Tình hình Hội chứng rối loạn hô hấp và sinh sản ở lợn trên địa bàn tỉnh Bắc Giang và một số chỉ tiêu năng suất sinh sản của đàn lợn nái sau dịch

Tài liệu Tình hình Hội chứng rối loạn hô hấp và sinh sản ở lợn trên địa bàn tỉnh Bắc Giang và một số chỉ tiêu năng suất sinh sản của đàn lợn nái sau dịch: ... Ebook Tình hình Hội chứng rối loạn hô hấp và sinh sản ở lợn trên địa bàn tỉnh Bắc Giang và một số chỉ tiêu năng suất sinh sản của đàn lợn nái sau dịch

doc73 trang | Chia sẻ: huyen82 | Ngày: 09/12/2013 | Lượt xem: 1483 | Lượt tải: 6download
Tóm tắt tài liệu Tình hình Hội chứng rối loạn hô hấp và sinh sản ở lợn trên địa bàn tỉnh Bắc Giang và một số chỉ tiêu năng suất sinh sản của đàn lợn nái sau dịch, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
1. MỞ ĐẦU 1.1. ĐẶT VẤN ĐỀ Bắc Giang là một tỉnh miền núi trung du thuộc vùng Đông Bắc Bắc Bộ, vùng chuyển tiếp giữa rừng núi phía bắc với châu thổ sông Hồng ở phía nam. Với sự đa dạng về khí hậu theo các tiểu vùng nên Bắc Giang có điều kiện thuận lợi để phát triển một nền nông nghiệp hàng hoá. Mô hình vườn - ao - chuồng (VAC), mô hình vườn - đồi, mô hình trang trại cây ăn quả và cây lấy gỗ kết hợp với chăn nuôi trâu, bò trên đất lâm nghiệp đang phát triển mạnh ở các huyện trong tỉnh. Bắc Giang có ngành chăn nuôi phát triển mạnh, đến nay tổng đàn lợn đạt trên 1 triệu con, tăng 4,8% so với năm 2007, đứng thứ nhất vùng Đông Bắc và thứ 16 toàn quốc; đàn trâu trên 87 ngàn con, giảm 4,2%; đàn bò trên 149 ngàn con, tăng 0,7%; đàn gia cầm trên 12 triệu con, tăng 9,9% so năm 2007, xếp thứ nhất vùng Đông Bắc và thứ 3 toàn quốc. Giá trị ngành chăn nuôi chiếm 39,6 % trong ngành nông nghiệp. Năm 2007 và 2009, Bắc Giang đã xảy ra hội chứng rối loạn hô hấp và sinh sản ở lợn (Porcine 8 and respiratory syndrome - PRRS) gây tổn thất nặng nề cho ngành chăn nuôi lợn tại địa phương. Đây là một bệnh truyền nhiễm nguy hiểm đối với lợn, gây ra do virut. Do dịch bệnh mới xuất hiện lần đầu trên địa bàn nên người chăn nuôi và cán bộ thú y chưa xác định ngay được biện pháp phòng chống hữu hiệu, kịp thời, các biện pháp phòng chống dịch còn nhiều hạn chế. Bệnh lây lan nhanh, diễn biến phức tạp và làm chết nhiều lợn, chủ yếu do nhiễm trùng kế phát và gây tổn hại rất lớn cho ngành chăn nuôi và nền kinh tế nói chung. Hiện nay hội chứng này đã trở thành dịch địa phương ở nhiều nước trên thế giới. Lợn ở các lứa tuổi đều có thể cảm nhiễm virut. Tại các cơ sở chăn nuôi công nghiệp với quy mô lớn, bệnh thường lây lan rộng tồn tại lâu dài trong đàn nái. Do vậy thực tế các biện pháp khống chế, thanh toán dịch bệnh gặp rất nhiều khó khăn. Lợn nái thường truyền mầm bệnh cho bào thai, gây sảy thai, thai chết lưu và lợn chết yểu với tỷ lệ cao. Lợn rừng ở các lứa tuổi khác nhau đều có thể cảm nhiễm virut. Việc nắm rõ tình hình bệnh, những di chứng để lại đối với đàn nái và đực giống sau khi dịch xảy ra là một trong những khâu quan trọng trong công tác phòng chống dịch nhằm giảm thiểu những tổn thất không đáng có do bệnh gây ra trong chăn nuôi. Xuất phát từ những yêu cầu thực tế trên chúng tôi tiến hành thực hiện đề tài: “Tình hình Hội chứng rối loạn hô hấp và sinh sản ở lợn trên địa bàn tỉnh Bắc Giang và một số chỉ tiêu năng suất sinh sản của đàn lợn nái sau dịch” 1.2. MỤC ĐÍCH VÀ YÊU CẦU CỦA ĐỀ TÀI - Đánh giá tình hình dịch tễ của PRRS trên địa bàn tỉnh Bắc Giang. - Xác định những di chứng sau dịch đối với những lợn nái trong đàn lợn mắc hội chứng rối loạn hô hấp và sinh sản tại một số trại chăn nuôi trên địa bàn tỉnh. Trên cơ sở dữ liệu nghiên cứu đề xuất phương án phòng chống dịch bệnh hiệu quả. 1.3. Ý NGHĨA KHOA HỌC VÀ THỰC TIỄN CỦA ĐỀ TÀI Từ những kết quả nghiên cứu đạt được góp phần làm rõ tình hình hội chứng rối loạn hô hấp và sinh sản ở đàn lợn nói chung: - Khẳng định những ảnh hưởng lâu dài của bệnh đến năng suất sinh sản của đàn lợn nái sau dịch. - Kết quả của đề tài sẽ là cơ sở khoa học cho việc xây dựng những biện pháp phòng, chống dịch có hiệu quả. Giúp các cơ sở sản xuất con giống thấy rõ việc nên hay không nên tiếp tục giữ lại những nái khỏi bệnh lâm sàng, nái nghi lây bệnh để làm giống. 2. TỔNG QUAN TÀI LIỆU 2.1. LỊCH SỬ HỘI CHỨNG RỐI LOẠN HÔ HẤP VÀ SINH SẢN 2.1.1. Khái quát chung Hội chứng rối loạn hô hấp và sinh sản ở lợn (PRRS: Porcine Reproductive and Respiratory Syndome) còn gọi là “ bệnh lợn tai xanh”, là một bệnh truyền nhiễm nguy hiểm đối với loài lợn (kể cả lợn rừng), gây ra bởi virut Lelystad. Bệnh lây lan nhanh với các biểu hiện đặc trưng viêm đường hô hấp rất nặng như: sốt, ho, thở khó, ở lợn nái có các rối loạn sinh sản: sảy thai, thai chết lưu, lợn sơ sinh chết yểu. Theo tổ chức Lương thực và Nông nghiệp Liên Hợp Quốc (FAO) xác định bệnh không lây truyền sang gia súc khác và con người. Bệnh được gọi bằng nhiều tên khác nhau dựa vào triệu chứng lâm sàng Tên bệnh Triệu chứng lâm sàng Bệnh bí hiểm của lợn Khi chưa phát hiện ra nguyên nhân Bệnh Tai xanh Tai một số lợn nái có màu xanh Hội chứng vô sinh và sảy thai ở lợn Vô sinh và sảy thai ở lợn nái Hội chứng sảy thai và bệnh đường hô hấp Sảy thai và bệnh đường hô hấp Hội chứng rối loạn hô hấp và sinh sản ở lợn Rối loạn sinh sản và bệnh đường hô hấp 2.1.2. Lịch sử của hội chứng rối loạn hô hấp và sinh sản Các ổ dịch có biểu hiện các triệu chứng lâm sàng của PRRS được báo cáo lần đầu tiên ở Hoa Kỳ vào cuối những năm 80 thế kỷ XX, tuy lúc đó chưa biết rõ căn nguyên gây bệnh (Keffaber, 1989 [37]; Loula, 1991 [39]). Triệu chứng thường biểu hiện bao gồm rối loạn sinh sản nghiêm trọng, viêm phổi ở lợn con sau cai sữa, chậm lớn, giảm năng suất và tỷ lệ tử vong tăng (Keffaber, 1989 [37]; Loula, 1991 [39]). Các ổ dịch có triệu chứng lâm sàng tương tự đã được thông báo ở CHLB Đức vào năm 1990; sau đó dịch đã lây lan khắp châu Âu vào năm 1991 (Hà Lan, Tây Ban Nha, Anh, Pháp (1991), Đan Mạch (1992)) (OIE, 1991) [10], và xuất hiện ở châu Á vào đầu những năm 1990 [42], [48]. Vào thời điểm đó, do chưa xác định được căn nguyên bệnh nên được gọi là “bệnh bí hiểm ở lợn” (Mistery Swine Disease - MSD), một số người căn cứ vào triệu chứng gọi là “bệnh tai xanh ở lợn”. Tiếp theo dịch bệnh lây lan rộng trên toàn thế giới và được gọi bằng nhiều tên khác nhau: Hội chứng hô hấp và vô sinh của lợn (Swine infertility and respiratory disease - SIRS), tại Mỹ đặt tên gọi bệnh bí hiểm ở lợn hay Hội chứng hô hấp và sảy thai ở lợn (Porcine Endemic abortion and Respiratory syndrome - PEARS), Hội chứng rối loạn hô hấp và sinh sản ở lợn (Porcine respiratory and reproductive syndrome - PRRS), bệnh tai xanh của lợn (Blue Ear disease - BED) ở châu Âu. Năm 1991, virut gây hội chứng rối loạn hô hấp và sinh sản (PRRSV) đã được định dạng bởi các nhà nghiên cứu Hà Lan và Hoa Kỳ (Wensvoort et al, 1991 [52]; Benfield et al, 1992 [22]). Năm 1992, Hội nghị quốc tế về bệnh này tại St. Paul, Minnesota (Mỹ) đã nhất trí sử dụng tên gọi Hội chứng rối loạn hô hấp và sinh sản ở lợn - PRRS do Hội đồng Châu Âu đưa ra. Tổ chức Thú y thế giới (OIE) cũng công nhận tên gọi này. Cho đến nay, PRRS đã lan rộng khắp thế giới với những đặc trưng của từng chủng ở các vùng khác nhau, gây ra những thiệt hại kinh tế nặng nề hàng năm (Albina, 1997 [19]; Blaha T, 2000 [23]; Gao, 2004 [33]). Ngày nay, PRRSV gây ra dịch địa phương cho quần thể lợn toàn cầu, tuy nhiên một vài quốc gia như Thuỵ Điển, Thuỵ Sĩ, Niu Dilân và Úc khẳng định không có bệnh này (Elvander et al, 1997 [31]; Canon et al, 1998 [24]; Garner et al, 1996 [34]). .Ở Việt Nam, PRRS được phát hiện năm 1997 trên đàn lợn nhập từ Mỹ, 10/51 lợn giống nhập khẩu có huyết thanh dương tính với PRRS. Các nghiên cứu về bệnh ở những trại lợn giống tại các tỉnh phía Nam cho thấy tỷ lệ lợn có huyết thanh dương tính với bệnh rất khác nhau, từ 1,3% cho tới 68,29% (Hoàng Văn Năm, 2001) [12]. Ở các nước khác, tỷ lệ đàn trong vùng bệnh có huyết thanh dương tính rất cao, như ở Anh là 60 - 75%, Mỹ là 36%...[51]. 2.2. TÌNH HÌNH DỊCH BỆNH 2.2.1. Tình hình dịch bệnh trên thế giới và trong khu vực Những ca bệnh dương tính đầu tiên dựa trên phản ứng huyết thanh được phát hiện ở Iowa năm 1985 và Minnesota, Mỹ năm 1986. Tỷ lệ PRRS ở dạng lâm sàng tăng lên nhanh chóng vào năm 1988 và 1989. Khoảng năm 1990, một cuộc điều tra của Hiệp hội các nhà Thú y chuyên về bệnh lợn của Mỹ báo cáo hơn 1600 ca bệnh ở 19 bang dựa trên triệu chứng lâm sàng. Điều tra huyết thanh học đã đánh giá chắc chắn sự thịnh hành PRRS ở đàn lợn của Mỹ. Chưa có một báo cáo tỷ mỷ nào về PRRS ở châu Âu. Nhiều ổ dịch lâm sàng ở châu Âu đã giảm sau giai đoạn kịch phát từ đầu đến giữa năm 1991. Tháng 11/1990, sự lây nhiễm virut xảy ra ở những vùng nuôi nhiều lợn tại Đức. Ohlinger đã báo cáo tìm thấy kháng thể kháng PRRSV ở đàn lợn Tây Đức từ 1988 và 1989, đúng trước khi trường hợp đầu tiên phát ra ở vùng Munster. Những nghiên cứu chỉ ra rằng trên đàn lợn nhiễm chủ yếu với PRRSV vẫn âm ỉ kéo dài. Hội chứng rối loạn hô hấp và sinh sản ở lợn đã trở thành dịch địa phương ở nhiều nước trên thế giới, kể cả các nước có ngành chăn nuôi lợn phát triển như Mỹ, Hà Lan, Đan Mạch, Anh, Pháp, Đức…, đã gây ra những tổn thất rất lớn về kinh tế cho người chăn nuôi lên đến hàng trăm triệu đô la. Tại Mỹ hàng năm phải chịu tổn thất do bệnh tai xanh gây ra khoảng 560 triệu USD. Các nước trong khu vực có tỷ lệ PRRS lưu hành rất cao, ví dụ ở Trung Quốc là 80% (Yan et al, 2003); Đài Loan 94,7 - 96,4% (Cruz et al, 2006); Philippine 90% (Cruz et al, 2006), có cả virus chủng độc lực cao; Thái Lan 97%, Malaysia 94% (Jasbir et al, 1994); Hàn Quốc 67,4 - 73,1% [35]. Nga là nước thứ 4 đã báo cáo chính thức có dịch bệnh Tai xanh do chủng PRRSV thể độc lực cao gây ra (Cục Thú y, 2008) [4]. Tại Thái Lan, một nghiên cứu với quy mô rộng lớn từ năm 2000 - 2003 cho thấy các PRRSV được phân lập từ nhiều địa phương thuộc nước này gồm cả chủng dòng Châu Âu và dòng Bắc Mỹ. Trong đó virut thuộc chủng dòng Bắc Mỹ chiếm 33,58%, dòng Châu Âu chiếm 66,42%. Các nghiên cứu trước đó đã khẳng định PRRS lần đầu tiên xuất hiện ở nước này vào năm 1989 và tỷ lệ lưu hành huyết thanh của bệnh này cũng thay đổi khác nhau, từ 8,7% vào năm 1991 và trên 76% vào năm 2002. Nguồn gốc PRRS tại Thái Lan là do việc sử