kèn in vitro 30 3.2. Lilium longiflorum thunb 30 3.3. Sơ đồ cấu trúc plasmid ITB2c 30 4.1. Ảnh hưởng của nguồn mẫu đến khả năng chuyển gen của vi khuẩn A.tumefaciens. 41 4.2. Ảnh hưởng của nguồn mẫu đến khả năng chuyển gen của vi khuẩn A.tumefaciens 44 4.3: Sự biểu hiện của gen Gus ở CT4 46 4.4. Ảnh hưởng của thời gian tiền nuôi cấy đến khả năng chuyển gen của vi khuẩn A.tumefaciens 48 4.5. ĐC trong MT chọn lọc có 2.5mg/l PPT 49 4.6. Mẫu sống trong MT chọn lọc có 2.5mg/l PPT 49 4.7. Ảnh hưởng của phương pháp lây nhiễm mẫu đến khả năng chuyển gen của vi khuẩn A.tumefaciens 52 4.8. Ảnh hưởng của PP lây nhiễm mẫu tới khả năng chuyển gen của vi khuẩn A.tumefaciens 53 4.9. Ảnh hưởng của thời gian đồng nuôi cấy đến khả năng chuyển gen của vi khuẩn Agrobacterium tumefasciens 56 4.10. Ảnh hưởng của thời gian đồng nuôi cấy đến khả năng chuyển gen của vi khuẩn A.tumefaciens 58 4.11. Đánh giá tác động của tổ hợp các công thức tối ưu tới khả năng chuyển gen của vi khuẩn A.tumefaciens qua sự biểu hiện của gen Bar (sau 8 tuần) 60 4.10. Đánh giá tác động của tổ hợp các công thức tối ưu tới khả năng chuyển gen của vi khuẩn A.tumefaciens qua sự biểu hiện của gen Bar (sau 8 tuần) 61 4.12. Kết quả điện di sản phẩm PCR của các dòng loa kèn chuyển gen 62 4.13. Sơ đồ thể hiện quy trình chuyển gen cho hoa loa kèn L.longiflorum nhờ vi khuẩn A.tumefacens 64 1. MỞ ĐẦU 1.1 Đặt vấn đề Nói đến vẻ đẹp của thiên nhiên không thể không nói đến các loài hoa. Mỗi loài hoa ẩn chứa một vẻ đẹp, một sức quyến rũ và giá trị kinh tế riêng. Với màu trắng pha thêm chút xanh, mùi hương thơm dịu, hoa loa kèn trắng (Lilium longiflorum) đã rất được ưa chuộng và có giá trị kinh tế cao trên thị trường hoa thế giới và Việt Nam. Tuy nhiên, cây hoa loa kèn trắng có thời gian sinh trưởng khá dài nên người trồng phải chi phí cao cho phòng trừ cỏ dại và sâu bệnh, đặc biệt là vào mùa Xuân ẩm ướt, gây ra những khó khăn cho người sản xuất hoa loa kèn ở miền Bắc nước ta. Việc chọn tạo ra các giống cây hoa bằng tất cả những phương pháp chọn tạo giống hiệu quả luôn là mong muốn của các nhà chọn tạo giống với mục tiêu không ngừng nâng cao giá trị thu nhập trên một đơn vị diện tích canh tác cho người nông dân. Do đó, việc tạo ra các giống cây hoa loa kèn mới chống chịu điều kiện bất lợi của thời tiết, chống chịu sâu bệnh, kháng thuốc trừ cỏ ... là nhu cầu của thực tiễn sản xuất và mong muốn của các nhà chọn tạo giống. Ngày nay với sự phát triển của công nghệ gen đã cho phép các nhà chọn tạo giống đưa được những tính trạng mong muốn vào cây trồng chỉ trong thời gian ngắn (chỉ sau một thế hệ), tạo được nhiều giống mới có nhiều đặc tính mới. Với phương pháp này, người ta có thể đưa được những gen quy định những tính trạng mới, kể cả những tính trạng của những loài có quan hệ rất xa, cũng có thể từ vi sinh vật, động vật… điều mà các phương pháp truyền thống không thể thực hiện được. Trong các kỹ thuật chuyển gen, thì phương pháp chuyển gen thông qua Agrobacterium tumefaciens tỏ ra có nhiều ưu điểm hơn các phương pháp khác và được sử dụng phổ biến nhất. Chính vì vậy chúng tôi thực hiện đề tài:“Nghiên cứu xây dựng quy trình chuyển gen vào cây hoa loa kèn (Lilium longiflorum) bằng vi khuẩn Agrobacterium tumefaciens”. 1.2 Mục đích và yêu cầu 1.2.1 Mục đích Xác định được các thông số kĩ thuật cho các bước trong quy trình chuyển gen mục tiêu nhờ vi khuẩn Agrobacterium tumefaciens, làm cơ sở cho việc tạo cây chuyển gen mang các đặc tính mong muốn. 1.2.2 Yêu cầu Xác định được vật liệu lây nhiễm phù hợp. Xác định được phương pháp lây nhiễm vi khuẩn phù hợp. Xác định được thời gian tiền nuôi cấy phù hợp. Xác định được thời gian đồng nuôi cấy phù hợp. Xác định được sự có mặt của gen chuyển nạp trong mẫu đã chuyển gen. 1.3 Ý nghĩa khoa học và ý nghĩa thực tiễn 1.3.1 Ý nghĩa khoa học Kết quả nghiên cứu của đề tài cho thấy khả năng có thể chuyển được gen vào cây hoa loa kèn, một loại cây thuộc nhóm một lá mầm bằng vi khuẩn Agrobacterium tumefaciens. Đồng thời, các thông số kĩ thuật đã xác định được sẽ làm cơ sở cho việc tiếp tục chuyển các gen mong muốn khác vào cây hoa loa kèn nói riêng và các cây hoa lily nói chung. 1.3.2 Ý nghĩa thực tiễn Kết quả nghiên cứu của đề tài làm tiền đề và thúc đẩy việc ứng dụng một phương pháp mới là tạo giống cây trồng chuyển gen mang đặc tính mong muốn trong công tác chọn tạo giống cây trồng nói chung và cây hoa loa kèn nói riêng ở Việt Nam. 2. TỔNG QUAN TÀI LIỆU 2.1 Giới thiệu chung về hoa loa kèn 2.1.1 Nguồn gốc, phân loại a) Nguồn gốc Lily là tên gọi chung của tất cả các loài Lilium, họ Liliaceae được tìm thấy ở các nước thuộc khu vực Đông Á như: Nhật Bản, Trung Quốc, các vùng dọc theo dãy núi Himalaya... Ngày nay, lily được trồng phổ biến khắp nơi trên thế giới, chẳng hạn: Mỹ, Hà Lan, Nhật Bản, Ý, Thái Lan, Trung Quốc, Việt Nam... Trong đó Trung Quốc được xem là nước trồng cây hoa lily đầu tiên. Trong sản xuất có thể phân chia Lilium thành ba nhóm chính sau: Asiatic lily, Oriental lily, Longiflorum lily. Hiện nay ở Việt Nam trong sản xuất chủ yếu trồng hoa loa kèn Lilium longiflorum Thunb (hay còn gọi là Huệ Tây) [21], là giống được nhập nội vào Việt Nam từ rất lâu do người Pháp du nhập vào, gần đây có một số giống nhập nội đang được trồng thử nghiệm ở Sapa, Đà Lạt, Hải Phòng và một số nơi khác. b) Phân loại khoa học Giới: Thực vật Ngành: Thực vật có hoa Nhóm: Một lá mầm (Monocotyledones) Lớp: Hành (Lilidae) Bộ: Hành (Liliales) Họ: Huệ tây (Liliaceae) Hình 2.1. Lilium longiflorum Thunb Chi: Lilium Loài: L. Longiflorum Danh pháp khoa học Lilium longiflorum Thunb. (Dương Đức Tiến, Võ Văn Chi, 1978) 2.1.2 Đặc điểm sinh vật học Cây hoa loa kèn trắng sinh trưởng phát triển tốt trên đất giàu chất hữu cơ, trung tính (pH 6,5-7,0), thoát nước tốt, nhiệt độ thích hợp cho sự ra rễ là 16-17oC, cho sự ra hoa và sinh trưởng của nụ hoa là 21-23oC, là cây ưa sáng. Hoa loa kèn trắng là cây thân thảo lâu năm, thân cao từ 50-200cm, thân dạng hành có vảy, phần dưới mặt đất gồm thân vảy, rễ và phần trên mặt đất gồm lá, thân. Trồng tháng 10-11. Ra hoa tháng 4 năm sau. Trồng bằng củ, mỗi củ thường chỉ mọc một cây [8]: * Thân vảy là phần phình to của các vảy củ tạo thành, trên đĩa thân vảy có vài chục vảy hợp lại, phía ngoài không có màng bao bọc nên gọi là thân vảy trần. Màu sắc, kích thước của thân vảy tùy thuộc vào loài, giống khác nhau. Đây là phần thương phẩm có thể dùng để nhân giống. * Rễ hoa loa kèn trắng gồm hai phần rễ thân và rễ gốc. Rễ thân do phần thân mọc dưới mặt đất sinh ra, có nhiệm vụ nâng đỡ thân, hút nước và dinh dưỡng, rễ gốc sinh trưởng khỏe, là cơ quan chủ yếu hút nước và dinh dưỡng của loa kèn. * Lá hoa loa kèn trắng mọc chéo nhau, hình dài, hình trứng… không có cuống hoặc cuống rất ngắn, mọc xung quanh thân. Một số ít giống ở nách có lá mầm, có thể dùng để nhân giống. * Hoa loa kèn trắng mọc đơn lẻ hoặc cụm gồm nhiều hoa thường có 1-6 hoa. Hoa to mọc riêng rẽ thành chùm hoặc thành cụm trên đỉnh ngọn thân, hoa thường có 6 cánh và 6 nhị, nếu muốn hoa tươi lâu thì khi cắm hoa ta nên cắt 6 bao phấn của hoa sẽ để được hoa tươi lâu hơn và ngăn chặn sự già hoá. Mỗi củ chỉ có một cành hoa, mầm thân của nó bị rụng đi, hoặc sau khi ngắt ngọn không thể mọc ra thân mới, cũng không thể hình thành cành hoa khác. Hoa có hình dạng như hình loa kèn…( Flower favourite), màu trắng, hương thơm dễ chịu [8]. 