dụng tinh lợn nhập nội đã bị nhiễm PRRSV hoặc do các đàn lợn nhập nội mang mầm bệnh. Từ những năm 95 của thế kỷ XX trở lại đây, Trung Quốc cũng ghi nhận xảy ra các trường hợp lợn chết hàng loạt do PRRS ghép với các bệnh khác. Chủng virut đang lưu hành tại Trung Quốc là chủng thuộc dòng Bắc Mỹ, chúng được chia thành hai dạng, gồm chủng cổ điển độc lực thấp và chủng độc lực cao gây ốm, chết nhiều lợn…, Trong vòng hơn 3 tháng của năm 2006, chủng PRRSV độc lực cao đã gây ra đại dịch lây lan ở hơn 10 tỉnh phía Nam, làm hơn 2 triệu con ốm, trong đó có hơn 400.000 lợn mắc bệnh bị chết (Kegong Tian, 2007) [38]. Năm 2007, các tỉnh Anhui, Hunan, Guangdong, Shandong, Liaoning, Jilin và một số tỉnh khác bị ảnh hưởng nặng buộc Trung Quốc phải tiêu huỷ tới 20 triệu lợn để ngăn chặn dịch lây lan [4]. Điều đáng chú ý vào năm 2006 ở Trung Quốc, virut gây ra đại dịch PRRS có những thay đổi, tính cường độc mạnh hơn rất nhiều so với các chủng PRRSV cổ điển được phân lập ở nhiều địa phương khác nhau tại nước này từ năm 1996 - 2006. Bên cạnh đó một báo cáo khác cũng cho thấy, tại Trung Quốc tỷ lệ lợn có huyết thanh dương tính với PRRS tại tỉnh Quảng Đông là trên 57%, đặc biệt các trại chăn nuôi tập trung với số lượng lớn có tỷ lệ lưu hành virut cao hơn các trại chăn nuôi nhỏ lẻ. Điều đáng chú ý tại Hồng Kông, người ta đã xác định được lợn có thể nhiễm đồng thời cùng một lúc cả 2 chủng virut dòng Bắc Mỹ và dòng Châu Âu. Từ năm 2005 trở lại đây, 27 nước và vùng lãnh thổ thuộc tất cả các châu lục (trừ châu Đại dương) trên thế giới đã báo cáo cho Tổ chức Thú y thế giới (OIE) khẳng định phát hiện có PRRS lưu hành (Cục Thú y, 2008) [2]. Con số thực tế sẽ còn khác rất nhiều. 2.2.2. Tình hình dịch bệnh trong nước Tại Việt Nam bệnh được báo cáo vào năm 1998 (OIE, 2000) [46]. Điều tra ở TP Hồ Chí Minh và các tỉnh lân cận cho thấy 25% mẫu huyết thanh lợn có kháng thể kháng PRRSV (596/2308 mẫu) và 5/15 trại (chiếm 33%) nhiễm PRRS (Nguyễn Lương Hiền và ctv, 2001) [8]. Tỷ lệ nhiễm ở một số trại chăn nuôi công nghiệp tại TP Hồ Chí Minh là 5,97% (Trần Thị Bích Liên và Trần Thị Dân, 2003) [11]. Năm 2003, tỷ lệ nhiễm PRRS trên lợn nuôi tập trung ở Cần Thơ là 66,86% (La Tấn Cường, 2005) [7]. Điều tra huyết thanh học của các tác giả Akemi Kamakawa và Hồ Thị Viết Thu từ năm 1999 - 2003 cho thấy tỷ lệ lợn có kháng thể kháng PRRSV tại Cần Thơ là 7,7% (37/478 mẫu dương tính với PRRSV). Các kết quả điều tra huyết thanh học tại một số trại lợn giống phía Nam đã phát hiện có sự lưu hành của bệnh do chủng virut cổ điển, độc lực thấp gây ra với một tỷ lệ nhất định lợn giống có huyết thanh dương tính với bệnh (Cục Thú y, 2007) [1]. Như vậy có thể thấy PRRSV đã xuất hiện và lưu hành tại nước ta trong một thời gian dài. Tuy nhiên, kể từ khi xác định được lợn có kháng thể kháng PRRSV ở đàn lợn giống nhập từ Mỹ, tại Việt Nam chưa từng có vụ dịch PRRS nào xảy ra. Sự bùng phát thành dịch gây tổn thất lớn cho ngành chăn nuôi bắt đầu từ tháng 3 năm 2007. Dịch xuất hiện từng đợt tại cả 3 miền Bắc, Trung và Nam, gây thiệt hại đáng kể cho chăn nuôi lợn, đặc biệt là ảnh hưởng đến phát triển đàn giống. Trong các ổ dịch, ngoài PRRSV đã được xác định là nguyên nhân chính, hàng loạt các loại mầm bệnh khác như: Dịch tả lợn, PCV2, Tụ huyết trùng, Phó thương hàn, Liên cầu khuẩn, Suyễn lợn…, + Đợt dịch đầu tiên: dấu ấn quan trọng của PRRS tại Việt Nam được bắt đầu từ ngày 12/3/2007, hàng loạt đàn lợn tại Hải Dương có những biểu hiện ốm khác thường. Ngày 23/3/2007, lần đầu tiên Chi cục Thú y tỉnh đã báo cáo Cục Thú y về tình hình dịch, ngay sau đó ngày 26/3/2007, Trung tâm Chẩn đoán Thú y Trung ương - Cục Thú y đã tiến hành lấy mẫu xét nghiệm và kết quả dương tính với PRRSV (Tô Long Thành, 2008) [16]. Do lần đầu tiên PRRS xuất hiện tại Việt Nam và không quản lý được việc buôn bán, vận chuyển lợn ốm, dịch đã lây lan nhanh và phát triển mạnh tại 6 tỉnh thành thuộc Đồng bằng Sông Hồng, gồm: Hưng Yên, Quảng Ninh, Thái Bình, Bắc Ninh, Bắc Giang và Hải Phòng làm hàng ngàn con lợn mắc bệnh. + Đợt dịch thứ 2: ngày 25/6/2007, dịch lại xuất hiện tại tỉnh Quảng Nam. Mặc dù đã có những bài học từ các tỉnh phía Bắc, cũng như những cảnh báo, hướng dẫn phòng chống bệnh cụ thể của Cục Thú y, Bộ Nông nghiệp và Phát triển nông thôn, nhưng do không được phát hiện kịp thời, Chi cục Thú y địa phương không nắm chắc được tình hình dịch, việc quản lý vận chuyển lợn ốm không triệt để đã làm dịch lây lan trên diện rộng tại 14 tỉnh, thành trong cả nước: Cà Mau, Long An, Bà Rịa-Vũng Tàu, Khánh Hoà, Bình Định, Quảng Ngãi, Quảng Nam, Đà Nẵng, Thừa Thiên Huế, Quảng Trị, Lạng Sơn, Hà Nội, Thái Bình và Hải Dương làm trên 30 ngàn lợn mắc bệnh, hàng ngàn lợn chết và phải tiêu hủy. Tương tự như đợt dịch tại các tỉnh phía Bắc, PRRS tại miền Trung có tốc độ lây lan nhanh do yếu kém trong công tác kiểm dịch vận chuyển; dịch xảy ra nhiều ở lợn nái và lợn con với tỷ lệ chết rất cao (khoảng 20 - 30% số lợn nhiễm bệnh). So với đợt dịch ở các tỉnh phía Bắc, lợn nhiễm bệnh tại các tỉnh miền Trung có tỷ lệ chết cao, tốc độ lây lan nhanh hơn. Đặc biệt là tỉnh Quảng Nam dịch lây lan nhanh hơn rất nhiều do phát hiện chậm, không kiểm soát chặt chẽ việc vận chuyển lợn ốm ra khỏi vùng dịch. + Đợt dịch thứ 3: gây thiệt hại lớn cho chăn nuôi lợn và gây hậu quả xấu về môi trường cũng như về kinh tế xã hội. Dịch xảy ra đầu tiên tại Bạc Liêu vào tháng 1 năm 2008 với số lượng lợn mắc bệnh ít. Đến tháng 3 năm 2008, sau khi phát hiện bệnh ở Hà Tĩnh, cũng chỉ trong một thời gian rất ngắn tại Thanh Hóa và Nghệ An cũng xảy ra dịch. Tại tỉnh Thanh Hóa, số lượng các xã bị dịch tăng lên từng ngày với tốc độ chóng mặt. Đến ngày 22/4/2008, dịch đã xuất hiện tại 11 tỉnh, thành: Bạc Liêu, Hà Tĩnh, Thanh Hóa, Quảng Nam, Nghệ An, Lâm Đồng, Thừa Thiên Huế, Thái Bình, Thái Nguyên, Ninh Bình và Nam Định. + Đợt dịch thứ 4: tái xuất hiện bắt đầu từ ngày 14/2/2009 tại tỉnh Quảng Ninh. Sau đó dịch tiếp tục xảy ra tại các tỉnh Hưng Yên, Bạc Liêu, Gia Lai, Bắc Giang Đắc Lắc, Bà Rịa-Vũng Tàu và đặc biệt là tỉnh Quảng Nam dịch xảy ra trầm trọng và kéo dài. Đến ngày 15/7/2009 có 4.313 con lợn mắc bệnh, chết và tiêu huỷ 4.210 con. Tình hình dịch đợt này có giảm so với năm 2008 cả về phạm vi, quy mô dịch và số lượng gia súc phải tiêu huỷ (Cục Thú y, 2009) [6]. Nguyên nhân giảm mức độ dịch: (1) chủ quan do Bộ Nông nghiệp và phát triển nông thôn đã chỉ đạo địa phương triển khai tốt công tác tiêm phòng, đặc biệt đối với các bệnh đỏ, tăng cường công tác giám sát dịch bệnh, phát hiện và báo cáo sớm về các ổ dịch, áp dụng có hiệu quả các biện pháp phòng chống; người dân cũng đã thấy rõ tính nguy hiểm của PRRS nên đã từng bước có những thay đổi về nhận thức trong chăn nuôi; (2) khách quan cho thấy PRRS đã xuất hiện ở hầu hết các địa phương trong cả nước, PRRSV đã lưu hành rộng rãi nhưng không gây ra các ổ dịch lớn do lợn mang trùng có thể có khả năng miễn dịch chống lại bệnh ở một mức độ nào đó. Tuy nhiên, do mầm bệnh đã lưu hành ở nhiều nơi, chăn nuôi còn rất nhỏ lẻ, vệ sinh chăn nuôi chưa được chú trọng, tiêm phòng vacxin còn chưa đồng đều, tỷ lệ thấp, thời tiết thay đổi liên tục nên khả năng mầm bệnh lây lan và gây thành dịch là rất lớn. 2.3. HỘI CHỨNG RỐI LOẠN HÔ HẤP VÀ SINH SẢN Ở LỢN - PRRS 2.3.1.Nguyên nhân gây bệnh Tác nhân gây bệnh được Collins và cộng sự xác định năm 1990 dựa trên kết quả gây bệnh đường hô hấp thực nghiệm đối với lợn bằng cách dùng bệnh phẩm của lợn bệnh ngoài thực địa đã qua lọc, gây nhiễm cho lợn thí nghiệm. Năm 1991, Viện nghiên cứu Thú y Trung ương ở Lelystad (Hà Lan) đã phân lập được virut trên tế bào đại thực bào phế nang lợn. Các tác giả đã đặt tên virut là virut Lelystad (Wensvoort, Terpstra và cs, 1991 [52]). Một năm sau các tác giả người Mỹ cũng phân lập được một virut và đặt tên là VR-2332. Kết quả nghiên cứu sau này của tác giả Benfield (1992) [22]; Dea (1992) [30]; Cavanagh (1997) [25] cho thấy PRRSV có quan hệ gần gũi về mặt sinh học, cấu trúc và di truyền với virut gây viêm động mạch truyền nhiễm ở ngựa - EAV (Equine arteritis virus), LDHV (virut gây cô đặc sữa ở chuột - Lactate dehydrogenase elevating virus) và SHFV (virut sốt xuất huyết khỉ - Simian hemorrhagic fever virus). Dựa vào đặc điểm đó người ta xếp 4 virut này vào một nhóm mới với danh mục phân loại như sau: giống Arterivirus, họ Arterviridae, bộ Nidovirales [58], [23]. Phân tích cấu trúc gen của PRRSV cho thấy bộ gen của virut biến động trong khoảng 15 - 15,5kb và gồm ít nhất 8 khung đọc mở (ORFs) có chức năng mã hoá cho khoảng 20 protein ở trạng thái thành thục [33]. PRRSV với các nguồn gốc địa lý khác nhau được phân loại thành 2 kiểu: châu Âu (typ I, EU-type) và kiểu Bắc Mỹ (typ II, NA-type) [45]. Protein không cấu trúc số 2 (Nsp2) [32] và glycoprotein 5 (mã hoá bởi ORF5) [21], được coi là 2 vùng đóng vai trò quyết định tính gây bệnh của các chủng PRRSV. Ngoài sự khác biệt giữa các typ phân lập, người ta đã chứng minh rằng có sự biến dị di truyền mạnh trong cả 2 typ phân lập được khẳng định qua phân tích trình tự nuclotide và amino acid của các khung đọc mở (ORFs) của LV và VR-2332. Trình tự amino acid của VR - 2332 so với LV là 76% (ORF 2) và 72% (ORF 3), 80% (ORF 4 và 5), 91% (ORF 6) và 74% (ORF 7), phân tích trình tự cho thấy các virut đang tiến hoá đột biến ngẫu nhiên và tái tổ hợp trong gen (Murtaugh et al, 1995 [43]; Nelsen et al, 1999 [44]; Meng et al, 1995 [40], [41]; Kapur et al, 1996 [36]). Những nghiên cứu gần đây ở Trung Quốc cho thấy PRRSV tồn tại dưới hai dạng: cổ điển độc lực thấp và biến thể độc lực cao gây nhiễm và chết nhiều lợn.. Tại Việt Nam, Trung tâm Chẩn đoán Thú y TW - Cục Thú y đã tiến hành các nghiên cứu độc lập và hợp tác, phối hợp với Bộ Nông nghiệp Mỹ (USDA) và Bộ Nông nghiệp Trung Quốc để xác chẩn và nghiên cứu độc lực của PRRSV. Các virut phân lập từ các ổ dịch lợn mắc PRRS có mức độ tương đồng cao so với PRRSV chủng độc lực cao của Trung Quốc, lợn ốm với triệu chứng sốt cao; virut, vi khuẩn kế phát hoặc đồng nhiễm đóng vai trò quan trọng làm cho tỷ lệ lợn chết không nhỏ ngoài thực địa [16]. Virut có đặc điểm là rất thích hợp với đại thực bào, đặc biệt là đại thực bào vùng phổi. Virut nhân lên ngay bên trong đại thực bào, sau đó phá huỷ và giết chết đại thực bào (tới 40%). Đại thực bào bị giết chết nên sức đề kháng của lợn mắc bệnh bị suy giảm nghiêm trọng, do vậy lợn bị bệnh thường dễ dàng bị nhiễm khuẩn thứ phát. Điều này có thể thấy rõ ở những đàn lợn vỗ béo hoặc chuẩn bị giết thịt nhiễm PRRSV có sự tăng đột biến về tỷ lệ viêm phổi kế phát do vi khuẩn có sẵn trong đường hô hấp của lợn như: liên cầu khuẩn (Streptococcus suis), tụ cầu khuẩn (Staphylococcus aureus), suyễn (Mycoplasma hyopneumoniae), vi khuẩn tụ huyết trùng (Pasteurella multocida, Pasteurella haemolytica) [18]. Một số vi khuẩn kế phát thường gặp trong cơ thể lợn mắc PRRS: STT Vi khuẩn Gây bệnh 1 Mycoplasma hyopneumoniae Suyễn 2 Actinobacilus pleuropneumoniae APP (Viêm phổi màng phổi) 3 Pasteurella multocida Tụ huyết trùng 4 Haemophilus parasuis Viêm đường hô hấp 5 Bordetella bronchiseptica Viêm teo mũi 6 Streptococcus suis Liên cầu khuẩn 7 Salmonella spp Phó thương hàn 8 E. coli E.Coli 9 Clostridium spp Viêm ruột hoại tử 2.3.1.1. Hình thái Dưới kính hiển vi điện tử, PRRSV là loại có vỏ bọc, hình cầu, kích thước khoảng 45 - 80nm, và chứa nhân nucleocapsid 25 - 35nm, trên bề mặt có gai nhô ra rõ. Sự sinh sôi của virut bị dừng lại khi dùng Chloroform hay Ether, chứng tỏ vỏ có chứa lipit. PRRSV là ARN virut với bộ gen là phân tử ARN sợi đơn dương, có những đặc điểm chung của nhóm Arterivirus. Sợi ARN này có kích thước khoảng 15 kilobase. Sợi ARN virut có 1 cổng 5’ và 1 dải cổng 3’. Gen ARN polymeraza chiếm khoảng 75% đầu 5’ của bộ gen, gen mã hóa cho các protein cấu trúc của virut nằm ở đầu 3’. 2.3.1.2. Sức đề kháng của virus [15] Điều kiện môi trường Khả năng đề kháng Virus trong bệnh phẩm -700C đến -200 C Hàng năm 1 tuần ở 40C Giảm 90% hiệu giá 1 tháng ở 40C Vẫn phát hiện được virut 6 ngày ở 20 - 210C Đề kháng tốt 24h ở 370C Đề kháng tốt 20 phút ở 560C Đề kháng tốt pH 6.5 - 7.5 Đề kháng tốt pH 7.5 Đề kháng kém Virus trong huyết thanh 72h ở 250 C Vẫn phát hiện được virut 72h ở 40C hoặc -200C Vẫn phát hiện được virut Virut bị diệt dưới ánh nắng mặt trời. Virut dễ dàng bị diệt trong dung môi hoà tan chất béo như cloroform và ête. Các virut Lelystad không thể ngưng kết hồng cầu của bất kỳ loài động vật nào. Tuy nhiên, nghiên cứu ở Nhật Bản thấy virut nguồn gốc châu Mỹ (VR 2332) có khả năng ngưng kết hồng cầu lợn [18]. Các thuốc sát trùng thông thường đều có thể diệt được virut như iodin 1%; cloramin B, T (Clorin) 2 - 3%; NaOH 3%; formol 3%; Virkon 1%; nước vôi 10%; vôi bột. 2.3.1.3. Cơ chế sinh bệnh Sau khi xâm nhập vào cơ thể lợn, đích tấn công của virut là các đại thực bào. Đây là tế bào duy nhất có receptor phù hợp với cấu trúc hạt virut, vì thế virut hấp thụ và thực hiện quá trình nhân lên chỉ trong tế bào này và phá huỷ nó. Một tỷ lệ lớn tế bào đại thực bào trong nang phổi bị virut xâm nhiễm rất sớm. Lúc đầu, PRRSV có thể kích thích các tế bào này, nhưng sau 2 hoặc 3 ngày virut sẽ giết chết chúng, các virion được giải phóng và ồ ạt xâm nhiễm sang các tế bào khác. Ở giai đoạn đầu quá trình xâm nhiễm của PRRSV, dường như hiệu giá kháng thể chống lại các loại virut và vi khuẩn không liên quan khác trong cơ thể của lợn tăng cao do sự kích hoạt của đại thực bào trong hệ thống miễn dịch. Điều này rất dễ gây ra sự nhầm lẫn trong việc đánh giá mức độ miễn dịch đối với các bệnh truyền nhiễm ở cơ thể lợn. Cần phải thấy rằng, trong hệ thống miễn dịch của cơ thể, đại thực bào đóng vai trò vô cùng quan trọng trong đáp ứng miễn dịch cả không đặc hiệu và đặc hiệu. Đây là loại tế bào trình diện kháng nguyên thiết yếu, mở đầu cho quá trình đáp ứng miễn dịch đặc hiệu. Khi tế bào đại thực bào bị virut phá huỷ, các phản ứng miễn dịch không xảy ra, lợn nhiễm bệnh rơi vào trạng thái suy giảm miễn dịch và dễ dàng mắc các bệnh nhiễm trùng thứ phát. Điều này có thể thấy rõ ở những đàn lợn vỗ béo chuẩn bị giết thịt, khi bị nhiễm PRRSV sẽ có sự tăng đột biến về tỷ lệ viêm phổi kế phát do những vi khuẩn vốn sẵn có trong đường hô hấp. 2.3.2. Dịch tễ học 2.3.2.1. Động vật cảm nhiễm Lợn ở các lứa tuổi đều có thể cảm nhiễm virut. Các cơ sở chăn nuôi công nghiệp với quy mô lớn, bệnh thường lây lan rộng tồn tại lâu dài trong đàn nái, rất khó thanh toán. Lợn nái thường truyền mầm bệnh cho bào thai, gây sảy thai, thai chết lưu và lợn chết yểu với tỷ lệ cao. Lợn rừng ở các lứa tuổi khác nhau đều có thể cảm nhiễm virut, có thể phát bệnh, nhưng thường không có triệu chứng lâm sàng và trở thành nguồn tàng trữ mầm bệnh trong tự nhiên. Cho đến nay kết quả nghiên cứu ở một số nước châu Âu đều cho thấy virut gây PRRS không cảm nhiễm cho các loại thú khác và người. Tuy nhiên, từ thực nghiệm các nhà khoa học đã chứng minh một số loại gia cầm chân có màng như vịt trời (mallard duck) rất mẫn cảm với PRRSV, virut có thể nhân lên ở loài vịt này. Vì thế việc phát tán PRRSV trên diện rộng là khó tránh khỏi [18]. 2.3.2.2. Động vật môi giới mang và truyền virut Trong tự nhiên, lợn đực và lợn nái mang virut là nguồn tàng trữ truyền mầm bệnh cho lợn nhà. Lợn rừng bị nhiễm virut không có biểu hiện lâm sàng cũng đóng vai trò làm lây truyền virut cho lợn nhà và ngược lại. Trong thực nghiệm cũng truyền được virut trực tiếp cho một số loài chuột và từ chuột nhiễm mầm bệnh sang chuột khỏe (dòng châu Âu). 2.3.2.3. Điều kiện lây lan bệnh Bệnh có thể lây lan từ nước này sang nước khác qua việc xuất nhập lợn mang mầm bệnh. Một số nước đang phát triển nhập lợn giống có phẩm chất và năng suất cao từ các nước Bắc Mỹ và Tây Âu, do không thực hiện tốt công tác kiểm dịch nên đã đưa bệnh vào nước mình. Thực tế cho thấy PRRS đã trở thành dịch địa phương ở nhiều nơi trên thế giới. Việc xác định chính xác tỷ lệ lưu hành ở những khu vực mắc dịch địa phương không dễ dàng bởi nhiều lý do như: quy trình lấy mẫu trong quần thể không có giá trị thống kê; nhiều nơi dùng vacxin nhược độc phòng PRRS làm kết quả điều tra huyết thanh học không còn chính xác. Ở các cơ sở có lưu hành bệnh, môi trường bị ô nhiễm, bệnh lây lan quanh năm nhưng tập trung vào thời kỳ có nhiều lợn nái phối giống và bệnh phát sinh thành dịch cao. Virut có trong dịch mũi, nước bọt, tinh dịch (trong giai đoạn nhiễm trùng máu), phân, nước tiểu, sữa và phát tán ra môi trường qua các dịch tiết, các chất bài thải này (Wills et al, 1997 [54], [55]; Swenson et al, 1994 [49]; Wagstrom et al, 2001 [50]; Rossow et al, 1994 [47]; Yoon et al, 1993 [57]). Virut bài thải qua nước tiểu đến 42 ngày, qua nước mũi, nước mắt đến 14 ngày, qua tinh dịch 43 và 92 ngày sau khi gây nhiễm (Swenson, 1994 [49]; Christopher-Hennings, 1995 [28], [29]). Virut tồn tại lâu trong cơ thể vật chủ. Người ta có thể phát hiện được virut từ mẫu dịch hầu họng 157 ngày sau khi tiêm thí nghiệm. Bệnh có thể truyền lây qua tiếp xúc trực tiếp giữa thú nhiễm bệnh và thú mẫn cảm, cũng xảy ra sự lây truyền qua tinh dịch ở lợn đực nhiễm bệnh (Yaeger, 1993) [56]. Đối với lợn mẹ mang trùng, virut có thể lây nhiễm qua bào thai từ giai đoạn giữa đến giai đoạn cuối của thai kỳ (Christianson, 1993 và 1994) [27], [26]. Sự tồn tại kéo dài của PRRSV trong từng cá thể dao động trong khoảng thời gian từ 154 - 157 ngày sau khi nhiễm đã được báo cáo (Albina et al, 1994 [20]; Otake et al, 2002 [10]). Virut có khả năng phân tán thông qua các hình thức: vận chuyển lợn mang trùng, theo gió (có thể đi xa tới 3 km); thông qua thức ăn, nước uống, dụng cụ chăn nuôi, dụng cụ bảo hộ lao động nhiễm trùng, thụ tinh nhân tạo và có thể do một số chim hoang (Wills et al, 2000), côn trùng (Schurrer et al, 2004) [10]. Lợn mẫn cảm với PRRSV theo nhiều đường: miệng, mũi, nội cơ, nội phúc mạc, âm đạo. Kí chủ mẫn cảm, ngoài lợn một số loài khác cũng mẫn cảm. Ví dụ: vịt trời thải PRRSV qua phân. Lợn cũng mẫn cảm với virut có nguồn gốc từ vịt trời. Sự lây lan bệnh từ đàn lợn này sang đàn lợn khác thường theo tinh dịch khi phối giống. Ngoài ra còn các đường như kim tiêm, nước uống, không khí, kí chủ không phải là lợn, côn trùng, vật liệu nhiễm khuẩn. Ở Pháp 56% đàn mắc bệnh do tiếp xúc với lợn bệnh, 20% do tinh dịch, 21% do vật dụng và 3% từ những nguồn chưa xác định. Nghiên cứu thực nghiệm đã chứng minh lây nhiễm tiếp xúc xảy ra sau 2 tuần, 6 tuần, 8 tuần và 14 tuần sau khi thải virut. Nhiều nhà nghiên cứu đã hướng nghiên cứu sinh bệnh học PRRS ở giai đoạn chửa cuối của lợn nái (77 - 95 ngày chửa)/lợn nái hậu bị với virut nuôi cấy tế bào hoặc chất mô có chứa virut. Trong hầu hết các nghiên cứu, người ta bơm virut vào trong mũi cho lợn (từ 1025 - 1055 TCID50), triệu chứng lâm sàng vẫn biểu hiện rõ. Thời gian ủ bệnh trong điều kiện thực nghiệm khoảng 3 - 5 ngày, sau đó con vât bỏ ăn và sốt. Trong thực tế thời gian ủ bệnh của bệnh gây ra do vận chuyển lợn rất khác nhau 3 - 24 ngày (trung bình 19 ngày, 9 đàn), 14 - 37 ngày (8 đàn), 28 ngày (1 đàn), 10 - 18 ngày (trung bình 14 ngày, 6 đàn) và 10 - 14 ngày (1 đàn vận chuyển vào chuồng nuôi lợn con). Sự khác nhau thời gian ủ bệnh có thể phản ánh sự khác nhau về độc lực giữa các chủng virut, sự khác nhau mật độ lợn ở đàn bị bệnh hoặc sự khác nhau về khả năng phát hiện ra triệu chứng lâm sàng của người sản xuất và thú y. Truyền lây bệnh qua không khí đã xảy ra ở nhiều trường hợp, đặc biệt ở châu Âu. Mặc dù khó chứng minh chắc chắn, những bằng chứng gián tiếp cho thấy sự truyền lây qua không khí là quan trọng trong việc lây truyền PRRSV trong vùng. Komijin và cộng sự đã thông báo thời gian lây lan ban đầu của PRRSV giữa Đức và Hà Lan đầu năm 1991, điều kiện khí hậu là lý tưởng cho sự truyền lây virut qua không khí. Thông thường gió ở Đức và Hà Lan thổi từ tây sang đông nhưng từ 14/1 đến 12/2 và từ 26/2 đến 9/3 hàng năm gió thổi từ đông sang tây. Vì thế thực tế đã xảy ra virut lây lan từ đông sang tây qua những vùng nuôi nhiều lợn trong thời gian này. Ở Anh, vận chuyển lợn làm lây lan virut làm cho chính phủ phải đề ra những biện pháp nghiêm ngặt trong việc vận chuyển lợn bị bệnh. Edward đưa ra thang bậc sau để biểu thị khả năng truyền qua không khí xung quanh đàn bị nhiễm: - 57% các trại trong vòng 1 km bị nhiễm. - 31% giữa 1- 2 km bị nhiễm. - 11% giữa 2- 3 km bị nhiễm. - Những đàn > 3 km cách đàn bị nhiễm vẫn âm tính. Những ổ dịch PRRS ở Đan Mạch cung cấp thêm bằng chứng về truyền lây qua không khí. Những ổ dịch này xảy ra cũng giống như ổ dịch giả dại trước đây dọc theo biên giới Đức đã xác định là do truyền qua không khí. Nếu truyền qua không khí ở Đan Mạch thì PRRSV có thể đi xa tới 20 km. Ở các cơ sở có lưu hành bệnh, môi trường bị ô nhiễm, bệnh lây lan quanh năm nhưng tập trung vào thời kỳ có nhiều lợn nái phối giống và bệnh phát sinh thành dịch, với tỷ lệ cao, lợn nái có hội chứng rối loạn sinh sản, trong khi lợn con bị viêm đường hô hấp là phổ biến. Một nghiên cứu ở Đức đối với 150 đàn lợn bị nhiễm cho thấy có 95% hoặc là đã mua giống dưới 4 tuần trước ổ dịch hoặc là trong vòng 5 km cách đàn bị bệnh. Những nghiên cứu khác, tác nhân sau đây được thông báo có ý nghĩa trong việc lây lan PRRSV : - Mua lợn. - Thiếu cách ly kiểm dịch đối với lợn mới mua. - Ở gần đàn mắc bệnh. - Quy mô đàn lớn. Một số đặc điểm dịch tễ PRRS tại Việ._.t Nam - PRRS lần đầu tiên xảy ra trên diện rộng ở Việt Nam vào tháng 3/2007 và gây ra 4 đợt dịch tại 29 tỉnh, thành trong phạm vi cả 3 miền Bắc, Trung, Nam. - Dịch đã xảy ra ở lợn mọi lứa tuổi, nhưng chủ yếu tập trung ở lợn nái mang thai và lợn con theo mẹ. Bệnh có đặc trưng làm cho lợn ốm, sốt cao, ở lợn con theo mẹ; lợn nái chửa giai đoạn cuối chết nhanh nhiều hơn so với lợn thịt và lợn đực giống. - Dịch xảy ra chủ yếu ở các hộ chăn nuôi nhỏ lẻ, phân tán ở những địa phương có tỷ lệ tiêm vacxin phòng một số bệnh truyền nhiễm khác thấp như: dịch tả lợn, tụ huyết trùng, phó thương hàn, đóng dấu lợn…, - Trong các đợt dịch cho thấy, lợn không chỉ mắc PRRS mà thường bị bội nhiễm những bệnh kế phát khác: dịch tả lợn, phó thương hàn, tụ huyết trùng, Streptococcus suis, Mycoplasma spp, v.v…, Các bệnh này là nguyên nhân kế phát gây chết nhiều lợn và làm dịch lây lan diện rộng. - Nguyên nhân của PRRS là do virut, tác nhân không lây bệnh cho người. - Dịch lây lan nhanh chủ yếu do phát hiện chậm, người chăn nuôi bán chạy lợn ốm, do không kiểm soát được vận chuyển lợn ốm từ vùng dịch sang vùng không có dịch. 2.3.3. Triệu chứng và bệnh tích 2.3.3.1. Triệu chứng Lợn mắc hội chứng rối loạn hô hấp và sinh sản thường có các đặc trưng lâm sàng: lợn nái có chửa thường bị sảy thai vào giai đoạn cuối hoặc thai chết lưu ở giai đoạn 2, trở thành thai gỗ hoặc lợn sơ sinh bị chết yểu. Lợn ốm thường sốt cao 40 - 420C, thậm chí cao hơn. Lợn bị viêm phổi nặng, ỉa chảy, tai chuyển từ màu hồng sang đỏ thẫm, xanh đến tím đen do tụ huyết rất phổ biến ở lợn bệnh. Với lợn nái đang chửa, nuôi con còn biểu hiện triệu chứng: lười uống nước, mất sữa, viêm vú, da biến màu từ đỏ sẫm thành đỏ tím ở núm vú, mõm, da vùng cổ và vùng bụng, âm hộ…, đẻ sớm hoặc hôn mê, rồi chết. Lợn con mắc bệnh thể trạng yếu, khó bú, mắt có dử màu nâu, da có nhiều vết phồng, bị viêm phổi nặng nhiều khi lợn bị ỉa chảy và khả năng chết rất cao sau khi sinh, đặc biệt ở lợn con cai sữa. Lợn ở tất cả các lứa tuổi đều có thể nhiễm PRRSV, tuy nhiên lợn con và lợn nái mang thai được xem là mẫn cảm hơn. Lợn rừng cũng đã được xác định là mắc bệnh và đây cũng được coi là nguồn lây nhiễm tiềm năng PRRS [18]. Thông thường lợn bị nhiễm chủng PRRSV dạng cổ điển có tỷ lệ chết rất thấp, 1 - 5%. Nếu thấy gia súc chết nhiều, thường là do nhiễm trùng kế phát: dịch tả lợn, Pasteurella multocida suis, Salmonella spp, Streptococus suis, E.coli, Mycoplasma spp, v.v…, Tuy nhiên, năm 2006 tại Trung Quốc các nhà nghiên cứu với quy mô lớn nhất từ trước đến nay đã khẳng định có sự biến đổi về độc lực của virut, hậu quả lợn bị nhiễm PRRSV độc lực cao có tỷ lệ chết rất cao trên 20% trong tổng số đàn nhiễm bệnh. Tại Việt Nam, kết quả theo dõi lợn mắc PRRS trong các ổ dịch ở một số tỉnh đồng bằng Bắc bộ đầu năm 2007 cũng cho thấy: lợn nái bị sảy thai, thai chết lưu ở thời kỳ chửa 2 hoặc lợn con chết yểu ngay sau khi sinh. Đối với lợn con theo mẹ, lợn sau cai sữa thường bị viêm phế quản, phổi rất nặng và chết với tỷ lệ cao (Lê văn Năm, 2007) [13]. Chúng ta đã phân lập được một số vi sinh vật khác gây nhiễm khuẩn kế phát như: liên cầu khuẩn (Streptococcus suis), vi khuẩn gây bệnh tụ huyết trùng (Pasteurella spp), vi khuẩn tụ cầu (Staphylococcus aureus), E.coli và một số trường hợp còn phát hiện dịch tả lợn như ở tỉnh Hải Dương (Cục Thú y, 2008) [3]. Các trường hợp bị bệnh kế phát do vi khuẩn làm cho lợn bị bệnh rất nặng và lợn thường chết nhiều…, Lợn nái: - Ở giai đoạn mang thai: sốt 40 - 420C, biếng ăn, sảy thai vào giai đoạn chửa kỳ 2 hoặc thai chết lưu chuyển thành thai gỗ; thể cấp tính tai chuyển màu xanh, con vật đẻ non vào giai đoạn cuối của thời kỳ mang thai hoặc thai chết lưu. - Ở giai đoạn đẻ và nuôi con: lợn nái biểu hiện sốt cao, biếng ăn, lười uống nước, mất sữa, viêm vú, phần da mỏng nổi ban đỏ biến màu (hồng sau đỏ sẫm), lờ đờ, hôn mê; lợn con mới sinh rất yếu, tai xanh nhạt và chết yểu. - Ở giai đoạn sau cai sữa: lợn nái động dục không bình thường (kéo dài) hoặc phối giống mà không thụ thai, ho và viêm phổi nặng. Lợn con: sốt cao 40 - 420C, gầy yếu, khó thở, mắt có dử màu nâu, phần da mỏng như da bụng, gần mang tai thường có màu hồng, đôi khi da có vết phồng rộp, ỉa chảy nhiều, ủ rũ, run rẩy và thường bị chết. Lợn choai, lợn thịt: sốt cao 40 - 420C, biếng ăn, ủ rũ, ho, thở khó; những phần da mỏng như phần da gần tai, phần da bụng nổi ban đỏ lúc đầu màu hồng nhạt, dần dần chuyển thành màu hồng thẫm và xanh nhạt. Lợn đực giống: sốt, bỏ ăn, đờ đẫn hoặc hôn mê, giảm hưng phấn hoặc mất tính dục, lượng tinh dịch ít. Các trường hợp cấp tính, lợn đực bị sưng dịch hoàn. Phần lớn lợn đực nhiễm virut không có biểu hiện lâm sàng, nhưng tinh dịch có virut kéo dài từ 6 - 8 tháng. 2.3.3.2. Bệnh tích Mổ khám có thể thấy các bệnh tích đại thể sau: - Ở lợn nái bị sảy thai: âm môn sưng tụ huyết; niêm mạc tử cung và niêm mạc âm đạo sưng thuỷ thũng, tụ huyết, xuất huyết đỏ sẫm và chảy dịch. Nếu lợn nái bị bệnh cấp tính, có viêm phổi thì sẽ thấy phổi sưng thuỷ thũng, tụ huyết từng đám, trong phế quản có nhiều dịch và bọt khí. Một số lợn nái bệnh còn thể hiện viêm bàng quang, xuất huyết. - Ở lợn con theo mẹ: thường thấy viêm đường hô hấp cấp với bệnh tích điển hình như phế quản và phổi sưng có màu vàng hoặc tụ huyết đỏ, có nhiều dịch và bọt khí trong phế quản. Chùm hạch phổi và hạch hầu sưng có màu vàng. Nếu có nhiễm khuẩn kế phát do liên cầu (Streptococcus suis) gây viêm não sẽ thấy xung huyết màng não. - Ở lợn con sau cai sữa: biểu hiện viêm đường hô hấp là chủ yếu, nhưng tỷ lệ viêm thấp hơn ở lợn con theo mẹ. Bệnh tích thường thấy là viêm phổi thuỷ thũng từng đám, có màu vàng hoặc đỏ do xuất huyết; phế quản chứa nhiều dịch nhày và bọt khí. Cũng như lợn con theo mẹ, lợn con sau cai sữa có kế phát các bệnh viêm não, nhiễm trùng huyết do liên cầu khuẩn (Streptococcus suis) và sẽ thấy tụ huyết và dịch hồng ở màng não. Nhiễm kế phát do vi khuẩn tụ huyết trùng sẽ thấy: các phủ tạng bị sưng, tụ huyết và xuất huyết đỏ. Nhiễm kế phát do vi khuẩn thương hàn sẽ có ỉa chảy và bệnh tích thể hiện tụ huyết, bong tróc niêm mạc ruột và có các nốt loét lan tràn ở niêm mạc vùng van hồi manh tràng. Các bệnh tích đại thể và vi thể của PRRS hầu hết xuất hiện ở lợn mới sinh. Ở lợn lớn hơn, bệnh tích có thể tương tự nhưng ít rõ ràng hơn. Bệnh tích đại thể của PRRS cũng khác nhau. Bệnh tích ở phổi có thể từ không có dấu hiệu gì đến phổi cứng lan tràn và kết hợp với một số vi khuẩn kế phát. Hạch lympho bị tấn công chủ yếu thấy ở lợn bé. Bệnh tích vi thể không đặc hiệu, chủ yếu ở phổi và tổ chức lympho. Bệnh tích phổi đặc trưng bởi viêm phổi kẽ với sự thẩm nhiễm của các tế bào đơn nhân. Các bệnh tích mạch máu, tim và não cũng được mô tả. Các bệnh tích thai thường ít gặp như viêm mạch máu, viêm cơ tim và viêm não. PRRSV chỉ là một trong số nguyên nhân gây nên viêm kẽ phổi ở lợn (Cục Thú y, 2008) [5]. 2.3.4. Các phương pháp chẩn đoán Chẩn đoán PRRS dựa vào các yếu tố chủ quan như lịch sử bệnh, triệu chứng lâm sàng, tổn thương đại thể và vi thể; các số liệu khách quan như phân tích tình hình sinh sản, xét nghiệm huyết thanh học hoặc phát hiện virut. Có thể nghi lợn mắc PRRS khi có các triệu chứng lâm sàng về đường hô hấp ở bất kỳ giai đoạn sinh sản nào, hoặc khi có hiện tượng rối loạn sinh sản. Rõ ràng chẩn đoán bằng phương pháp huyết thanh học (phát hiện kháng thể) và phát hiện virut (phát hiện kháng nguyên) là các phương pháp tin cậy nhất. 2.3.4.1. Chẩn đoán lâm sàng Chẩn đoán lâm sàng dựa vào 2 nhóm triệu chứng: + Triệu chứng đường sinh sản: trong giai đoạn đầu của PRRS, có thể thấy có hiện tượng sảy thai ở giai đoạn cuối thời kỳ mang thai và đẻ non, thai yếu, thai chết lưu, đồng thời có thai gỗ, lợn con yếu, chết trước khi cai sữa. + Triệu chứng đường hô hấp: Viêm phổi ở lợn con và lợn vỗ béo. Có thể dùng phương pháp chẩn đoán lâm sàng nghi vấn để chẩn đoán xác định bệnh trong các trường hợp sau: Sẩy thai muộn > 20% Chết khi sinh > 5% Chết trước lúc cai sữa > 25%. Trong chẩn đoán lâm sàng cần chẩn đoán phân biệt PRRS với các bệnh: giả dại, cúm lợn, truyền nhiễm đường hô hấp do Coronavirus, viêm não và cơ tim, bệnh do Parvovirus, bệnh do Cytomegalovirus, các bệnh do Circovirus [15]. 2.3.4.2. Chẩn đoán bằng phương pháp giải phẫu bệnh Đối với lợn con, lợn vỗ béo, lợn xuất chuồng: khi mổ khám thấy phổi rắn, chắc, có vùng xám và hồng. Trên tiêu bản vi thể viêm phổi kẽ tăng sinh đa điểm hoặc lan tràn làm vách phế nang dày lên, viêm não giữa và giảm số lượng tế bào lympho trong các tổ chức lympho. Đối với thai sảy và thai chết lưu không có bệnh tích đại thể hoặc vi thể đặc trưng. 