2.1.3 Giá trị sử dụng và giá trị kinh tế Hoa loa kèn to, có độ bền cao, hoa có màu trắng tinh khiết tượng trưng cho một vẻ đẹp quý phái. Hoa được sử dụng trong những ngày hội lớn, ngày lễ tết, trang trí trong hội trường, công viên, trong văn phòng. Không những thế, hoa còn được cắm trong phòng khách của mỗi gia đình tạo nên một cảm giác thoả mái và ấm cúng. Ngoài ra hoa loa kèn còn được sử dụng làm quà tặng nhân các dịp lễ. Với Hà Nội, hoa loa kèn được coi là một thứ hoa sang trọng, quyền quý, trong sáng, nhẹ nhàng, đặc trưng của Hà Nội khi tháng tư về [37]. Ở Châu Âu, Lilium longiflorum được gọi là Easter lily _ hoa Phục Sinh vì hoa nở vào mùa Phục Sinh [37]. Hoa loa kèn tượng trưng cho niềm hân hoan vui mừng trước vẻ đẹp và niềm hy vọng vào cuộc sống, cũng như đạt được sự ưa chuộng và phát triển mạnh ở khắp nơi trên thế giới. Bên cạnh giá trị về tinh thần, hoa loa kèn còn có giá trị kinh tế đáng kể. Năm 2002, diện tích trồng hoa loa kèn tiếp tục tăng lên với tổng diện tích là 4523ha, đứng thứ hai trong tổng diện tích hoa cắt trồng bằng củ, chỉ xếp sau diện tích trồng hoa tulip. Bên cạnh Hà Lan còn một số nơi trồng nhiều hoa loa kèn như: Nhật, Mỹ, Nam Hemisphere, e.g. Australia, Chile và Nam Phi. Tại Mỹ, 60% nguồn củ được nhập khẩu từ Hà Lan với hơn 1 tỷ củ hoa, 8% nhập khẩu từ nước Anh, 6% nhập khẩu từ các nước khác, 25% hàng nội địa (do Mỹ tự sản xuất) [8]. Năm 2003, Hàn Quốc xuất khẩu hoa loa kèn cắt cành sang thị trường Nhật Bản thu về hơn 10 triệu USD, và nhập khẩu 4 triệu USD củ loa kèn giống từ Hà Lan [8]. Ở Việt Nam, cây hoa loa kèn đang trở thành một trong những xu hướng chuyển dịch cơ cấu cây trồng của rất nhiều hộ nông dân. Hoa chính vụ thu hoạch giá từ 700 - 1000 đồng/cành, vào những ngày lễ tết giá hoa có thể lên tới 15000 – 20000đ/cành. Theo tính toán của một hộ nông dân ở Mê Linh Vĩnh Phúc trồng 1 sào hoa loa kèn trái vụ, nở đúng dịp Tết, thu được gần 20 triệu đồng, lãi khoảng 10 triệu đồng [34]. Tuy nhiên, trồng hoa loa kèn gặp không ít khó khăn về giống, sâu bệnh và điều kiện tự nhiên không thuận lợi. Chủng loại, chất lượng, kích thước hoa không đồng đều, ít phong phú nên giá trị xuất khẩu hoa còn nhỏ. Vì vậy, việc liên tục chọn tạo ra các giống cây hoa loa kèn mới nâng cao hiệu quả kinh tế là một trong những nhiệm vụ cần thiết đối với các nhà chọn tạo giống Việt Nam trong xu thế hội nhập. 2.2 Chuyển gen ở thực vật 2.2.1 Khái niệm chuyển gen Chuyển gen là kỹ thuật đưa một hay nhiều gen lạ đã được thiết kế ở dạng DNA tái tổ hợp vào tế bào chủ của cây trồng nói riêng và của các sinh vật nói chung (vi sinh vật, động vật,...) làm cho gen lạ có thể tồn tại ở dạng plasmid tái tổ hợp hoặc gắn vào bộ gen tế bào chủ. Trong tế bào chủ, các gen này hoạt động tổng hợp nên các protein đặc trưng dẫn tới việc xuất hiện các đặc tính mới của cơ thể chuyển gen [18]. Chuyển gen ở thực vật đã phát triển cùng với sự phát triển của các kỹ thuật nuôi cấy mô và tế bào thực vật. Nó cho phép nghiên cứu cấu trúc và điều khiển hoạt động của gen, mở ra triển vọng chuyển các gen có ý nghĩa kinh tế vào cây trồng. Các bước chính để tạo một thực vật chuyển gen gồm có: Chọn lọc và phân lập gen; chuyển gen vào tế bào thực vật; nuôi tế bào thực vật mang gen lạ thành cây hoàn chỉnh. Hình 2.2. Chuyển gen cây trồng 2.2.2 Chuyển gen nhờ vi khuẩn Agrobacterium Có nhiều phương pháp chuyển gen vào thực vật nhưng có thể phân loại thành hai nhóm phương pháp chính: phương pháp chuyển gen trực tiếp và phương pháp chuyển gen gián tiếp. Ở phương pháp chuyển gen trực tiếp, gen được chuyển trực tiếp vào tế bào thực vật thông qua những thiết bị hoặc thao tác nhất định mà không cần phải nhờ các sinh vật trung gian. Phương pháp chuyển gen gián tiếp, gen được chuyển vào tế bào thực vật qua một sinh vật trung gian thường là vi sinh vật hoặc virus [12], [13]. Vi khuẩn đất nhuộm gram âm Agrobacterium tumefaciens là một vi khuẩn gây bệnh, mà một phần bình thường trong vòng đời của nó là biến nạp di truyền các tế bào thực vật. Được nghiên cứu từ những năm 1960 – 1970, việc phát hiện ra vi khuẩn này có khả năng chuyển gen vào thực vật vào đầu những năm 1980 đã biến loài này trở thành một trong những công cụ quan trọng nhất của Công nghệ sinh học thực vật với những ưu điểm nổi trội: số bản sao của gen biến nạp được chuyển vào tế bào thực vật thấp (khoảng 1-2 gen, trong khi sử dụng súng bắn gen là nhiều hơn), do vậy, giảm tối thiểu sự không biểu hiện của gen được chuyển, tăng khả năng chuyển gen bền vững, hiệu quả chuyển gen cao; tránh được sự hình thành của các cây chuyển gen khảm; kỹ thuật đơn giản, dễ thực hiện; không đòi hỏi thiết bị đắt tiền [17]. Phương pháp này đã khắc phục được những hạn chế chủ yếu của các phương pháp chuyển gen trực tiếp như: thường thu nhận được cây trồng có nhiều bản sao của một gen dẫn tới sự “nhiễu gen” và không bền vững của gen trong thực vật, tần số chuyển gen thấp, kết quả có thể thu được những cây mang thể khảm nghĩa là chỉ mang gen ở một số vị trí trên cây... Chuyển gen bằng Agrobacterium đã thực hiện có kết quả trên nhiều loài cây hai lá mầm như: thuốc lá, cà chua, khoai tây, đậu tương, ngô, bông và đặc biệt là trên cây một lá mầm thì đã làm cho phương pháp chuyển gen này trở nên hấp dẫn và củng cố được vị trí của nó ngay từ đầu [19]. * Đặc điểm chung của vi khuẩn Agrobacterim tumefaciens Agrobacterium là các vi khuẩn đất nhuộm gram (-) gây ra các triệu chứng bệnh ở cây khi xâm nhiễm qua vết thương, tạo ra các u sần ảnh hưởng đến sự sinh trưởng bình thường của cây bị xâm nhiễm [5], [7]. Trong chi Agrobacterium thì A.tumefaciens được sử dụng nhiều nhất cho việc chuyển gen. Phân loại khoa học: Giới: Bacteria Ngành: Proteobacteria Lớp: Alpha Proteobacteria Bộ: Rhizobiales Họ: Rhizobiaceae Chi: Agrobacterium Loài: A. tumefaciens Danh pháp khoa học: Agrobacterium tumefaciens. Quy trình chung để chuyển gen nhờ vi khuẩn A. tumefaciens như sau: Bước 1: Thiết kế vector mang gen. Bước 2: Nhân dòng vector nhờ vi khuẩn E.coli. Bước: Chuyển vector mang biến nạp từ E.coli sang A.tumefaciens. Bước 4: Lây nhiễm A.tumefaciens chứa gen biến nạp với tế bào, mô thực vật để tiến hành quá trình chuyển gen sang mô, tế bào đích. Bước 5: Chọn lọc các mô, tế bào được biến nạp thành công. Bước 6: Tái sinh mô, tế bào biến nạp thành cây hoàn chỉnh. Sau đó, từ những cây chuyển gen thu được cần đánh giá sự ổn định di truyền qua các thế hệ, sử dụng phương pháp lai hữu tính để thu được con cái mang gen mong muốn. Đồng thời đánh giá tác động của cây chuyển gen để đưa ra sản xuất và cung cấp cho thị trường [18]. Vì vậy với mỗi loại cây, mỗi loại vector mang gen khác nhau sử dụng cho quá trình chuyển gen nhờ vi khuẩn Agrobacterium tumefaciens cần có quy trình riêng với các thông số kỹ thuật cụ thể cần được nghiên cứu. 2.3 Cơ sở khoa học của phương pháp chuyển gen vào thực vật nhờ vi khuẩn A. tumefaciens 2.3.1 Cơ sở về khả năng tái sinh ở thực vật Trong kỹ thuật chuyển gen vào thực vật thì những đối tượng thường được sử dụng để chuyển gen là: mô lá, mô thân, mẩu callus hay những tế bào tách rời... những vật liệu này sau khi đã được biến nạp thành công các tế bào đã dung hợp các gen ngoại lai, ta phải tìm cách làm cho các tế bào này tái sinh được thành một cơ thể hoàn chỉnh bằng cách đặt vào nó một môi trường tái sinh thích hợp. Nếu như sự tái sinh thành cây hoàn chỉnh không thành công thì tất cả những vật liệu đã được biến nạp đó sẽ trở lên vô nghĩa. Chính vì vậy, sự thành công của kỹ thuật chuyển gen phụ thuộc vào sự tái sinh của tế bào. Quá trình phát sinh hình thái trong nuôi cấy mô tế bào thực vật thực chất là kết quả của quá trình phân hoá và phản phân hoá tế bào. Về cơ bản thì quá trình phân hoá và phản phân hoá là quá trình hoạt hoá, ức chế các gen. Tại một thời điểm nào đó trong quá trình phát triển cá thể có một số gen được hoạt hoá (mà vốn trước nay bị ức chế) để cho ta tính trạng mới còn một số gen khác thì lại bị đình chỉ hoạt động. Điều này xảy ra theo một chương trình đã được mã hoá trong cấu trúc của phân tử DNA của mỗi tế bào khiến quá trình sinh trưởng phát triển của cơ thể thực vật luôn được hài hoà. Mặt khác, khi tế bào nằm trong một khối mô của cơ thể thường bị ức chế bởi các tế bào xung quanh, khi tách riêng từng tế bào hoặc giảm kích thước của khối mô sẽ tạo điều kiện thuận lợi cho sự hoạt hoá các gen của tế bào [18]. Do vậy, việc lựa chọn và điều chỉnh môi trường nuôi cấy mô và tế bào thực vật đóng vai trò quan trọng góp phần quyết định sự thành công hay thất bại của thí nghiệm biến nạp. Yêu cầu cơ bản đối với hệ thống tái sinh: * Các mẫu tế bào, mô dùng cho quá trình chuyển gen cần phải có khả năng phân chia in vitro nhanh. * Các mô, tế bào này phải có khả năng tiếp nhận gen mới. * Quy trình tái sinh cây phải có hiệu quả cao, không hoặc ít phụ thuộc vào kiểu gen * Cây tái sinh phải có tỷ lệ sống cao (khi đưa ra ngoài đất trồng), tần số biến dị thấp và khả năng hữu thụ cao để có thể sử dụng làm nguồn nguyên liệu ban đầu để tiếp tục tiến hành chuyển gen trong điều kiện in vivo sau này. Nếu sự biến nạp xảy ra mà không có sự tái sinh kèm theo, hoặc sự tái sinh diễn ra mà không kèm theo sự biến nạp thì thí nghiệm biến nạp không thành công. Vì vậy, giai đoạn biến nạp và giai đoạn tái sinh cây đều có ý nghĩa quan trọng trong thành công của thí nghiệm chuyển gen. 2.3.2 Cơ chế chuyển gen của Agrobacterim tumefaciens. A.tumefaciens có khả năng chèn gen của mình vào thực vật và sau đó sử dụng bộ máy thực vật để biểu hiện các gen này dưới dạng hợp chất dinh dưỡng cho chúng. A.tumefaciens sẽ tạo ra các khối u thực vật gần điểm tiếp nối giữa rễ và thân, gây ra những nốt sần ở cây (bệnh mụn cây - crown gall disease), khi đó các tế bào khối u ở thực vật có gắn một đoạn DNA từ vi khuẩn. Khi phân tích khối u cho thấy trong khối u có sự hình thành một số vật chất mới như: nopaline, octopine gọi chung là opine. Các chất này không hề có trước đó và không hề có ở cây trồng thông thường. Như vậy vi khuẩn đã truyền vào cây qua vết thương một tác nhân gây bệnh cho cây và tác nhân này có bản chất là vật chất di truyền. Qua nghiên cứu người ta kết luận rằng tác nhân gây u này chính là Ti-plasmid có trong vi khuẩn A.tumefaciens. Ti-plasmid này có đặc điểm chung như sau: Ti-plasmid là một plasmid được cấu tạo bao gồm một phân tử DNA kép, vòng tròn lớn có kích thước: 200kb, có khả năng tái bản độc lập với sự tái bản của DNA nhiễm sắc thể của vi khuẩn. Hình 2.4. Cấu trúc Ti- Plasmid (nguồn : Trên Ti-plasmid có đoạn T-DNA được giới hạn bằng bờ phải (right border) và bờ trái (left border) có trình tự nucleotid tương tự nhau. T-DNA là đoạn nucleotid có kích thước 25kb và mang hai loại gen: loại gen gây ung thư (oncogenic gene), loại này mã hoá cho một enzym liên quan tới tổng hợp các auxin, cytokinin và hình thành khối u; loại thứ hai liên quan tới tổng hợp opine. Đoạn này được gọi là T-DNA (Tumor DNA) vì đây là đoạn sẽ được chuyển vào tế bào thực vật gắn vào bộ NST và gây ra bệnh u. Trên Ti-plasmid còn có vùng vir chứa các gen chịu trách nhiệm hoạt động lây nhiễm, chuyển nạp và tiêu hoá opine. Khi cây nhiễm bệnh, do T-DNA nạp vào trong bộ gen của cây chủ bắt đầu hoạt động và sản sinh ra auxin, cytokinin và opine, toàn bộ sinh trưởng của cây bị rối loạn, các tế bào phân chia vô tổ chức và tạo ra các khối u. Opine được vi khuẩn sử dụng như một loại thức ăn, nhờ gen chuyển hoá opine trên Ti-plasmid. (1)_Agrobacterium nhận dạng và tấn công tế bào chủ;(2)_Tổ hợp tín hiệu VirA/VirG của Agrobacterium cảm nhận những tín hiệu thực vật đặc trưng;(3)_Sự hoạt hoá của vùng gen vir; (4)_ T-DNA được tách ra khỏi Ti-plasmid nhờ phức hợp protein VirD1/D2; (5)_Sự tạo thành phức hợp VirD2-DNA (phức hợp-T chưa thành thục), cùng với một vài protein Vir khác, đi vào nguyên sinh chất tế bào chủ; (6)_Sự kết hợp của VirE2 với sợi-T tạo thành phức hợp-T thành thục đi xuyên qua nguyên sinh chất tế bào chủ; (7)_Phức hợp-T thành thục chủ động đi vào nhân tế bào chủ; (8)_T-DNA bị hấp dẫn tới vị trí hợp nhất; (9)_T-DNA tách khỏi các protein bảo vệ; (10)_T-DNA hợp nhất vào bộ gen chủ. Quá trình chuyển T-DNA từ vi khuẩn A.tumefaciens sang tế bào cây chủ được thực hiện bởi hoạt động của các gen vir A, B, C, D, E, G, F, trong đó vir C và vir E có tác dụng làm tăng tần số biến nạp [19]. Các gen này có vai trò quan trọng trong việc nhận diện ra vết thương của cây thông qua tín hiệu hoá học acetosyringone (AS). Tín hiệu hoá học được nhận biết đầu tiên bởi vir A. Gen vir A sẽ tổng hợp nên một loại protein nằm trong màng tế bào để đáp ứng sự trao đổi chất của vết thương trên cây. Protein vir A tự photphoryl hoá đồng thời làm cho protein vir G được photphoryl hoá và kích hoạt sao mã của các gen vir B, C, E, F, G. Tiếp đó các protein được mã hoá bởi vir D, vir E thực hiện chức năng giải phóng sợi T-DNA. Protein D2 cắt T-DNA tại vị trí 5’ của bờ phải và 3’ của bờ trái và giải phóng sợi T-DNA. Protein E2 bảo vệ T-DNA khỏi sự phân giải của enzym nuclease trong cây. Đồng thời thực hiện chức năng này có các protein vir C1, vir C 2 có tác dụng tăng cường việc giải phóng T-DNA. Sự chuyển phức hợp T-DNA do operon vir B đảm nhiệm. Vir B có chức năng tạo kênh xuyên qua màng tế bào giúp chuyển sợi đơn T-DNA vào nhân tế bào. Đồng thời protein vir B4, vir B11 có hoạt tính ATPase cung cấp năng lượng cho vận chuyển T-DNA. Như vậy, thực chất đã có một hệ thống chuyển gen của vi khuẩn đất vào cây trồng tồn tại trong tự nhiên. * Thiết kế vector chuyển gen. Các nghiên cứu về Agrobacterium và khả năng tự nhiên của chúng trong việc biến đổi vật chất sinh học của các tế bào thực vật bị nhiễm đã giúp các nhà khoa học thiết kế được những phân tử giúp chuyển gen mong muốn vào tế bào thực vật: T-DNA được giới hạn hai đầu bởi vùng biên (T-DNA borders), phần còn lại trong vùng biên sẽ không có chức năng gì trong quá trình chuyển gen. Nhờ vậy, có thể loại bỏ khả năng gây hại của T-DNA bằng cách thay các gen tạo khối u (oncogenes) nằm trong hai đầu vùng biên bằng các gen mong muốn. Khi các oncogene bị loại bỏ, tế bào hoặc mô thực vật chuyển gen sẽ phát triển bình thường và trong hầu hết các trường hợp, cho cây hữu thụ. Quá trình tổng hợp opine sử dụng các nguyên liệu của cây làm ảnh hưởng đến năng suất cuối cùng nên trong quá trình thiết kế cũng loại bỏ các gen tổng hợp opine. Ti-plasmid có kích thước lớn (200-800kb) nên những đoạn DNA không cần thiết cũng phải được cắt bỏ để chèn vào đoạn DNA mục tiêu. Ngoài ra, Ti-plasmid không tự tái bản trong E.coli nên cần được bổ sung thêm gốc tái bản của E.coli. Cuối cùng, cần bổ sung các gen chỉ thị để chọn lọc cây và vi khuẩn. Như vậy, cấu trúc của một vector chuyển gen bao gồm: * Có gốc tái bản (ORI) có nguồn gốc từ vi khuẩn. * Vùng khởi động (promoter) có nguồn gốc từ thực vật. * Vùng kết thúc (terminator). * Vùng gắn gen chuyển vào (MCS). * Vùng chứa gen chọn lọc (để tách các tế bào chuyển gen). * Vùng chứa các gen báo cáo để biết được các gen chuyển vào có thành công không (Gus, GFP - gen phát huỳnh quang). Người ta đã tạo ra các dạng vector mới để chuyển gen là những vector liên hợp (cointegrate vector) và vector nhị thể (binary vector) [4]. Hệ thống vector liên hợp (cointegrate vector) là kết quả của sự liên hợp hai loại plasmid: Ti-plasmid đã loại trừ vùng gen gây khối u và gen tạo các hợp chất opine nhưng vẫn giữ lại vùng vir và vùng bờ trái, bờ phải. Thay vào những gen bị cắt bỏ là đoạn tương đồng với một đoạn trên plasmid thứ hai (plasmid trung gian) để phục vụ cho việc liên hợp hai loại plasmid. Plasmid trung gian là một plasmid tách dòng từ vi khuẩn E.coli và có thể tái sinh được ở Agrobacterium. Plasmid này có chứa vùng gắn gen cần chuyển nạp, các gen chỉ thị phục vụ việc chọn lọc và có mặt đoạn tương đồng. Khi cho tương tác hai loại plasmid này với nhau chúng sẽ liên hợp qua sự trao đổi chéo giữa hai đoạn tương đồng và hình thành nên vector liên hợp. Vector liên hợp này nằm trong vi khuẩn A. tumefaciens và hoạt động theo cơ chế chuyển gen thông thường của vi khuẩn đất. Do tần số đưa plasmid trung gian từ E.coli sang Agrobacterium rất thấp (10-7-10-5) nên vector này ít được sử dụng. Hệ thống vector nhị thể khác với vector liên hợp là chúng có hai vector (plasmid) cùng có mặt và hoạt động trong Agrobacterium. Một plasmid tách dòng từ E.coli trong đó có thiết kế vùng bờ trái và bờ phải, nằm giữa chúng là các gen chỉ thị và vùng gắn gen cần chuyển. Plasmid thứ hai là Ti-plasmid cải tiến: toàn bộ vùng T-DNA và vùng bờ trái và bờ phải bị cắt bỏ chỉ giữ lại vùng vir, plasmid này được gọi là plasmid hỗ trợ. Hệ thống vector này cũng hoạt động theo cơ chế chuyển gen của vi khuẩn đất Agrobacterium một cách rất hữu hiệu [18]. 2.3.3 Đặc điểm ưu việt của phương pháp biến nạp gen ở thực vật so với các phương pháp chọn tạo giống truyền thống Từ xưa đến nay con người đã can thiệp vào các đặc tính di truyền của thực vật bằng chọn giống kinh điển. Theo phương pháp truyền thống này, nhà tạo giống tìm cách tổ hợp lại các gen giữa hai cá thể thực vật nhằm tạo ra con lai mang những tính trạng mong muốn. Phương pháp này được thực hiện bằng cách chuyển hạt phấn từ cây này sang nhuỵ hoa của cây khác. Tuy nhiên phép lai chéo này bị hạn chế bởi nó chỉ có thể thực hiện được giữa các cá thể cùng loài hoặc có họ hàng gần. Phải mất nhiều thời gian mới thu được những kết quả mong muốn và thường là những đặc tính quan tâm lại không tồn tại trong những loài có họ hàng gần. Quá trình biến nạp gen thực hiện trong phòng thí nghiệm, không phụ thuộc nhiều vào thời gian, không gian mùa vụ, thời tiết. Các gen được chuyển có tính trạng đặc thù cao hơn. Các gen tương ứng chính xác với các tính trạng mong muốn được lựa chọn dùng cho quá trình biến nạp, loại bỏ được các tính trạng không mong muốn. Quá trình chuyển một gen mong muốn vào một cá thể diễn ra nhanh hơn nhiều. Chỉ cần sau một thế hệ, tính trạng mong muốn được thể hiện và thu nhận, trong khi các phương pháp truyền thống cần nhiều thế hệ. Mức độ “linh động” của các gen được chuyển lớn hơn nhiều. Nhiều gen của loài này có thể được chuyển vào loài khác và biểu hiện thành các tính trạng hoàn toàn mới. Điều này không thể thực hiện được khi sử dụng các phương pháp tạo giống truyền thống. Trước đây muốn lai tạo được một giống mới thì phải mất rất nhiều năm. Đầu tiên người ta phải tìm ra giống cây dại có mang những đặc tính mong muốn rồi lấy phấn hoa của cây dại này phết lên nhụy hoa của cây họ đang trồng. Nếu thụ phấn thành công thì cây trồng từ hạt của cây này sẽ chứa những gen hữu ích. Nhưng bằng cách này đồng thời cây này cũng mang những gen bất lợi khác. Người ta có thể loại bỏ dần dần những gen xấu đi nhưng phải mất một thời gian dài, có khi hàng 20 – 30 năm mới có một giống cây như ý muốn [3]. Ngày nay với công nghệ chuyển gen đã giúp cho việc chuyển được gen ưu việt vào cây trồng tạo giống mới được thực hiện một cách dễ dàng và nhanh chóng hơn nhiều. Gen được chuyển không phải chỉ từ những gen trên cùng một loài mà có thể lấy gen từ loài có quan hệ rất xa, cũng có thể gen lấy từ động vật, sinh vật khác. Do đó có thể thu nhận được những cây có các tính trạng hoàn toàn mới, điều này không thể thực hiện được ở các phương pháp truyền thống Tăng năng suất nông nghiệp và giảm chi phí sản xuất. Điều này đặc biệt đúng khi các gen được dùng cho biến nạp vào thực vật thường là các gen làm tăng năng suất, giảm thời gian trồng trọt, tăng khả năng trao đổi chấ._.t, kháng các loại sâu bệnh. Nhờ vậy, thời gian, công lao động, vật tư hoá chất dùng cho quá trình sản xuất nông nghiệp sẽ được giảm đi nhiều lần dẫn đến sự giảm chi phí sản xuất và hạn chế ô nhiễm môi trường [18]. 2.4 Phương pháp PCR Thực tế là một cây sau khi biến nạp sinh trưởng trên môi trường chọn lọc thì chưa đủ cơ sở để nói là một biến nạp thành công vì có thể tính kháng xuất hiện tự nhiên do một đột biến trong vật chất di truyền của thực vật. Sau khi chuyển gen cần theo dõi gen chuyển vào cây sẽ được tế bào, đặc biệt là bộ genome của tế bào chủ tiếp nhận như thế nào. Bằng các phương pháp phân tích genome như PCR, Southern Blot, Western Blot và các thí nghiệm khác được thực hiện để tìm ra chính xác những cây biến đổi gen. Để chứng minh DNA được biến nạp vào thực vật thì phương pháp Southern và PCR được sử dụng vì hai phương pháp này rất nhạy cảm. Khi có nhiều mẫu khác nhau và có một lượng rất ít DNA thì khuyếch đại PCR là phương pháp được lựa chọn. Phương pháp này đặc biệt phù hợp cho mục đích kiểm tra và xác định những thay đổi gen ở cây trồng. Phương pháp PCR được Karry Mullis phát minh vào năm 1985 và tiếp tục được hoàn thiện, phát triển thông qua sự phân lập và sản xuất thành công enzym tổng hợp DNA chịu nhiệt từ vi khuẩn Thermus aquaticus và sự thiết kế thành công các máy chu kỳ nhiệt cho phép thay đổi nhanh chóng và chính xác nhiệt độ cho từng giai đoạn phản ứng. Với kỹ thuật này, các đoạn DNA được nhân bội hàng triệu lần với tốc độ nhanh và độ chính xác cao với cặp mồi đặc hiệu. Mẫu không mang gen được chuyển vào thì cặp mồi không bắt cặp, quá trình nhân DNA không xảy ra. Mẫu có mang gen chuyển vào thì cặp mồi bắt cặp và