2.3.4.3. Phương pháp huyết thanh học Có thể phát hiện kháng thể kháng PRRSV trong huyết thanh, dịch của cơ thể hoặc từ thai chết lưu bằng một số phương pháp huyết thanh học bao gồm phương pháp kháng thể huỳnh quang gián tiếp, phương pháp miễn dịch enzym trên thảm tế bào một lớp, ELISA và phản ứng trung hòa huyết thanh. Trong các phương pháp trên, ELISA là phương pháp thuận tiện hơn cả vì có thể chẩn đoán một số lượng lớn huyết thanh, kết quả thu được của các phòng thí nghiệm (khi chẩn đoán cùng mẫu huyết thanh) là tương đối đồng nhất. Ưu điểm nữa của phương pháp này là có thể phát hiện được cả chủng PRRSV có nguồn gốc Bắc Mỹ và các chủng có nguồn gốc châu Âu, trong khi đó phương pháp huỳnh quang kháng thể hoặc phương pháp miễn dịch enzym trên thảm tế bào chỉ phát hiện được các chủng virut về mặt kháng nguyên gần với chủng dùng trong phản ứng. Trong khi đánh giá kết quả của một phản ứng huyết thanh, phải cân nhắc đến trạng thái miễn dịch của đàn sau khi được tiêm phòng bởi vì hiện nay chưa có phản ứng huyết thanh học nào phân biệt được kháng thể do lợn mắc tự nhiên hay kháng thể do vacxin kích thích tạo nên. Động thái kháng thể kháng PRRSV khi đánh giá bằng các phản ứng huyết thanh học kể trên là tương tự nhau. Có thể phát hiện kháng thể từ 7 - 14 ngày sau khi lợn bị nhiễm virut. Hàm lượng kháng thể đạt mức tối đa vào 30 - 50 ngày sau khi nhiễm, sau đó giảm dần và không phát hiện được nữa khoảng 4 - 6 tháng sau khi bị nhiễm. Phản ứng trung hòa huyết thanh có lẽ kém nhạy hơn các phản ứng huyết thanh học khác vì kháng thể trung hòa xuất hiện chậm. Tuy nhiên phản ứng trung hòa lại là chỉ thị tốt nhất để đánh giá tình trạng bệnh trong quá khứ vì kháng thể trung hòa có thể tồn tại ít nhất 1 năm. 2.3.4.4. Phát hiện virut Để phát hiện virut, lấy bệnh phẩm là huyết thanh, huyết tương, bạch cầu, phổi, hạch amidan, tổ chức lympho, dịch báng của thai chết lưu hoặc lợn chết ngay sau khi sinh. Nhìn chung bệnh phẩm ở lợn con thích hợp hơn lợn già vì virut tồn tại trong một thời gian dài ở lợn con. Có thể phân lập được virut từ huyết thanh trong vòng từ 4 - 6 tuần sau khi bị nhiễm ở lợn đang bú, lợn cai sữa và lợn nhỡ và trong 1 - 2 tuần sau khi nhiễm ở lợn đực trưởng thành và lợn nái. Cần phải bảo quản lạnh ngay lập tức bệnh phẩm dùng để phát hiện virut. Có thể áp dụng một số kỹ thuật sau để phát hiện virut: - Phân lập virut trên một số loại tế bào: tế bào phế nang của lợn, tế bào MA-104, tế bào MARC-145, CL2621 và CRL11171. - Phương pháp miễn dịch bệnh lý. - Phương pháp huỳnh quang gián tiếp phát hiện kháng nguyên. - Phương pháp nhân gen PCR. - Phương pháp lai phân tử tại chỗ (insitu hybrization). Thực tế phân lập PRRSV gặp nhiều khó khăn do tế bào để phân lập virut là đại thực bào phế nang của lợn, tế bào này cần được lấy từ lợn sạch bệnh khoảng 6 - 8 tuần tuổi. Không phải phòng thí nghiệm nào cũng có sẵn lợn sạch bệnh và các dòng tế bào thường trực không thể thay thế hoàn toàn được tế bào đại thực bào phế nang vì chúng kém nhạy với virut. Thêm vào đó các lô đại thực bào khác nhau cũng không phải luôn có độ nhạy giống nhau đối với virut; lý do này chưa biết rõ, nhưng rõ ràng cần phải kiểm tra mỗi mẻ tế bào trước khi dùng [5]. Sau khi phân lập được virut, giám định bằng phương pháp huỳnh quang gián tiếp. Một số dòng tế bào thận khỉ (MA-104) có thể thay thế được đại thực bào, nhưng dòng tế bào này không giúp sự tăng sinh của các chủng virut đặc biệt là các chủng châu Âu. Các phương pháp RT-PCR và nested PCR cũng là các phương pháp có độ nhạy cao để phát hiện RNA của virut và được dùng nhiều đối với các tổ chức khác nhau và huyết thanh của lợn. Các phương pháp này cũng rất hữu dụng khi có vấn đề về phân lập virut, ví dụ như khi xét nghiệm tinh dịch và xét nghiệm một số tổ chức đã bị phân huỷ do nhiệt độ trong lúc vận chuyển mẫu. Người ta cũng đã thiết lập một phương pháp multiplex PCR để phân biệt chủng virut châu Âu và Bắc Mỹ. 2.3.5. Điều trị - Không có thuốc điều trị đặc hiệu vì đây là bệnh do virut gây ra. - Trong quy trình phòng trị PRRS ở các nước chăn nuôi lợn quy mô công nghiệp (ở châu Âu và Bắc Mỹ), người ta loại thải những lợn bị bệnh hoặc mang virut sau khi xét nghiệm huyết thanh dương tính để khỏi lây nhiễm bệnh trong đàn lợn. - Ở các nước đang phát triển, người ta vẫn có thể điều trị một số lợn nhập ngoại có phẩm chất và năng suất cao; nhưng chỉ điều trị một số bệnh nhiễm khuẩn kế phát đường hô hấp và tiêu hoá, thực chất thì không điều trị được PRRSV [18]. Nhìn chung để điều trị có hiệu quả cần : - Nâng cao sức đề kháng của lợn. - Chống nhiễm khuẩn kế phát. - An toàn sinh học. 2.3.6. Biện pháp phòng chống Ngành chăn nuôi Việt Nam hiện nay có thể nói là đang trên đà phát triển mạnh và ngày càng được chú trọng hơn. Nhiều loại hình chăn nuôi, bao gồm cả chăn nuôi lợn còn mang tính nhỏ lẻ, phân tán. Vì thế việc phòng chống dịch bệnh thường gặp phải rất nhiều khó khăn, đặc biệt là những ổ dịch lớn. Vì vậy, để phòng tận gốc dịch PRRS thì việc đầu tiên cần phải làm là thay đổi phương thức chăn nuôi từ nhỏ lẻ, phân tán sang chăn nuôi lớn tập trung, nhập con giống phải khoẻ mạnh rõ nguồn gốc. Bên cạnh đó cần phải áp dụng triệt để các biện pháp an toàn sinh học trong chăn nuôi, chuồng trại phải đảm bảo vệ sinh an toàn thú y, chăm sóc tốt để nâng cao sức đề kháng cho đàn vật nuôi…, Nói chung cần phải áp dụng đồng bộ cùng lúc nhiều biện pháp phòng chống. 2.3.6.1. Biện pháp phòng khi chưa có dịch (1) Thường xuyên theo dõi sức khoẻ của đàn lợn trong các cơ sở chăn nuôi lợn sinh sản để sớm phát hiện lợn có dấu hiệu lâm sàng của PRRS. Cách ly, xử lý kịp thời và gửi mẫu bệnh phẩm đi xét nghiệm khi có nghi ngờ bệnh. (2) Tiêm vacxin phòng bệnh cho đàn lợn trong cơ sở chăn nuôi chưa có lưu hành bệnh. Trước khi tiêm, cần tham khảo ý kiến của Chi cục Thú y tỉnh để biết trong khu vực trước đó có chủng virut nào gây bệnh (châu Âu hoặc Bắc Mỹ) để lựa chọn vacxin thích hợp. Bởi vì vacxin không tạo được miễn dịch chéo giữa chủng chế tạo vacxin và chủng gây bệnh cho lợn ở trong vùng. Hiện nay, nước ta đã nhập vacxin nhược độc và vacxin chết chế tạo từ chủng có nguồn gốc châu Âu (virut Lelystad) và chủng có nguồn gốc Bắc Mỹ (virut VR 2332). (3) Để loại trừ các bệnh kế phát do vi khuẩn ở lợn, tất cả đàn lợn phải được tiêm phòng 4 bệnh đỏ (dịch tả lợn, tụ huyết trùng, đóng dấu lợn và phó thương hàn). Trong điều kiện cần thiết có thể phải tiêm vacxin phòng một số bệnh đường hô hấp (bệnh suyễn lợn, bệnh viêm phổi và màng phổi ở lợn). (4) Khi nhập lợn giống, phải mua từ các cơ sở chăn nuôi và vùng không có PRRS. Lợn mới mua về phải nuôi cách ly ít nhất 3 - 4 tuần lễ, không có dấu hiệu lâm sàng của PRRS cũng như các bệnh truyền nhiễm khác mới cho nhập đàn. (5) Đảm bảo thức ăn đủ chất dinh dưỡng và nguồn nước sạch cho lợn, giúp lợn có sức đề kháng với PRRSV cũng như các bệnh khác, hạn chế mắc các bệnh truyền nhiễm. (6) Giữ chuồng trại và khu chăn thả lợn luôn khô sạch, thoáng mát mùa hè, kín ấm mùa đông và phải phun thuốc sát trùng định kỳ 2 tuần/lần để diệt mầm bệnh. (7) Khi xuất nhập lợn cần thực hiện kiểm dịch thú y nghiêm ngặt. 2.3.6.2. Biện pháp phòng chống khi có dịch xảy ra (1) Các gia trại và trang trại phải thống kê số lợn ốm, lợn chết báo với chính quyền và thú y địa phương để xử lý theo đúng lệnh công bố dịch và hướng dẫn phòng chống PRRS của Cục Thú y, Bộ Nông nghiệp và PTNT và xin hỗ trợ thiệt hại của Nhà nước. Tiêu huỷ số lợn mắc bệnh nặng không chờ kết quả xét nghiệm (lợn mắc bệnh nặng đã được chăm sóc tích cực, được hỗ trợ tăng cường sức đề kháng trong vòng 7 ngày nhưng không có khả năng bình phục), lợn mắc bệnh nhẹ nuôi cách ly triệt để với lợn chưa bị bệnh để theo dõi chặt chẽ diễn biến bệnh. (2) Chính quyền và thú y địa phương tổ chức bao vây ổ dịch, ngăn cấm không cho vận chuyển lợn ra khỏi ổ dịch và cũng không mang lợn từ ngoài vào ổ dịch. Các gia trại và trang trại phối hợp với chính quyền và thú y thực hiện nghiêm túc biện pháp này. (3) Không bán chạy lợn ra ngoài, không mổ lợn và bán thịt lợn trong vùng dịch khi chưa công bố hết dịch. (4) Cách ly đàn lợn khoẻ để nuôi dưỡng, chăm sóc tốt và tổ chức tiêm thuốc trợ sức, nâng cao sức đề kháng của đàn lợn với bệnh. (5) Tổ chức làm vệ sinh triệt để chuồng trại và khu chăn thả đã có lợn ốm và phun thuốc sát trùng 2lần/tuần trong suốt thời gian có dịch. (6) Tổ chức tiêm vacxin phòng PRRS ở các vùng chưa có dịch, nhưng bị dịch uy hiếp, nếu có thể được. (7) Tuyên truyền về PRRS và các biện pháp phòng chống trên các phương tiện truyền thông từ Trung ương đến địa phương để người chăn nuôi nâng cao ý thức áp dụng các biện pháp chống dịch. (8) Chỉ nuôi lợn trở lại khi có lệnh công bố hết dịch và đã để trống chuồng 4 tuần; đồng thời phun thuốc sát trùng theo đúng quy định. 2.3.6.3. Phòng bệnh bằng vacxin Hiện nay chưa có loại thuốc nào đặc hiệu điều trị hội chứng rối loạn hô hấp và sinh sản ở lợn. Có thể sử dụng một số thuốc tăng cường sức đề kháng, điều trị triệu chứng và chủ yếu là ngăn ngừa bệnh kế phát. Chính vì vậy, để phòng chống bệnh ngoài việc chăn nuôi an toàn sinh học, chăm sóc nuôi dưỡng tốt ...thì tiêm vacxin phòng bệnh cũng là một giải pháp quan trọng. Danh mục thuốc thú y được phép lưu hành của Bộ Nông nghiệp và PTNT có 3 loại vacxin nhập khẩu gồm: Porcilis PRRS của Intervet - Hà Lan; Amervac PRRS của Hipra - Tây Ban Nha và BSL.PS.100 của Bestar - Singapore. Việt Nam cũng đã nhập khẩu vacxin chết phòng PRRS thể độc lực cao từ Trung Quốc, Cục Thú y đang tiến hành thí điểm tại một số trại và một số địa phương. 1. Vacxin phòng PRRS BSL - PS100: là loại vacxin sống nhược độc dạng đông khô có nguồn gốc từ chủng JKL-100 thuộc dòng PRRSV Bắc Mỹ. Một liều vacxin chứa ít nhất 105 TCID50. Vacxin chỉ được pha với dung dịch pha chuyên biệt, sử dụng tiêm bắp với liều 2ml/lợn. Miễn dịch chắc chắn sau tiêm 1 tuần và kéo dài 4 tháng. Lợn con tiêm lần đầu vào lúc 3 tuần tuổi. Lợn đực giống tiêm lúc 18 tuần tuổi và tái chủng hàng năm. Nái hậu bị và nái sinh sản tiêm phòng trước khi cai sữa cho con hoặc trước lúc phối giống. 