quá trình nhân DNA diễn ra mạnh mẽ. Sau phản ứng trên máy PCR, thu mẫu và đem mẫu đi điện di, đánh giá kết quả. Ngày nay, kỹ thuật PCR được ứng dụng trong nhiều lĩnh vực và được xem như một trong những phương pháp nền quan trọng nhất của công nghệ sinh học hiện đại. Một gen lạ có thể biểu hiện trong tất cả tế bào (DNA lạ biến nạp vào nhiều vị trí khác nhau trong hệ gen) hoặc chỉ trong một số loại tế bào hoặc mô nhất định. Người ta sử dụng những trình tự khởi động phiên mã được gọi là promoter. Mỗi một gen được một promoter điều khiển sự biểu hiện của gen. Một số promoter hoạt động trong phần lớn các tế bào, một số khác có tính chuyên hoá rất cao đối với những loại tế bào nhất định. Trong thực tế phần lớn promoter 35S được sử dụng cho sự biểu hiện của gen biến nạp trong tất cả các loại mô và tế bào. Promoter có nguồn gốc virus nên có hiệu quả phiên mã gen sau khởi động. Promoter CaMV 35S đặc biệt phù hợp cho sự biểu hiện của gen chọn lọc và gen chỉ thị. 2.5 Một số thành tựu và xu hướng phát triển của cây trồng biến đổi gen 2.5.1 Lợi ích của cây chuyển gen Với những lợi ích to lớn và lâu dài cho môi trường, kinh tế và phúc lợi xã hội, không làm ảnh hưởng đến nguồn tài nguyên cho các thế hệ sau, cây trồng chuyển gen tiếp tục được đưa vào canh tác rộng rãi trên thế giới: - Góp phần đảm bảo an ninh lương thực trong tương lai dựa trên quỹ đất hiện có, làm giảm giá lương thực trên thế giới, góp phần xoá đói giảm nghèo. - Bảo tồn đa dạng sinh học. - Cây chuyển gen có lợi tiềm tàng đối với môi trường. Chúng góp phần giảm sói mòn đất, cải thiện chất lượng nước, rừng và nơi cư ngụ của động vật hoang dại. - Tăng hiệu quả quá trình sản xuất nhiên liệu sinh học. - Góp phần ổn định lợi ích kinh tế. Trong 11 năm từ 1996 đến 2006 cây trồng chuyển gen đã tăng thêm thu nhập tới 33,8 tỷ USD (trong đó Hoa Kỳ- 15,8 tỷ; Trung Quốc- 5,8 tỷ; Brazil- 1,9 tỷ; Ấn Độ- 1,3 tỷ; Canada- 1,2 tỷ; Paraguay- 349 triệu; Australia-184 triệu; Nam Phi- 156 triệu; Mexico- 71 triệu; Philippin- 18 triệu; Argentina- 6,6 triệu…). Nhờ dùng cây chuyển gen mà các nước này đã giảm được 286 triệu kg thuốc trừ sâu, cũng có nghĩa là giảm được 15,4% về tác động tổng hợp đối với môi trường. Do sử dụng cây chuyển gen mà giảm nhiên liệu dùng để làm đất, phun thuốc, do đó đã giảm trong năm 2006 được 14,76 tỷ kg khí nhà kính CO2 (tương đương với 6,56 triệu ô tô không tham gia giao thông trong năm này). Gần đây một số thực vật chuyển gen còn được dùng để thu hút kim loại nặng trong đất và làm giải tỏa tình trạng ô nhiễm môi trường bởi kim loại nặng [39]. 2.5.2 Tình hình phát triển cây trồng chuyển gen trên thế giới Sau một thập niên (1985-1995) phát triển công nghệ sinh học cây trồng, đã có 34 nước thông báo về thử nghiệm đồng ruộng đối với cây chuyển gen. Cây trồng đã được chuyển gen bao gồm nhiều loại cây trồng khác nhau như: ngô, bông, đậu tương, thuốc lá, khoai tây, cà chua, lúa gạo, dưa chuột, hoa cúc, bí ngô... Năm 1980, những thí nghiệm chuyển gen đầu tiên nhờ vi khuẩn Agrobacterium tumefaciens vào cây trồng đầu tiên được thực hiện. Năm 1986, các thử nghiệm đầu tiên trồng cây biến đổi gen trên đồng ruộng ở một số quốc gia. Năm 1990, chuyển gen bất dục đực cho ngô bằng súng bắn gen và thực phẩm biến đổi gen được chấp thuận ở Mỹ lần đầu tiên. Năm 1994, giống cà chua Flavor Saver mang gen chín chậm, là sản phẩm cây trồng chuyển gen đầu tiên được thương mại hoá. Năm 2007, diện tích trồng cây chuyển gen đã tăng lên 114,3 triệu ha, 23 nước tham gia trồng cây chuyển gen [31]. Năm 2008, số nước trồng cây chuyển gen đã lên tới 25 nước, một mốc kỷ lục mới. Đặc biệt, trong số 25 nước trồng cây chuyển gen, có 15 nước là các nước đang phát triển so với 10 nước là các nước công nghiệp. Diện tích đất trồng cây chuyển gen đạt 125 triệu ha, tăng so với năm 2007 [32]. Đáng chú ý năm 2008  tất cả 7 nước EU hiện đang trồng giống ngô Bt đã tăng diện tích trồng, tăng 21%, với diện tích canh tác vượt mức 107000 hec-ta. Cây đa tính trạng là nhóm cây trồng chuyển gen tăng số lượng nhanh nhất trong năm 2007 và 2008, với tỉ lệ tăng trưởng 23%, cao hơn nhiều so với cây đơn tính trạng chịu thuốc diệt cỏ (tăng 9%) và kháng sâu bệnh (giảm 6%). Cây đa tính trạng - giống cây trồng chuyển gen ngày càng giữ vị trí quan trọng. Đã có 10 nước trên thế giới trồng những giống cây này trong năm 2008. Làn sóng ứng dụng giống cây trồng đa tính trạng mới này nối tiếp với làn sóng trồng cây trồng chuyển gen đầu tiên, tạo nên sự phát triển nhanh chóng của cây trồng chuyển gen trên toàn thế giới [32]. Đậu tương chuyển gen tiếp tục là giống cây chính được trồng trong năm 2008 với diện tích 65,8 triệu ha, chiếm 53% diện tích đất trồng cây chuyển gen trên toàn cầu, tiếp theo là ngô chuyển gen (37,3 triệu ha, chiếm 30%), bông chuyển gen (15,5 triệu ha, chiếm 12%) và cải canola chuyển gen (5,9 triệu ha, chiếm 5% diện tích đất trồng cây chuyển gen trên toàn cầu) [35]. Hiện nay đã có 25 nước đã cho phép trồng cây chuyển gen và 30 quốc gia khác đã cho phép nhập khẩu các sản phẩm công nghệ sinh học sử dụng làm thực phẩm và thức ăn chăn nuôi, đưa tổng số nước phê chuẩn cây trồng chuyển gen lên 55 nước. Năm 2008 giá trị của thị trường công nghệ sinh học toàn cầu ước tính khoảng 7,5 tỉ đôla, tổng giá trị từ năm 1996 đến 2007 đạt trên 50 tỉ đôla. Dự đoán, đến năm 2015 diện tích đất trồng cây chuyển gen trên toàn cầu sẽ tăng gấp đôi, đạt mức 200 triệu ha [35]. 2.5.3 Tình hình nghiên cứu cây trồng biến đổi gen trong nước Chủ trương của Việt Nam là cho phép trồng cây biến đổi gen và đẩy mạnh việc phát triển loại loại cây trồng này [41]. Theo Quyết định số 11/2006/QĐ-TTg của Chính phủ ngày 11-1-2006, kế hoạch phát triển cây trồng chuyển gen ở Việt Nam với 3 giai đoạn: Giai đoạn 2006 - 2010 thử nghiệm một số giống cây trồng chuyển gen trên đồng ruộng; giai đoạn 2011- 2015 đưa một số giống cây trồng chuyển gen vào sản xuất; đến năm 2020 tăng diện tích một số cây trồng chuyển gen như ngô, bông, đậu tương... sẽ có diện tích từ 30-50% trên toàn quốc [36]. Như vậy, trong tương lai với lợi ích thu được từ cây trồng chuyển gen về mặt kinh tế và xã hội thì diện tích cây trồng chuyển gen của nước ta sẽ được tăng lên. Với chủ trương này, tại một số phòng thí nghiệm lớn đã và đang đi sâu hơn vào công tác cải thiện giống cây trồng bằng kĩ thuật chuyển gen. Hiện nhiều công trình nghiên cứu liên quan đến cây trồng biến đổi gen tại Việt Nam đã được triển khai… trong phòng thí nghiệm. Các nghiên cứu chuyển gen kháng virus đốm vòng vào cây đu đủ, chuyển gen chịu hạn vào cây bông… đã và đang được triển khai hiệu quả, nhưng chỉ trồng thử nghiệm ở nhà kính [38], [41]. Tại Viện Sinh học Nhiệt đới, sử dụng phương pháp chuyển gen thông qua vi khuẩn A. tumefaciens hoặc phương pháp bắn gen, các nhà khoa học đã tạo được các cây thuốc lá, lúa, đậu xanh, cải bông, cải xanh và cây cà tím mang gen kháng côn trùng, kháng thuốc diệt cỏ [42]. Tại Viện Sinh học Nông nghiệp - Đại học Nông nghiệp Hà Nội đã và đang tiến hành các nghiên cứu về chuyển gen cho cây lương thực, cây hoa (chuyển gen kháng sâu, kháng bệnh bạc lá cho cây lúa, chuyển gen