2. Vacxin phòng PRRS BSK-PS100: là loại vacxin vô hoạt chứa chủng PRRSV dòng châu Âu. Một liều vacxin chứa ít nhất 107,5 TCID50. Vacxin an toàn và gây miễn dịch tốt. Liều dùng 2ml/con, tiêm bắp. Lợn con: sử dụng lần đầu vào lúc 3 - 6 tuần tuổi. Nái hậu bị: tiêm lúc 18 tuần tuổi, tiêm nhắc lại sau 3 - 4 tuần. Nái sinh sản: tiêm 3 - 4 tuần trước khi phối giống. Lợn đực giống: tiêm lúc 18 tuần tuổi, tái chủng 6 tháng/1 lần. Bảo quản vacxin ở 20C - 60C. 3. Vacxin Amervac-PRRS: là vacxin nhược độc đông khô, chứa virut chủng châu Âu VP 046 BIS, mỗi liều ít nhất 103,5TCID50. Vacxin này có khả năng bảo hộ tất cả các chủng châu Âu khác và Bắc Mỹ. Đây là chủng an toàn nhất trong các chủng châu Âu và hoàn toàn không hoàn nguyên độc lực. Liều lượng 2ml/con, tiêm vào cơ cổ. Lợn con: tiêm 1 lần lúc 3 - 4 tuần tuổi, khả năng bảo hộ tới 5 tháng tuổi. Lợn nái hậu bị: chủng 1 lần ở thời điểm 5 tuần trước khi phối giống. Lợn đực giống: chủng lúc 5 tuần tuổi, sau đó tái chủng 6 tháng/1 lần. Lợn nái: chủng 1 liều sau khi sinh 12 - 15 ngày. Bảo quản: 2 - 80C. Hiện nay, tuy chưa có những đánh giá cụ thể về hiệu quả sử dụng vacxin ở Việt Nam nhưng việc tiêm phòng vacxin chỉ thực sự hiệu quả khi đồng thời thực hiện các biện pháp an toàn sinh học, kiểm tra huyết thanh định kỳ... 3. NỘI DUNG, NGUYÊN LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1. NỘI DUNG NGHIÊN CỨU 3.1.1. Tình hình HCRLHH và SS ở đàn lợn nuôi trên địa bàn tỉnh Bắc Giang Tổng hợp chung tình hình HCRLHH và SS ở đàn lợn nuôi trên địa bàn tỉnh Bắc Giang. Tình hình HCRLHH và SS ở đàn lợn nái. Tình hình HCRLHH và SS ở đàn lợn thịt. Tình hình HCRLHH và SS ở đàn lợn con theo mẹ. 3.1.2. Một số chỉ tiêu về sức sản xuất của đàn lợn nái sau dịch - Kết quả điều tra về số lần phối giống đối với những nái trong đàn lợn xảy ra HCRLHH và SS được giữ lại sản xuất con giống. - Số lần phối giống của nái hậu bị. - Thời gian động dục lại và số lần phối giống của nái cai sữa. - Thời gian động dục lại và số lần phối giống của nái bị bệnh (đẻ non, sảy thai, thai chết lưu…). - Thời gian động dục lại và tỷ lệ đẻ ở các lứa đẻ sau dịch của nái hậu bị. - Thời gian động dục lại và tỷ lệ đẻ ở các lứa đẻ sau dịch của nái cai sữa. - Thời gian động dục lại và tỷ lệ đẻ ở các lứa đẻ sau dịch của những nái bị bệnh (sảy thai, đẻ non, thai chết lưu…). - Một số chỉ tiêu về khả năng sinh sản và chất lượng đàn con của đàn lợn nái xảy ra HCRLHH và SS được giữ lại sản xuất con giống. - Một số chỉ tiêu về khả năng sinh sản và chất lượng đàn con của những nái hậu bị. - Một số chỉ tiêu về khả năng sinh sản và chất lượng đàn con của những nái cai sữa chờ phối. - Một số chỉ tiêu về khả năng sinh sản và chất lượng đàn con của những nái bị bệnh (sảy thai, đẻ non, thai chết lưu). Khả năng tăng trọng của lợn con cai sữa sau HCRLHH và SS. 3.1.3. Các biện pháp phòng chống bệnh tại Bắc Giang. 3.2. NGUYÊN LIỆU - Tư liệu về tình hình hội chứng rối loạn hô hấp và sinh sản ở lợn từ năm 2007 - 2009 tại Chi cục Thú y Bắc Giang, Cơ quan Thú y vùng II, Trung tâm Chẩn đoán Thú y Trung ương, Cục Thú y. - Số liệu điều tra dịch bệnh trực tiếp tại các cơ sở. - Mẫu bệnh phẩm lợn mắc HCRLHH và SS lấy từ các ổ dịch. 3.3. PHƯƠNG PHÁP NGHIÊN CỨU 3.3.1. Phương pháp thu thập số liệu Điều tra hiện trạng qua phiếu điều tra, quan sát cũng như phỏng vấn trực tiếp theo phương pháp hồi cứu. 3.3.2. Phương pháp lấy mẫu, vận chuyển và bảo quản bệnh phẩm Lấy mẫu, bảo quản và vận chuyển theo hướng dẫn của Cục Thú y. 3.3.3. Giám định PRRSV bằng phản ứng RT-PCR Quy trình cơ sở xét nghiệm PRRSV bằng phương pháp Realtime RT-PCR của Cục Thú y. * Phạm vi áp dụng: quy trình được áp dụng để xét nghiệm phát hiện PRRSV tại các phòng xét nghiệm chẩn đoán bệnh động vật thuộc Cục Thú y. * Bệnh phẩm: huyễn dịch bệnh phẩm, huyết thanh hoặc dịch nổi tế bào sau khi phân lập virut. * Máy móc và nguyên liệu: - Hệ thống chiết tách RNA - Máy Realtime PCR - Bộ Micropipette các cỡ - Kít chiết tách RNA (Qiagen hoặc Ambion Magmax) - Kít RT-PCR: Qiagen one step RT-PCR kit Cat No.210210) hoặc Invitrogen supercript III qRT-PCR kit (Cat No.12574-026) - Primer và probe * Cách tiến hành: + Chiết tách RNA: áp dụng theo quy trình của nhà sản xuất + Chuẩn bị master mix Qiagen one-step RT-PCR kit Invitrogen SS3 qRT-PCR kit Reagent Lượng (µl) Reagent Lượng (µl) DW 10.5 DW 4.5 5x Reaction Mix 5.0 5x Reaction Mix 12.5 MgCl2 (25mM) 1.2 MgCl2 (25mM) 1.0 dNTP 0.8 PPP 1.5 PPP 1.5 Enzyme mix 1.0 Enzyme mix 0.5 - Cho 20 µl master mix vào ống PCR - Cho 5 µl mẫu RNA vào ống PCR - Đặt ống PCR vào máy Realtime PCR - Chạy chương trình - Chọn đọc màu ở bước kéo dài + Chạy phản ứng Qiagen one-step RT-PCR kit Invitrogen SS3 qRT-PCR kit RT PCR RT PCR 500C-30m, 950C-15m 40 x (950C-10s + 600C-50s) 500C-30m, 950C-2m 40 x (950C-10s + 600C-50s) * Đọc kết quả: Xét nghiệm được công nhận khi: - Đối chứng dương tính cho giá trị Ct đã biết (±2) - Đối chứng âm tính không có Ct - Mẫu được coi là dương tính khi có Ct ≤ 35 - Mẫu được coi là âm tính nếu không có Ct - Mẫu được coi là nghi ngờ nếu Ct > 35 Danh mục và trình tự primer và probe Tên Primer/probe Sequence (5’ - 3’) Modification 5’ 3’ PRRS-1 (NA) Probe TGT GGT GAA TGG CAC TGA TTG CA FAM BHQ1 Forward ATG ATG RGC TGG CAT TCT None None Reverse ACA CGG TCG CCC TAA TTG None None PRRS-2 (EU) Probe CCT CTG CTT GCA ATC GAT CCA GAC FAM BHQ1 Forward GCA CCA CCT CAC CCA GAC None None Reverse CAG TTC CTG CGC CTT GAT None None PRRS-China (JVM) Probe CGCGTAGAACTGTGACAACAACGCTGA HEX BHQ1 Forward CCCAAGCTGATGACACCTTTG None None Reverse AATCCAGAGGCTCATCCTGGT None None 3.3.4. Phương pháp xử lý số liệu Các số liệu thu thập được xử lý bằng phương pháp thống kê sinh học thông qua phần mềm Excell trên máy vi tính. Ứng dụng phần mềm ArcGIS 9.3 vẽ bản đồ dịch tễ PRRS. 4. KẾT QUẢ VÀ THẢO LUẬN 4.1. TÌNH HÌNH HỘI CHỨNG RỐI LOẠN HÔ HẤP VÀ SINH SẢN Ở ĐÀN LỢN TRÊN ĐỊA BÀN TỈNH BẮC GIANG Những năm gần đây ngành chăn nuôi ở Bắc Giang phát triển khá mạnh, số lượng đàn vật nuôi, đặc biệt là đàn lợn liên tục tăng. Tuy nhiên trong quá trình chăn nuôi, người dân đã gặp nhiều khó khăn, trong đó có dịch bệnh gây thiệt hại lớn, đặc biệt là hội chứng rối loạn hô hấp và sinh sản ở lợn (sau đây gọi là HCRLHH và SS). Theo báo cáo của Sở Nông nghiệp và PTNT Bắc Giang và Chi cục Thú y tỉnh, HCRLHH và SS đã xảy ra 2 đợt trên địa bàn: tháng 4/2007 và tháng 4 - 5/2009. Do phát hiện dịch chậm, không chấp hành nghiêm các quy định về phòng chống dịch, giấu dịch do chưa hiểu hết về tác hại, cách lây lan của HCRLHH và SS, cùng với việchahgfdsgftrg vào cuộc chậm của chính quyền và việc chủ quan của người dân, dịch đã tiếp tục lan ra 8/10 huyện [17]. 4.1.1. Tổng hợp chung tình hình HCRLHH và SS ở đàn lợn trên địa bàn tỉnh Bắc Giang Tổng hợp về tình hình HCRLHH và SS ở lợn trên địa bàn tỉnh Bắc Giang được trình bày ở bảng 4.1: Từ số liệu bảng 4.1 cho thấy: Có 8/10 huyện thị của tỉnh Bắc Giang có lợn mắc HCRLHH và SS, với 287 thôn của 63 xã tregfdgfdgfdjfdhhdfđgftrong tổng số 190 xã. Tỷ lệ lợn mắc bệnh so với tổng đàn dao động trong khoảng 78,41% đến 98,77%. Trung bình số lợn mắc bệnh chiếm 95,87%. Tỷ lệ lợn chết so với lợn mắc bệnh dao động trong khoảng 0,46% đến 43,16%, trung bình 16,71%. Số lợn buộc phải tiêu hủy so với tổng số lợn bệnh chiếm tỷ lệ trung bình 6,40%. Bảng 4.1: Tổng hợp chung tình hình HCRLHH và SS ở lợn trên địa bàn tỉnh Bắc Giang TT Địa phương Số xã có dịch/Tổng số xã Số thôn có lợn mắc bệnh (thôn) Số hộ có lợn mắc bệnh (hộ) Tổng đàn lợn của những hộ có lợn mắc bệnh (con) Lợn mắc bệnh Lợn bị chết Lợn buộc phải tiêu hủy Số con Tỷ lệ (%) Số con Tỷ lệ (%) Số con Tỷ lệ (%) 1 TP. Bắc Giang 6/11 12 169 600 551 91,83 122 22,14 - - 2 H. Hiệp Hòa 2/26 5 53 579 454 78,41 79 17,40 - - 3 H. Lạng Giang 7/24 37 99 410 349 85,12 55 15,76 - - 4 H. Lục Nam 12/26 48 116 2.232 2.165 97,00 210 9,70 384 17,74 5 H. Sơn Động 11/23 39 180 1.200 1.165 97,08 284 24,38 246 21,12 6 H. Tân Yên 3/23 5 13 107 95 88,79 41 43,16 43 45,26 7 H. Yên Dũng 2/25 5 759 1.139 1.093 95,96 5 0,46 - - 8 H. Lục Ngạn 20/32 136 854 4.700 4.642 98,77 1.016 21,89 - - Σ toàn tỉnh 63/190 287 2.243 10.967 10.514 95,87 1.757 16,71 673 6,40  ừ kết quả ở bảng 4.1 còn nhận thấy tình hình dịch ở đàn lợn của từng huyện rất khác nhau: - Huyện Yên Dũng mặc dù là huyện xảy ra dịch đầu tiên của tỉnh Bắc Giang nhưng tỷ lệ lợn chết lại rất thấp (5 con chết trong tổng số 1.093 con mắc bệnh) chiếm 0,46%. - Tại huyện Tân Yên, tỷ lệ lợn chết rất cao 43,16%. Theo chúng tôi kết quả này được giải thích như sau: ở huyện Yên Dũng do lợn mắc bệnh chủ yếu là lợn nái nên khi lợn mới mắc bệnh người dân không xác định được là bệnh gì do đó đã bỏ rất nhiều tiền mua nhiều loại thuốc về tự điều trị cộng với hộ lý chăm sóc tốt dẫn đến số lợn chết ít. Huyện Tân Yên gồm 23 xã nhưng có 13 hộ thuộc 5 thôn của 3 xã với 95 lợn mắc bệnh, trong đó chết 41 con, chiếm 43,16%. Kết quả này cho thấy khi mắc HCRLHH và SS thì tỷ lệ chết đối với lợn nái thấp hơn so với lợn các đối tượng khác. Để có cái nhìn tổng quan về tình hình dịch tễ HCRLHH và SS ở lợn toàn tỉnh, chúng tôi lập bản đồ dịch tễ PRRS trên cơ sở tổng số lợn mắc bệnh tại các xã, huyện có dịch xảy ra. Dựa vào số liệu báo cáo của Chi cục Thú y Bắc Giang, kết hợp với điều tra thực tế, chúng tôi tiến hành đánh giá thiệt hại do HCRLHH và SS gây ra đối với lợn từng đối tượng nuôi. Kết quả được trình bày ở 4.1.2, 4.1.3 và 4.1.4. 