Gus, Bar, GFP cho các giống hoa lily, đồng tiền, …) [1], [2], [9], [10], [11]. Tại Viện Công nghệ sinh học, hướng nghiên cứu các giống cây trồng chuyển gen đã được đẩy mạnh ngay từ cuối những năm 1990. Các cán bộ của viện đã tiến hành thu thập và phân lập được nhiều nguồn gen quý có giá trị nông nghiệp như gen chịu hạn, lạnh ở lúa (Cry), gen mã hóa protein bất hoạt hóa riboxom (RIP) ở cây mướp đắng và gen mã hóa α-amylase của cây đậu cove có hoạt tính diệt côn trùng, gen kháng bọ hà khoai lang của vi khuẩn Bt, gen mã hoá protein vỏ của virus gây bệnh đốm vòng ở đu đủ… Tại Bộ Nông nghiệp và phát triển nông thôn, Lã Tuấn Nghĩa và cộng sự đã chuyển gen Gus và gen kháng kanamycin vào cà chua [33]. Phan Tố Phượng và cộng sự đã thành công trong việc sử dụng phương pháp gián tiếp qua vi khuẩn A.tumefaciens để chuyển gen vào cây Arabidopsis. Gần đây, nhóm nghiên cứu của Đặng Trọng Lương đã tiến hành thiết kế vector và chuyển gen Cry vào cây cải bắp, chuyển gen Gus vào đỉnh sinh trưởng phôi hạt chín giống đậu tương ĐT12 thông qua vi khuẩn A.tumefaciens [16]. Các nghiên cứu chuyển gen kháng thuốc diệt cỏ và kháng bệnh khô vằn vào giống lúa DT10, DT13; gen kháng bệnh bạc lá vào giống lúa VL902; gen kháng sâu tơ vào cải bắp CB26; gen Cry, Gna, Xa21 và gen mã hoá β-caroten vào lúa Indica… đã và đang được triển khai với những kết quả khả quan. Sở Khoa học và công nghệ TP.HCM vừa đồng ý nghiệm thu đề tài: Nghiên cứu chuyển gen tạo năng suất và kéo dài thời gian bảo quản đối với cây bắp cải, đồng thời yêu cầu sớm đưa vào áp dụng trong thực tế. Với mức kinh phí được cấp là 50 triệu đồng, đề tài nói trên được thực hiện với mục đích kéo dài quá trình già hoá ở lá của cây được chuyển gen, giúp kéo dài thời gian bảo quản, tăng năng suất và chất lượng cây trồng. Vật liệu dùng để nghiên cứu chuyển gen là hạt giống bắp cải Brassica olera Var. Capitata F1 TN5, do Công ty Trang Nông cung cấp [40]. Cũng tại buổi hội thảo “Công nghệ sinh học cho cây trồng ở Việt Nam: Hướng phát triển cho tương lai”, các chuyên gia trong lĩnh vực công nghệ sinh học Việt Nam cũng có những báo cáo về việc nghiên cứu chuyển gen như “Nghiên cứu chuyển nạp gen ở đậu tương và tạo dòng đậu tương biến đổi gen kháng sâu” của TS. Trần Thị Cúc Hoa (Viện lúa Đồng bằng Cửu Long); “Nghiên cứu khả năng làm tăng tuổi thọ hoa cúc nhờ chuyển gen IPT tạo cytokinin” của tác giả Nguyễn Hữu Hồ và cộng sự (Viện Sinh học nhiệt đới)…[43]. 2.5.4 Các nghiên cứu về cây hoa loa kèn L. Longiflorum trên thế giới 2.5.4.1 Các nghiên cứu về sự tái sinh in vitro Các nghiên cứu ứng dụng kỹ thuật nuôi cấy in vitro cho cây hoa loa kèn nhằm nhân nhanh các giống sạch bệnh đã được nhiều nhà khoa nghiên cứu. Trong các nghiên cứu cơ bản ban đầu, hoa loa kèn có thể được tiến hành nuôi cấy trên rất nhiều bộ phận khác nhau như đỉnh sinh trưởng, đoạn thân, vảy củ, mô lá, bầu hoa, cánh hoa, chỉ nhị, ... Asjes và cộng sự (1974) đã ứng dụng thành công kỹ thuật nuôi cấy meristem để tạo ra các giống hoa loa kèn hoàn toàn sạch virus ở Hà Lan. Năm 1979, Ramsay-J-L và cộng sự cũng tiến hành nuôi cấy bầu hoa của hoa loa kèn thành công trên môi trường MS + 5% đường + 1ppm 2,4D + 2ppm BA. Các nhà nghiên cứu người Mỹ Wickremesinhe-E và cộng sự (1995) đã tạo được mô sẹo từ mô lá non của hoa loa kèn khi nuôi cấy trên môi trường MS có bổ sung B5, 20g/l saccazose, 1ppm 2,4D, 1ppm BA, và 2,0g/l Gelrite trong điều kiện bóng tối hoặc chiếu sáng 16h ở nhiệt độ 250C. Sau 3 tuần cấy chuyển sang môi trường 0,1ppm 2,4D + 0-5ppm BA, các mô sẹo bắt đầu phát sinh cơ quan [20]. Qua nhiều nghiên cứu của các tác giả như: W.P.Hackett (1969), Allen (1974), J.A.Simmondds & B.G.Cumming (1976) [20], Stimart & Ascher (1978) [28], S.M.Robb (1957), … đã khẳng định vảy củ là nguyên liệu tốt nhất cho việc tái sinh chồi. Năm 1993, kết quả nghiên cứu của IIcheva-V và cộng sự tại Bungari cũng đã khẳng định vảy củ là nguyên liệu tốt nhất cho việc tái sinh chồi trực tiếp từ mô nuôi cấy mà không cần qua giai đoạn mô sẹo khi được cấy trên môi trường Linsmaier và Skoog có bổ sung 0,5mg/l NAA và 0,1mg/l Kinetin. Các cây được hình thành đều mang số nhiễm sắc thể của loài [23]. Vì vậy sử dụng vảy củ làm nguyên liệu chính cho nuôi cấy in vitro tạo mô sẹo phục vụ trong công tác chuyển gen hay tạo chồi khi sản xuất cây giống rất tiện lợi, dễ thành công, có hiệu quả cao hơn nhiều so với việc sử dụng các bộ phận khác của cây hoa loa kèn. 2.5.4.2 Các nghiên cứu về chuyển gen Trong vấn đề tạo giống hoa loa kèn mới sử dụng các phương pháp chuyển gen cũng được nhiều nhà khoa học nghiên cứu và đã đạt được các thành công nhất định Năm 1998 Watad A.A. và cộng sự đã tạo thành công cây Lilium longiflorum thông qua hệ thống bắn gen Biolicstics PDS 1000/He vào callus tái sinh từ vảy củ [30]. Năm 2002, tại Triều Tiên, In-Hae Park, Hee-Sung Park chuyển gen thành công vào phấn hoa loa kèn L.longiflorum in vitro sử dụng Agrobacterium mang gen Gus. Trong thí nghiệm sử dụng chủng vi khuẩn A. tumefaciens pBI121 [24]. Năm 2002, Lipsky A. và cộng sự đã tạo được cây L. longiflorum Thunb kháng virus (CMV) nhờ kỹ thuật bắn gen. Callus xuất phát từ vảy củ có độ đồng đều thấp sau 6 tháng cấy chuyển. Nghiên cứu chuyển gen đã được thực hiện bằng sử dụng thiết bị bắn gen Finer – type bombardment trên callus 3 hoặc 10 tháng được duy trì trong môi trường lỏng ở điều kiện bóng tối. Callus nuôi cấy trên môi trường lỏng cho phép thu được cây chuyển gen bền vững cao hơn 50- 70 lần so với môi trường đặc [26]. Cùng năm 2002, tại Nhật Bản, Sakea Suzuki, Masaru Nakano chuyển gen vào một số cây trồng thuộc họ Liliaceae gồm có: Lilium formosanum, Agapanthus praecox spp. orientalis và Muscari armeniacum. Trong nghiên cứu sử dụng các chủng vi khuẩn chuyển gen A.tumefaciens mang các gen cần chuyển neomycin phosphotransferase II (nptII), hygromycin phosphotransferase (hpt), and intron-containing -glucuronidase (gus-intron) đó là các chủng: EHA101/pIG121Hm, LBA4404/pIG121Hm, và LBA4404/pIOK233 (Sakea Suzuki & Masaru Nakano, 2002). Kết quả nghiên cứu đã không thu được mô chuyển gen trên giống Lilium formosanum mặc dù có biểu hiện tạm thời của gen Gus ở callus trong quá trình đồng nuôi cấy. Tuy nhiên, đã thu được một số cụm tế bào có kháng hygromycin của giống Agapanthus prarcox ssp. orientalis và Muscarri armeniacum trên môi trường có bổ sung hygromycin. Callus kháng hygromycin đã tái sinh tạo cây hoàn chỉnh qua phôi soma, hầu hết trong số chúng được xác định là cây chuyển gen dựa trên phép thử Gus histochemical assay và phân tích PCR. Bằng lai Southrn Blot đã phát hiện 1-5 bản sao của gen trong bộ gen của cây chuyển gen của hai giống, trong đó hầu hết là có một hoặc hai bản sao. Hệ thống chuyển gen này có thể là một công cụ để phát triển trong nghiên cứu về sinh học phân tử [28]. Năm 2003, A.Mercuri và cộng sự (Đức) chuyển gen thành công vào chỉ nhị và đế hoa của Lilium longiflorum Thunb. cultivar 'Snow Queen' sử dụng chủng vi khuẩn A.tumefaciens LBA4404 mang vector pBin18, vùng T-DNA được tách dòng từ EcoRI15 mang ORFs 10, 11 và 12 tương ứng với torol A, B và C, được cắt từ Agrobacterium