4.1.2. Tình hình HCRLHH và SS ở đàn lợn nái trên địa bàn tỉnh Bắc Giang Tiến hành đánh giá tác động của HCRLHH và SS tới đàn lợn nái thông qua số lợn mắc bệnh, số lợn bị chết, và số lợn bị tiêu hủy. Kết quả được trình bày ở bảng 4.2: Từ số liệu tổng hợp trong bảng 4.2 cho thấy: Bắc Giang là một trong những tỉnh chăn nuôi lợn khá phát triển. Đặc biệt là nhiều gia đình, nhiều cơ sở, doanh nghiệp nuôi lợn nái để chủ động sản xuất con giống cung cấp cho người dân trong tỉnh. Tuy nhiên đợt dịch HCRLHH và SS đã gây ảnh hưởng không nhỏ đến đàn lợn nái giống của địa phương. Cụ thể: Bảng 4.2: Tình hình HCRLHH và SS ở đàn lợn nái trên địa bàn tỉnh Bắc Giang TT Địa phương Tổng đàn lợn của những hộ có lợn mắc bệnh (con) Tổng số lợn mắc bệnh (con) Lợn nái mắc bệnh Tổng số lợn chết (con) Lợn nái bị chết Tổng số lợn bị tiêu hủy (con) Lợn nái bị tiêu hủy Số con Tỷ lệ %/ tổng đàn lợn của những hộ có lợn mắc bệnh (%) Tỷ lệ %/ tổng số lợn mắc bệnh (%) Số con Tỷ lệ %/ tổng đàn lợn của những hộ có lợn mắc bệnh (%) Tỷ lệ %/ tổng số lợn mắc bệnh (%)gfdgfdgfdg Tỷ lệ chết (%) Số con Tỷ lệ %/ tổng đàn lợn của những hộ có lợn mắc bệnh (%) Tỷ lệ tiêu hủy (%) 1 TP Bắc Giang 600 551 162 27,00 29,40 122 59 9,83 10,71 48,36 - - - - 2 H. Hiệp Hòa 579 454 49 8,46 10,79 79 1 0,17 0,22 1,27 - - - - 3 H. Lạng Giang 410 349 55 13,41 15,76 55 55 13,41 15,76 100,00 - - - - 4 H. Lục Nam 2.232 2.165 305 13,66 14,09 210 59 2,64 2,73 28,10 384 - - - 5 H. Sơn Động 1.200 1.165 127 10,58 10,90 284 16 1,33 1,37 5,63 246 16 1,33 6,50 6 H. Tân Yên 107 95 21 19,63 22,11 41 - - - - 43 - - - 7 H. Yên Dũng 1.139 1.093 1.093 95,96 100,00 5 5 0,42 0,46 100,00 - - - - 8 H. Lụ._. trong mua bán động vật, sản phẩm động vật. - Tiêm phòng: Tiêm vacxin là một trong những biện pháp chủ động ngăn ngừa dịch bệnh. Mặc dù vacxin không có khả năng ngăn cản virut xâm nhập nhưng có khả năng giảm mức độ gây hại của virut. Chính vì vậy sau khi dịch xảy ra, Bắc Giang đã có hướng chỉ đạo tiến hành tiêm vacxin phòng PRRS cho đàn lợn của địa phương theo kế hoạch số 93/KH-TY ngày 15/4/2008 về việc tiêm phòng vacxin PRRS cho đàn lợn giống theo chương trình hỗ trợ của tỉnh. Việc tiêm phòng vacxin PRRS cho đàn lợn trong diện tiêm được tiến hành đồng thời với việc tiêm phòng triệt để các loại vacxin theo kế hoạch tiêm phòng chung của Chi cục Thú y, đặc biệt chú trọng đàn lợn nái và đực giống. Toàn tỉnh đã tiêm được cho trên 15 ngàn con lợn, tuy nhiên kết quả này cũng chưa đáp ứng được yêu cầu phòng PRRS do tính chất lây lan nhanh của dịch. - Tuyên truyền: Xác định tuyên truyền là biện pháp giúp mọi người nhận thức đúng về nguy cơ và sự ảnh hưởng khi có dịch PRRS xảy ra trên địa bàn, từ đó để người dân có ý thức tự giác thực hiện các biện pháp phòng chống dịch. Bắc Giang đã tăng cường hoạt động tuyên truyền dưới nhiều hình thức về các biện pháp phòng chống, sự nguy hại của dịch bệnh để người chăn nuôi và mọi người dân có thể phát hiện, khai báo kịp thời cho thú y cơ sở, thực hiện các biện pháp an toàn sinh học trong chăn nuôi; tiêm phòng vacxin PRRS cho đàn lợn; không mua bán, sử dụng thực phẩm động vật chưa được kiểm soát về thú y; không ăn tiết canh, không ăn thực phẩm chưa được chế biến kỹ. UBND các cấp chỉ đạo việc thực hiện thông tin tuyên truyền theo nội dung của cơ quan thú y, tuyên truyền, vận động người chăn nuôi cam kết thực hiện “5 không”: không giấu dịch; không mua bán, giết mổ lợn và sử dụng sản phẩm của lợn nghi mắc bệnh; không mua bán, sử dụng động vật, sản phẩm động vật chưa được kiểm soát về thú y; không thả rông, không vận chuyển, bán chạy lợn mắc bệnh; không vứt xác lợn nghi mắc PRRS bừa bãi. - Tập huấn kỹ thuật: Để giúp cho mạng lưới thú y cơ sở và người chăn nuôi thực hiện tốt các biện pháp phòng chống PRRS, Chi cục Thú y đã tổ chức các lớp tập huấn về kiến thức phòng chống dịch tại Chi cục cũng như đến tận các xã, phường, thị trấn. - Chế độ trực dịch và báo cáo: Việc nắm bắt và xử lý thông tin về tình hình dịch bệnh là rất quan trọng, chính vì vậy Chi cục Thú y đã nghiêm túc thực hiện chế độ trực dịch và báo cáo tình hình. Tại Chi cục Thú y và các Trạm Thú y đều thực hiện chế độ trực chống dịch 24/24 giờ. Mọi thông tin về dịch và các nhu cầu cần thiết đáp ứng phòng chống dịch của người chăn nuôi và các cơ sở đều được giải quyết chính xác, kịp thời. Với các biện pháp chuyên môn này, dịch PRRS tại Bắc Giang đã nhanh chóng được khống chế, đẩy lùi, không làm ảnh hưởng đến ngân sách của tỉnh và cơ bản vẫn giữ được đàn lợn sinh sản cho người dân. 4.3.2. Biện pháp phòng dịch Hiện chưa có thuốc điều trị đặc hiệu cho HCRLHH và SS nên công tác phòng bệnh đóng vai trò hết sức quan trọng. Mặc dù HCRLHH và SS đã được khống chế nhưng không lơ là, chủ quan trước nguy cơ tái phát dịch. Các cấp chính quyền, đoàn thể và các ngành liên quan triển khai các biện pháp khẩn cấp phòng chống HCRLHH và SS, thực hiện có hiệu quả các biện pháp để đối phó và ngăn chặn dịch bệnh với tinh thần nỗ lực cao nhất: - Tổ chức tuyên truyền, phổ biến kiến thức liên tục, thường xuyên bằng nhiều hình thức cho mọi người hiểu biết về sự nguy hại của bệnh, thực hiện tốt “3 không”: không dấu khi lợn bệnh, không bán chạy lợn bệnh, không vứt xác lợn chết bừa bãi. - Duy trì hoạt động thường xuyên của Ban chỉ đạo phòng, chống dịch động vật. Phân công trách nhiệm giám sát dịch bệnh cho từng thành viên Ban chỉ đạo và chính quyền cấp thôn, xã đến từng cơ sở, hộ gia đình chăn nuôi. - Tăng cường hoạt động kiểm soát của Đội kiểm tra liên ngành, tăng cường công tác kiểm dịch vận chuyển động vật, kiểm tra vệ sinh thú y trên địa bàn, xử lý nghiêm các trường hợp vi phạm. - Thành lập các Trạm kiểm dịch ở những nơi trọng điểm nhằm ngăn chặn nguồn dịch lây lan từ bên ngoài vào tỉnh. Đã thành lập 6 chốt kiểm soát trọng yếu thuộc địa bàn các huyện Hiệp Hoà, Việt Yên, Yên Dũng, Lục Nam, Lục Ngạn, Sơn Động. - Chi cục Thú y đã xây dựng Phương án số 228/KH-TY về phòng chống PRRS của tỉnh với nhiệm vụ trọng tâm tăng cường giám sát dịch bệnh đến cơ sở, hộ chăn nuôi, phát hiện, báo cáo và xử lý kịp thời không để dịch bệnh lan rộng, chú trọng các địa bàn có nguy cơ cao. Đồng thời yêu cầu các Trạm thú y tham mưu chính quyền các cấp tổ chức thực hiện nghiêm túc. - Đặc biệt, Bắc Giang chú trọng chỉ đạo việc tiêm phòng các loại vacxin cho đàn lợn khoẻ mạnh. Trước mắt đã tiến hành hỗ trợ tiêm kết hợp vacxin phòng PRRS và vacxin Dịch tả lợn cho 100% đàn lợn nái, lợn đực giống và lợn tại các trang trại trong toàn tỉnh. Thông báo rộng rãi đến người chăn nuôi và chủ động các điều kiện kỹ thuật đáp ứng đầy đủ nhu cầu sử dụng vacxin phòng PRRS cho người chăn nuôi. Bên cạnh việc thực hiện triệt để các biện pháp chuyên môn: quản lý giám sát dịch bệnh; vệ sinh tiêu độc khử trùng; kiểm dịch, kiểm tra vệ sinh thú y; kiểm soát lưu thông động vật, sản phẩm động vật trên thị trường; tổ chức tiêm phòng hàng năm; thực hiện nghiêm chế độ báo cáo dịch cũng như các công tác khác về phòng chống dịch bệnh, Chi cục Thú y Bắc Giang đã thành lập tổ quản lý chuyên trách giám sát HCRLHH và SS, xử lý kịp thời các thông tin về dịch bệnh, lập hồ sơ theo dõi, giám sát chặt chẽ tình hình dịch tại 10 huyện, thành phố. Đặc biệt lưu ý các địa phương đã có bệnh lưu hành và vùng có nguy cơ cao. Hiện tại Bắc Giang hoàn toàn chủ động và sẵn sàng đối phó với HCRLHH và SS. 5. KẾT LUẬN VÀ ĐỀ NGHỊ 5.1. KẾT LUẬN Từ kết quả được trình bày ở trên chúng tôi đưa ra một số kết luận sau: 1. 8/10 huyện thị của tỉnh Bắc Giang có lợn mắc HCRLHH và SS, với 287 thôn của 63 xã trong tổng số 190 xã. Tỷ lệ lợn mắc bệnh trong toàn tỉnh 95,87%, tỷ lệ lợn chết là 16,71% trong đó: Tỷ lệ lợn nái, lợn thịt và lợn con mắc bệnh so với tổng số lợn bệnh lần lượt là 24,57%, 38,99%, 36,29%. Tỷ lệ chết của lợn nái và lợn thịt so với tổng số lợn mắc bệnh thấp (2,26% và 1,00%), tỷ lệ chết của lợn thịt so với tổng số lợn bệnh tăng cao ở lợn con theo mẹ (13,99%). 2. Các mẫu bệnh phẩm lấy từ lợn có biểu hiện triệu chứng lâm sàng của HCRLHH và SS của các huyện xét nghiệm đều cho kết quả dương tính với PRRSV chiếm 52,94% (09/17 mẫu dương tính). 3. Dù nái hậu bị, nái cai sữa hay nái bị bệnh trong đàn xảy ra HCRLHH và SS được giữ lại để sản xuất con giống đều không mang lại hiệu quả kinh tế. Vì ở những lứa đẻ sau dịch, thời gian động dục lại kéo dài (nái cai sữa thời gian động dục dao động 7±3,02 đến 11±3,11 ngày; nái bị bệnh 13±4,75 đến 18±2,34 ngày). Tỷ lệ đẻ không cao (nái hậu bị dao động 69,77% đến 93,55%; nái cai sữa 65,56% đến 93,94%; nái bị bệnh 59,17% đến 83,33%), một số con phải phối giống tới 2 - 3 lần. Nhiều con bị viêm nhiễm đường sinh dục, vẫn có một tỷ lệ nhất định bị chết thai, đẻ non. 4. Lợn nái hậu bị, nái cai sữa sau tách con hay nái bị bệnh được điều trị khỏi về triệu chứng trong đàn lợn xảy ra HCRLHH và SS được giữ lại để sản xuất con giống thì các chỉ tiêu về khả năng sinh sản và chất lượng đàn con ở các lứa đẻ sau dịch đều kém hơn so với nái không bị bệnh, đặc biệt ở lứa 1 và 2 ngay sau dịch (nái hậu bị ở lứa 1, 2 sau dịch với số con đẻ ra/lứa tương đương nhau: 11,89±0,51 con/ổ và 10,15 ± 0,48 con/ổ, nái cai sữa: 11,25 ± 1,05 con/ổ và 11,04 ± 1,75 con/ổ, nái bị bệnh: 11,40 ± 0,51 con/ổ và 11,04 ± 0,63 con/ổ nhưng số con cai sữa/ổ của nái hậu bị 6,56 ± 0,31 con/ổ và 6,60 ± 0,56 con/ổ, nái cai sữa lần lượt 5,50 ± 2,50 và 6,03 ± 2,11 con/ổ, nái bị bệnh 4,60 ± 0,31 và 5,50 ± 0,52 con/ổ; khối lượng cai sữa/con của nái hậu bị là 4,93 ± 0,56 kg/con và 4,63 ± 0,06kg/con; nái cai sữa 4,85 ± 0,11 và 5,05 ± 0,14 kg/con; nái bị bệnh lần lượt 4,06 ± 0,06 và 4,23 ± 0,06 kg/con). 5. Cùng trọng lượng cai sữa tương đương nhau nhưng khả năng tăng trọng của lợn con không mắc HCRLHH và SS cao hơn những lợn bị dịch (Khối lượng cai sữa của lợn con sau dịch 5,07 ± 0,06 kg/con, của lợn trước dịch 5,18 ± 0,08 kg/con; khối lượng xuất chuồng của lợn sau dịch 80,20 ± 3,71 kg/con; lợn trước dịch 85,57 ± 2,06 kg/con). 5.2. ĐỀ NGHỊ Trong quá trình điều tra chúng tôi đề nghị một số một số vấn đề như sau: 1. Trong chăn nuôi đặc biệt là chăn nuôi theo hình thức gia trại, trang trại áp dụng chăn nuôi an toàn sinh học. Thường xuyên định kì phun sát trùng, hạn chế khách ra vào trại, không nuôi vật thả rông trong trại. 2. Tập trung nâng cao sức đề kháng của đàn lợn bằng việc tăng cường chăm sóc nuôi dưỡng, tiêm vacxin phòng dịch đầy đủ. 3. Định kì nhập mới lợn hậu bị về để thay thế đàn, thường xuyên loại thải những nái có vấn đề, nái quá già, không nên khai thác quá nhiều lứa (chỉ nên khai thác tối đa 10 lứa/nái). 