rhizogenes pRi 1855. Callus phát sinh phôi xuất phát từ vòi nhụy và cuống đã được cấy và đồng nuôi cấy trong 7 ngày với huyền phù của vi khuẩn Agrobacterium LBA4404, mang binary vector pBin 19 bao gồm nptII gen được điều khiển bởi Nos promoter và các đoạn giới hạn T – DNA EcoRI 15, bao gồm Os11 và 12 tương ứng với rol A, B và C được cắt từ A. rhizogenes pRI 1855. Các chồi chuyển gen đã được tái sinh trên môi trường chọn lọc và dễ dàng nhân nhanh, ra rễ và chuyển ra đất. Có sự đa dạng về kiểu hình của các dòng chuyển gen [27]. Năm 2004, Y.Hoshi và cộng sự (Nhật Bản) đã chuyển gen thành công vào Oriental hybrid lily, Lilium cv. Acapulco bằng chủng vi khuẩn A.tumefaciens EHA101/pIG121Hm mang các gen nptII, hpt và gen Gus. Kết quả đã thu được 6 dòng lily kháng Hyg từ hơn 200 callus bằng cách làm tổn thương callus với giấy giáp trước khi đồng nuôi cấy. Callus được nuôi cấy trên môi trường MS không có NH4NO3, sử dụng Hyg trong môi trường chọn lọc. Các dòng tái sinh kháng Hyg tạo chồi sau đó phát triển thành cây khi chuyển sang môi trường MS không bổ sung chất điều tiết sinh trưỏng. Tất cả các cây được kết luận chuyển gen nhờ Gus histochemical assay và phân tích PCR [22]. Năm 2004, các tác giả Byung Jooon Ahn và cộng sự đã chuyển gen bằng súng bắn gen cho huyền phù tế bào của hoa Easter lily (Lilium longiflorum). Sự biểu hiện tạm thời của gen uidA xuất hiện ở 493 tế bào/ đĩa petri. Để chuyển gen bền vững, huyền phù tế bào của lilium longflorum được bắn với plasmid bao gồm cucumber mosaic virus (CMV) replicase được điều khiển bởi Act, 1 promotor và gen Bar đã được điều khiển bởi CaMV promotor, 10 cây tái sinh đã được phân tích bởi PCR, 2 trong 10 cây đã được khẳng định chuyển gen nhờ lai Southern Blot. Hai cây chuyển gen được chuyển độc lập trong đó có một cây mang gen Bar, một cây mang cả hai gen gồm CMV replicase và gen Bar. Các cây này đã được xác định là có khả năng kháng PPT ở nồng độ 1000mg/l ở giai đoạn nở hoa chứng tỏ gen Bar đã được biểu hiện ở toàn bộ là khi được điều khiển bởi CaMV 35S promtor. Năm 2007, Kim Sung Su và cộng sự đã chuyển gen thành công cho loài hoa Lilium longiflorum L. qua sự biểu hiện tạm thời của β-glucuronidase bằng vi khuẩn Agrobacterium [25]. Trong những năm gần đây đã có nhiều nghiên cứu thành công về phương pháp biến nạp gen bằng vi khuẩn Agrobacterium trên một số loài Lilium. Đây cũng chính là những tiền đề cho nghiên cứu chuyển gen vào mô tế bào của loài Lilium longiflorum. 2.5.5 Các nghiên cứu về cây hoa loa kèn L. Longiflorum ở Việt Nam Ở Việt Nam, cũng đã có những nghiên cứu về hoa loa kèn và đạt được những thành công nhất định trong nhân nhanh, tái sinh và bước đầu trong nghiên cứu chuyển gen cho cây hoa loa kèn. 2.5.5.1 Các nghiên cứu về sự tái sinh in vitro Dương Tấn Nhựt (1994) đã công bố kết quả nghiên cứu phương pháp nuôi cấy in vitro vảy củ, một giải pháp hữu hiệu khắc phục hiện tượng thoái hoá giống hoa huệ tây trầm trọng tại Đà Lạt. Vảy củ được khử trùng bằng HgCl2 2% trong 5 phút, sau đó cấy trên môi trường MS có bổ sung các thành phần vitamin, chất hữu cơ và saccazose. Sau khi tạo được cây con trong ống nghiệm, có thể tiếp tục nhân bằng cách tách các vảy củ được tạo thành đem cấy trên môi trường nhân [15]. Bùi Văn Lệ và cộng sự (1999) đã nghiên cứu tái sinh chồi in vitro từ lát cắt mỏng mô vảy củ Lilium longiflorum. Cùng năm ông đã nghiên cứu tái sinh chồi thành cây hoàn chỉnh từ đế hoa phục vụ cho việc nhân nhanh [10]. Năm 2001, Dương Tấn Nhựt đã nghiên cứu tái sinh callus, tái sinh tạo chồi thành cây hoàn chỉnh, nghiên cứu ảnh hưởng của chất điều tiết sinh trưởng (NAA, BA, 2,4D...) tới khả năng tái sinh của mô vảy củ L.longiflorum [15]. Nguyễn Thị Nhẫn, Nguyễn Quang Thạch, Nguyễn Thị Phương Thảo (1999) đã xây dựng quy trình nhân giống cây hoa loa kèn bằng kỹ thuật tạo củ trong ống nghiệm [14]. 2.5.5.2 Các nghiên cứu về chuyển gen Nghiên cứu chuyển gen cho cây hoa loa kèn L.longiflorum mới chỉ được thực hiện tại Viện Sinh học Nông nghiệp - Trường Đại học Nông nghiệp Hà Nội, nghiên cứu chuyển được gen GFP, gen Gus, gen Bar cho hoa loa kèn L.longiflorum [1],[2]. Đề tài: “Nghiên cứu xây dựng quy trình chuyển gen vào cây hoa loa kèn “Lilium longiflorum” bằng vi khuẩn Agrobacterium tumefaciens”góp phần xây dựng được quy trình chuyển gen vào cây hoa loa kèn, làm cơ sở cho việc tiếp tục chuyển các gen mong muốn khác vào cây hoa loa kèn và cây hoa lily nói chung. Kết quả của đề tài sẽ làm tiền đề và thúc đẩy việc ứng dụng phương pháp chuyển gen trong công tác chọn tạo giống cây trồng ở Việt Nam. 3. NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1 Đối tượng, vật liệu, địa điểm và thời gian nghiên cứu * Đối tượng: Giống hoa loa kèn “Lilium longiflorum”, giống địa phương được trồng phổ biến ở miền Bắc Việt Nam. - Vectơ sử dụng để chuyển các gen mục tiêu: chủng EHA 105 mang vectơ ITB2c mang các gen Gus, Bar, CryIA(c) do Viện Sinh học Nhiệt đới TP HCM- VKHVN cung cấp. Hình 3.3. Sơ đồ cấu trúc plasmid ITB2c * Địa điểm thực tập: Viện Sinh học Nông nghiệp – Trường Đại học Nông nghiệp Hà Nội * Thời gian thực tập: Từ 01/6/2008 – 01/7/2009 3.2 Nội dung và phương pháp nghiên cứu 3.2.1 Nội dung nghiên cứu 3.2.1.1 Thí nghiệm 1 Ảnh hưởng của nguồn mẫu cấy đến khả năng chuyển gen của vi khuẩn Agrobacterium tumefasciens. Công thức Nguồn mẫu cấy Ghi chú 1 Đối chứng (không lây nhiễm với vi khuẩn)callus, vảy củ, đỉnh chồi TNC: 3 ngày, ĐNC: 3 ngày Lây nhiễm: ngâm trong dịch vi khuẩn 5 phút, đồng nuôi cấy Lượng mẫu: 450 mẫu/công thức 2 Vảy củ 3 Callus 4 Protocorm Từ kết quả thí nghiệm trên rút ra công thức tốt nhất làm thí nghiệm tiếp theo. 3.2.1.2 Thí nghiệm 2 Nghiên cứu ảnh hưởng của thời gian tiền nuôi cấy đến khả năng chuyển gen của vi khuẩn A.tumefaciens. Công thức Thời gian tiền nuôi cấy (ngày) Ghi chú 1 ĐC (không nhiễm khuẩn) Nguồn mẫu: loại mẫu tốt nhất từ thí nghiệm 1 Lây nhiễm: ngâm trong dịch vi khuẩn 5 phút, đồng nuôi cấy Lượng mẫu: 450 mẫu/công thức ĐNC: 5 ngày 2 0 3 1 4 3 5 5 6 7 Từ kết quả thí nghiệm trên rút ra công thức tốt nhất làm thí nghiệm tiếp theo. 3.2.1.3 Thí nghiệm 3 Ảnh hưởng của phương pháp cắt và lây nhiễm mẫu đến khả năng chuyển gen của vi khuẩn Agrobacterium tumefasciens - Cách 1. Mẫu cấy được cắt trên giấy khô sau đó ngâm vào dung dịch vi khuẩn trong thời gian 5 phút sau đó vớt ra, để khô trên giấy thấm vô trùng. - Cách 2. Mẫu cấy được cắt trên giấy khô, cấy trên môi trường đồng nuôi cấy, sau đó dùng micropipet hút dịch vi khuẩn trên nhỏ vào mẫu, mỗi mẫu cấy chỉ nhỏ 10ml dung dịch vi khuẩn. - Cách 3: Mẫu cấy được cắt trong môi trường đồng nuôi cấy, sau đó chuyển sang lây nhiễm trong dịch vi khuẩn trong 5 phút. - Cách 4: Mẫu cấy được cắt trong môi trường đồng nuôi cấy, sau đó cấy trên môi trường đồng nuôi cấy, rồi dùng micropipet hút dịch vi khuẩn trên nhỏ vào mẫu, mỗi mẫu cấy chỉ nhỏ 10ml dung dịch vi khuẩn. - Cách 5: Mẫu cấy được cắt trong môi trường đồng nuôi cấy có vi khuẩn pha loãng. Công thức Cách lây nhiễm Ghi chú 1 ĐC (không nhiễm khuẩn) Nguồn mẫu: loại mẫu tốt nhất từ thí nghiệm 1 Lượng mẫu: 450 mẫu/công thức. TNC: thời gian tiền nuôi cấy tốt nhất từ thí nghiệm 2 ĐNC: 3 ngày 2 Cách 1 3 Cách 2 4 Cách 3 5 Cách 4 6 Cách 5 Từ kết quả thí nghiệm trên rút ra công thức tốt nhất làm thí nghiệm tiếp theo. 3.2.1.4 Thí nghiệm 4 Nghiên cứu ảnh hưởng của thời gian đồng nuôi cấy đến khả năng chuyển gen của vi khuẩn Agrobacterium tumefasciens Công thức Thời gian đồng nuôi cấy (ngày) Ghi chú 1 Đối chứng (không nhiễm khuẩn) Nguồn mẫu: loại mẫu tốt nhất từ thí nghiệm 1 Cách lây nhiễm: cách lây nhiễm tốt nhất từ thí nghiệm 3 Tiền nuôi cấy: thời gian tiền nuôi cấy tốt nhất từ thí nghiệm 2 Lượng mẫu: 450 mẫu/công thức 2 1 3 3 4 5 5 7 3.2.1.5 Thí nghiệm 5 Đánh giá tác động tổ hợp của các công thức tối ưu tới khả năng chuyển gen của vi khuẩn Agrobacterium tumefasciens Công thức Phương pháp Ghi chú CT1 ĐC (không nhiễm khuẩn) - Nguồn mẫu: callus - Vi khuẩn mang gen kháng PTT - Lượng mẫu: 450 mẫu/công thức CT2 Tổ hợp các công thức tối ưu 3.2.2 Phương pháp nghiên cứu 3.2.2.1 Cách bố trí thí nghiệm Thí nghiệm được thiết kế hoàn toàn ngẫu nhiên, mỗi công thức được bố trí 3 lần nhắc lại, mỗi lần nhắc lại 150 mẫu. 3.2.2.2 Điều kiện tiến hành thí nghiệm - Phòng nuôi cấy mô có điều kiện: + Cường độ ánh sáng: 2000 – 3000 lux + Nhiệt độ: 24 – 27oC + Chu kỳ chiếu sáng: 16 giờ chiếu sáng/8giờ tối. 3.2.2.3 Phương pháp nghiên cứu - Sử dụng phương pháp nuôi cấy mô hiện hành. - Các loại môi trường sử dụng: * Môi trường cơ bản MS (Muraskige & Skoog 1962) (phụ lục). * Môi trường đồng nuôi cấy đặc: MS (không có NH4NO3) + 20mg/l AS + 20g/l saccharose + 10g/l glucose + 10mM/l MES + 0.25mg/l BA + 1g/l cassamino acid + 700mg/l L-asparagine monohydrate + 700mg/l L-glutamine + 7g/l agar. pH = 6. * Môi trường pha loãng vi khuẩn: MS (không có NH4NO3) + 20mg/l AS + 20g/l saccharose + 10g/l glucose + 10mM/l MES + 0.25mg/l BA + 1g/l cassamino acid + 700mg/l L-asparagine monohydrate + 700mg/l L-glutamine. pH = 6. * Môi trường nuôi cấy vi khuẩn (LB): 10g/l Tripton + 10g/l NaCl + 5g/l cao nấm men. pH = 7 * Môi trường tái sinh chồi: MS + 0.25mg/l BA + 20g/l saccharose + 7g/l agar. pH = 5.8 * Môi trường diệt khuẩn: môi trường tái sinh chồi + 500mg/l cefotaxime. pH = 5.8 * Môi trường chọn lọc các mẫu mô (callus, protocorm, vảy củ): MS + 60g/l saccharose + 10g/l glucose + 0.25 mg/l BA + 2.5mg/l PPT + 7g/l agar. pH = 5.8 Môi trường trước khi sử dụng được hấp khử trùng ở nhiệt độ 121oC trong vòng 20 phút. - Các bước chuyển gen cho hoa loa kèn trắng nhờ vi khuẩn A.tumefaciens. * Bước 1: Nuôi cấy vi khuẩn và chuẩn bị huyền phù vi khuẩn. Nuôi vi khuẩn trên môi trường LB lỏng (280C, 17- 19 giờ, và được lắc trên máy lắc 200 vòng/phút. Chuẩn bị môi trường dùng để pha loãng vi khuẩn, bổ xung 20mg/l AS (Acetosyringon) Dung dịch vi khuẩn được ly tâm để lấy sinh khối ở tốc độ 5000 vòng/phút trong 10 phút ở điều kiện nhiệt độ phòng. * Bước 2: Chuẩn bị mẫu lây nhiễm: Callus được cắt thành các lớp có kích thước 5x5x2 mm (dài, rộng, cao) Protocorm Vảy củ: cắt bỏ phần lá trên và phần gốc, sau đó mẫu được cắt thành các lớp mỏng có chiều dày 0.5 – 1 mm * Bước 3: Nhiễm mẫu với vi khuẩn mẫu (Thí nghiệm 3). * Bước 4: Mẫu sau khi lây nhiễm được nuôi cấy trên môi trường đồng nuôi cấy theo các công thức ở thí nghiệm 4. Mẫu được dặt trong tối ở điều kiện 22 – 24oC. * Bước 5: Rửa khuẩn Vi khuẩn được rửa bằng nước cất vô trùng hoặc môi trường MS vô trùng có bổ xung cefotaxime với nồng độ 500mg/l. Mẫu được rửa 2 – 3 lần, sau đó rửa bằng nước cất vô trùng (hoặc MS vô trùng) 1 lần nữa, thao tác cần nhanh (trong vòng 30 giây đến 1 phút một lần rửa),chính xác, tránh lẫn tạp. * Bước 6: Chuyển mẫu qua môi trường tái sinh có bổ sung kháng sinh. Mẫu cấy được rửa sạch vi khuẩn, để ráo nước trên giấy thấm vô trùng, sau đó được cấy vào môi trường tái sinh có bổ sung 500g/l cefotaxime. * Bước 7: Kiểm tra mẫu chuyển gen. - Kiểm tra sự biểu hiện tạm thời của gen chỉ thị Gus bằng dung dịch X-gluc theo phương pháp của Jefferson (1987): ngâm mẫu với dung dịch X-gluc khoảng 15 giờ 37oC trong bóng tối, mẫu chuyển gen sẽ có màu xanh chàm đặc trưng, còn mẫu đối chứng sẽ không chuyển màu. - Kiểm tra sự biểu hiện gen chọn lọc Bar Khảo sát khả năng sống của mô hoa loa kèn in vitro sau 8 tuần trên môi trường có bổ sung PPT. Mẫu được cấy chuyển định kỳ 2 hoặc 3 tuần/lần sang môi trường mới. Lặp lại thao tác cấy chuyển trên môi trường chọn lọc trong 2 tháng. Các mẫu có mang gen Bar sẽ sống và tái sinh trên môi trường chọn lọc sau 8 tuần nuôi cấy. * Bước 8: Xác định sự có mặt của gen chuyển vào bằng phương pháp PCR + Chiết tách DNA - Nghiền lá bằng chày cối sứ: 0,1g lá + 350 μm DNA extraction buffer - Tiếp tục nghiền - Thêm vào 350 μl DNA extraction buffer trộn đều chuyển sang ống mới + 10μl ARNase + 2 μl β – mercaptoethanol - Trộn đều ủ ở 370C trong 1 giờ; khoảng 5 – 10 phút đảo một lần. - Thêm 700 μl dung dịch Chloroform : Isoamyl alcohol (24:1) trộn đều và ly tâm 8000vòng/phút trong 10 phút. - Chuyển dung dịch trên sang ống mới và tiếp tục lặp lại bước 5 và 6. - Thêm 800 μl cồn 100% (để DNA kết tủa) rồi trộn đều, ly tâm 3 – 5 phút (1300 vòng/phút trong 5 phút). - Rửa = cồn 700C 3 lần rồi phơi khô khoảng 30 phút - Hoà với TE rồi giữ ở - 200C + Quy trình chạy PCR * Trình tự mồi: Mồi xuôi: CACTACAAATGCCATCATTGCGATA Mồi ngược: CTTATATAGAGGAAGGGTCTTGCGA * Thành phần phản ứng Thành phần Thể tích (μl) DNA 2 Nước đề ion (H2O cất 2 lần) 8,2 Buffer (10X) 1,5 Mg2+25μM 1 dNTP10µM 0,3 Mồi xuôi nồng độ 10µM 0,5 Mồi ngược nồng độ 10µM 0,5 taq Polymerase 1U 1 Σ = 15μl * Chu trình chạy PCR - Chu kỳ đầu: bước 1: 950C 5 phút, bước 2: 58-600C trong 1phút 30giây, bước 3: 720C trong  1 phút - Chu kỳ 2: bước 1: 950C 40 giây, bước 2 và bước 3: tương tự chu kì đầu. Chu kì 2 lặp lại 35 lần. - Chu kỳ cuối: bước 1 và bước 2: tương tự chu kỳ 2, bước 3: 720C trong 5 phút. Sau đó sản phẩm PCR được giữ ổn định ở 40C trước khi điện di * Chạy điện di : nồng độ agarose 1%, hiệu điện thế 150vol, trong 15phút, thang DNA chuẩn 1000bp. * Các chỉ tiêu theo dõi: ∑ số mẫu mọc khuẩn Tỷ lệ mẫu mọc khuẩn (%) = x100% ∑ số mẫu lây nhiễm ∑ số mẫu sống sau diệt khuẩn Tỷ lệ sống sau diệt khuẩn (%) = x 100% ∑ số mẫu sau rửa khuẩn ∑ số mẫu biểu hiện gen gus Tỷ lệ mẫu biểu hiện gen gus (%) = x 100% ∑ số mẫu đem kiểm tra ∑ số mẫu sống sau chọn lọc Tỷ lệ mẫu sống sau CL (%) = x 100% ∑ số mẫu đưa vào chọn lọc ∑ số mẫu TS sau chọn lọc Tỷ lệ mẫu TS sau CL (%) = x 100% ∑ số mẫu sống sau chọn lọc Σ Chồi thu được Số chồi trung bình/mẫu = ———————— Σ Mẫu sống sau CL ∑ chiều cao chồi khoẻ đo được sau CL Chiều cao TB (cm) = ∑ số chồi khoẻ thu được sau CL ∑ Số lá trên chồi khoẻ sau CL Số lá TB (lá/chồi) = ∑ số chồi khoẻ thu được sau CL Phương pháp xử lý số liệu: Số liệu được xử lý bằng phần mềm Excel và IRRISTAT 4.0 4. KẾT QUẢ VÀ THẢO LUẬN 4.1 Thí nghiệm 1: Nghiên cứu ảnh hưởng của nguồn mẫu cấy đến khả năng chuyển gen của vi khuẩn Agrobacterium tumefasciens. Nguồn vật liệu sử dụng cho quá trình biến nạp ảnh hưởng rất lớn đến khả năng chuyển gen và hiệu qủa chuyển gen của vi khuẩn. Vì vậy chúng tôi tiến hành nghiên cứu._.

Các file đính kèm theo tài liệu này:

  • docLuận văn up.doc
Tài liệu liên quan