4. Những lợn bị mắc HCRLHH và SS thì không nên giữ lại để khai thác: nuôi sinh sản, nuôi đến xuất chuồng… (chỉ có thể giữ những lợn ít bị ảnh hưởng của dịch: những lợn không có biểu hiện rõ triệu chứng của HCRLHH và SS). TÀI LIỆU THAM KHẢO TÀI LIỆU TIẾNG VIỆT Cục Thú y (2007), “Báo cáo tình hình dịch bệnh trên đàn lợn ở các tỉnh đồng bằng sông Hồng”, Hà Nội. Cục Thú y (2008), “Báo cáo phòng chống hội chứng rối loạn hô hấp và sinh sản ở lợn, Hội thảo khoa học: phòng chống hội chứng rối loạn hô hấp và sinh sản”, ngày 21/5/2008, Hà Nội. Cục Thú y (2008), Báo cáo tình hình dịch bệnh vùng Tả ngạn sông Hồng, Cơ quan Thú y vùng II. Cục Thú y (2008), Hội thảo tập huấn “Kỹ năng giám sát chủ động và điều tra ổ dịch PRRS - Cục Thú y 20 - 22/11/2008”. Cục Thú y (2008), Quy trình chẩn đoán hội chứng Rối loạn hô hấp và sinh sản, Trung tâm Chẩn đoán Thú y Trung ương. Cục Thú y (2009), Báo cáo sơ kết công tác 6 tháng đầu năm 2009, phòng chống dịch bệnh gia súc, gia cầm. La Tấn Cường (2005), Sự lưu hành và ảnh hưởng của Hội chứng rối loạn sinh sản và hô hấp trên heo (PRRS) ở một số trại chăn nuôi tại TP Cần Thơ, Luận văn thạc sĩ - Trường Đại học Cần Thơ. Nguyễn Lương Hiền, Ngô Thanh Long, Nguyễn Ngô Minh Triết và cs (2001), Bước đầu khảo sát hội chứng rối loạn sinh sản và hô hấp ở một số trại heo giống thuộc vùng TPHCM, Bộ Nông nghiệp và PTNT-Báo cáo khoa học, Phần chăn nuôi thú y 1999-2000, tr.244-247. Võ Trọng Hốt và cộng sự (2000), Giáo trình chăn nuôi lợn, Nhà xuất bản Nông nghiệp. Jenny G. Cho, Scott A. Dee (2007), Virus gây hội chứng rối loạn sinh sản và hô hấp ở lợn, Khoa học Kỹ thuật thú y, tập XIV - số 5-2007, tr.74-80. Trần Thị Bích Liên và Trần Thị Dân (2003), Tỷ lệ nhiễm PRRS và một số biểu hiện lâm sàng về rối loạn sinh sản, Trường Đại học Nông lâm TPHCM - Hội nghị khoa học CNTY lần IV, 2003. Hoàng Văn Năm (2001), Các bệnh mới phát hiện ở gia súc, gia cầm nhập nội và các công nghệ mới trong chẩn đoán, phòng trị, NXB Nông nghiệp, Hà Nội. Lê Văn Năm (2007), Khảo sát bước đầu các biểu hiện lâm sàng và bệnh tích đại thể bệnh tai xanh ở lợn tại một sô địa phương vùng đồng bằng Bắc bộ, Khoa học kỹ thuật Thú y - tập XIV - số 6-2007, tr.10-18. Trần Văn Phùng (2004), Kỹ thuật chăn nuôi lợn nái sinh sản, Viện Chăn nuôi Quốc gia - NXB Lao động Xã hội. Tô Long Thành (2007), Hội chứng rối loạn sinh sản và hô hấp của lợn, Khoa học kỹ thuật Thú y, tập XIV số 3-2007, tr.81-88. Tô Long Thành, Nguyễn Văn Long (2008), Kết quả chẩn đoán và nghiên cứu virus gây Hội chứng sinh sản và hô hấp (PRRS) trên lợn ở Việt Nam từ tháng 3/2007 đến 5/2008, Khoa học kỹ thuật Thú y - tập XV - số 2-2005, tr5-13. Sở Nông nghiệp và PTNT Bắc Giang (2008), Báo cáo tình hình và các biện pháp cấp bách phòng chống dịch bệnh rối loạn hô hấp và sinh sản, ngày 11 tháng 4 năm 2008. Trung tâm khuyến nông Quốc gia - Bộ Nông nghiệp và PTNT (2007), Hội chứng rối loạn sinh sản, hô hấp ở lợn và các văn bản chỉ đạo, hướng dẫn phòng chống, NXB Nông nghiệp. TÀI LIỆU TIẾNG ANH Albina E. Epidemiology of porcine reproductive and respiratory syndrome (PRRS): an overview.Vet Microbiol. 1997;55:309-16. Albina, E., F. Madec, R. Cariolet, and J. Torrison. 1994. Immune response and persistence of the porcine reproductive and respiratory syndrome virus in infected pigs and farm units. Vet. Rec. 134:567-573. An TQ, Zhou YJ, Liu GQ, Tian ZJ, Li J, Qiu HJ. et al. Genetic diversity and phylogenetic analysis of glycoprotein 5 of PRRSV isolate in mainland China from 1996 to 2006: coexistence of two Nasubgenotypes with great diversity. Vet Microbiol.2007; 123:43-52.DOIL 10.1016/j.vetmic.2007.02.025. Benfield DA, Nelson E, Collins JE, et al. 1992b. Characterization of swine infertility and respiratory syndrome (SIRS) virus (isolate ATCC VR-2332). J Vet Diagn Invest 4:127-133. Blaha T. The “Colourful” epidemiology of PRRS. Vet Res. 2000;31:77-83. Canon, N. Et al.1998 Vet.Rec, 142.142. Cavanagh D. Nidovirales: a new order comprising Coronaviridae and Arteriviridae. Arch Virol.1997;142:629-633. Christianson W and Joo HS. 1994. Porcine reproductive and respiratory syndrome: a review. Swine Health and Production 2(2):10-28. Christianson WT, Choi CS, Collins JE, et al. 1993. Pathogenesis of porcine reproductive and respiratory syndrome virus infection in mid-gestation sows and fetuses. Can J Vet Res 57:262-268. Christopher-Hennings J, Nelson EA, Hines RJ, Nelson JK, Swenson SL, Zimmerman JJ, Chase CCL, Yaeger MJ, Benfield DA. Persistence of porcine reproductive and respiratory syndrome virus in serum and semen of adult boars. J Vet Diagn Invest. 1995;7:456-646. Christopher-Hennings J, Nelson EA, Nelson JK, Hines RJ, Swenson SL, Hill HT, Zimmerman JJ, Katz JB, Yaeger MJ, Chase CCL, Benfield DA. Detection of Porcine Reproductive and Respiratory Syndrome Virus in Boar Semen by PCR. J Clin Micro. 1995;33:1730-1734. Dea S, Gagnon CA, Mardassi H, Pirzadeh B, Rogan D. Current knowledge on the structural proteins of porcine reproductive and respiratory syndrome (PRRS) virus: comparison of the North American and European isolates. Arch Virol. 2000;145:659-688. Elvander M, Larsson B, Engvall A, Klingeborn B, Gunnasson A.1997. Nation -wide surveys of TGE/PRCV, CSF, PRRS, SVD, L.ponoma, and B.suis in pigs in Sweden. Epidemiol sante Anim 31-32:07.B.39. Fang Y, Kim DY, Ropp S, Steen P, Christopher Hennings J, Nelson EA, et al. Heterogenecity in Nsp2 of European-like porcine reproductive and respiratory syndrome viruses isolated in the United States. Virus res.2004;100:229-35. DOI:10.1016/j.virusres.2003.12.026. Gao ZQ, Guo X, Yang HC. Genomic characterization of two Chinese isolates of porcine respiratory and reproductive syndrome virus. Arch Virol. 2004;149:1341-1351. Garner MG, Gleeson LJ, Martin R, Higgins P.1996. Report on the national serological survey for PRRS in Australia. Pig research and Development Corporation Prọject No.BRS1/1037. Animal and plant Health Branch, Bureau of Resource Sciences, PO BOX E11 Queen Victoria Terrace, Parkes ACT260. Kapur, V., M. R. Elam, T. M. Pawlovich, and M. P. Murtaugh. 1996. Genetic variation in porcine reproductive and respiratory syndrome virus isolates in the midwestern United States. J. Gen. Virol. 77:1271-1276. Keffaber KK. 1989. Reproductive failure of unknown etiology. American Association of Swine Practitioners Newsletter 1:1-10. Kegong Tian, X. Yu (2007), Emergence of Fatal PRRSV Varants: Unparalleled Outbreaks of Atypical PRRS in China and Molecular Dissection of the Unique Hallmark, PloS ONE 2(6), International PRRS Symposium. Loula T. 1991. Mystery pig disease. Agri Prac 12:23-34. Meng, X. J., P. S. Paul, P. G. Halbur, and M. A. Lum. 1995a. Phylogenetic analyses of the putative M (ORF 6) and N (ORF 7) genes of porcine reproductive and respiratory syndrome virus (PRRS virus): implication for the existence of two genotypes of PRRS virus in the USA and Europe. Arch. Virol. 140:745-755. Meng, X.J., P. S. Paul, P. G. Halbur, and I. Morozov. 1995b. Sequence comparison of open reading frames 2 to 5 of low and high virulence United States isolates of porcine reproductive and respiratory syndrome virus. J. Gen. Virol. 76:3181-3188. Murakami Y, Kato A, Tsuda T, Morozumi T, Miura Y, et al. Isolation and serological characterization of porcine reproductive and respiratory syndrome (PRRS) viruses from pigs with reproductive and respiratory disorders in Japan. J Vet Med Sci. 1994;56:891-894. Murtaugh, M. P., et al. Comparison of the Structural Protein Coding Sequences of the VR-2332 and Lelystad virus strain of the PRRS virus, Journal Arch. Virol. 140(8), pp. 1451-1460 (1995). Nelsen, C. J., et al., Porcine reproductive and respiratory syndrome virus comparison: Divergent evolution on two continents. J. Virol. 73 (1): pp. 270-280, 1999. Nelson EA, Christopher-Hennings J, Drew T, Wensvoort G, Collins JE, Benfield DA. Differentiation of U.S and European isolates of porcine reproductive and respiratory syndrome virus by monoclonal antibodies: J Clin Microbiol. 1993; 31:3184-9. OIE manual, (2000). Porcine reproductive and respiratory syndrome , pp 901-904. Rossow KD, Bautista EM, Goyal SM, Molitor TW, Murtaugh MP, Morrison RB, Benfield DA, Collins JE: Experimental porcine reproductive and respiratory syndrome virus infection in one-, four-, and 10-week old pigs. J Vet Diagn Invest 6:3-12, 1994. Shimizu M, Yamada S, Murakami Y, Morozumi T, Kobayashi H, et al. Isolation of porcine reproductive and respiratory syndrome (PRRS) virus from Heko-Heko disease of pigs. J Vet Med Sci. 1994;56:389-391. Swenson SL, Hill HT, Zimmerman JJ, Evans LE, Landgraf JG, Wills RW, Sanderson TP, McGinley MJ, Brevik AK, Ciszewski DK, Frey ML. Excretion of porcine reproductive and respiratory syndrome virus in semen after experimentally induced infection in boars. JAVMA. 1994;204:1943-1948. Wagstrom EA, Chang C-C, Yoon K-J, Zimmerman JJ. 2001. Shedding of porcine reproductive and respiratory syndrome (PRRS) virus in mammary secretions of sows. Am J Vet Res 62:1876-1880. web site: www.nanogenpharma.com Wensvoort G, Terpstra C, Pol JMA, et al. 1991. Mystery swine disease in the Netherlands: the isolation of Lelystad virus. Vet Q 13:121-130. Wensvoort G. Lelystad virus and the porcine epidemic abortion and respiratory syndrome. Vet Res. 1993; 24; 117-24 Wills RW, Zimmerman JJ, Swenson SL, Yoon K-J, Hill HT, Bundy DS, McGinley MJ. 1997. Transmission of porcine reproductive and respiratory syndrome virus by direct, close, or indirect contact. Journal of Swine Health and Production 5(6):213-218. Wills RW, Zimmerman JJ, Yoon K-J, Swenson SL, Hill HT, Bundy DS, Hoffman LJ, McGinley MJ, Hill HT, Platt KB. 1997. Porcine reproductive and respiratory syndrome virus: routes of excretion. Vet Microbiol 57:69-81. Yaeger MJ, Prieve T, Collins J, Christopher-Hennings J, Nelson EA, Benfield D. Evidence for the transmission of porcine reproductive and respiratory syndrome (PRRS) virus in boar semen. Swine Hlth Prod 1993, 1(5):7-9 Yoon IJ, Joo HS, Christianson WT, et al. 1993. Persistent and contact infection in nursery pigs experimentally infected with porcine reproductive and respiratory syndrome (PRRS) virus. Swine Health and Production 1(4):5-8. Zimmer Jj, Yoon KJ, Wills RW, Swenson SL.General overview of PRRSV: a perspective from the United States. Vet Microbiol. 1997;55:187-96.DOI: 10.1016/SO378-1135(96)01330-2. PHỤ LỤC PHIẾU ĐIỀU TRA Ổ DỊCH TAI XANH (PRRS) A. THÔNG TIN CHUNG Đây là ổ dịch mới? Không đúng Đúng Ngày báo cáo Ngày ………Tháng……Năm…………….. Người báo dịch là: Chủ gia súc Nhân viên thú y cơ sở Cán bộ thú y Cán bộ chính quyền địa phương (Trưởng thôn, cán bộ xã) Khác (ghi rõ) Địa điểm xảy ra ổ dịch Địa chỉ Thôn/làng Xã/phường Huyện/quận Tỉnh/thành phố Toạ độ (nếu có GPS): Vĩ độ ……………. Kinh độ ……………………. Thời gian xuất hiện triệu chứng lâm sàng: Ngày………tháng………năm…. Loại lợn phát bệnh đầu tiên: ………………………………………………… Nguồn gốc của lợn? Toàn bộ lợn do gia đình tự nhân giống sản xuất Có lợn mới đưa về từ hộ khác ở cùng làng, xã Tên xã ………………………….., đưa về ngày……tháng……năm…… Có lợn mới được đưa về từ huyện khác. Tên huyện ………………tỉnh ………., đưa về ngày……tháng……năm…… Chủng loại và số lượng lợn trong ổ dịch (con) Lợn con theo mẹ: Tổng số............Mắc bệnh............Chết......... Tự hồi phục....... Sau cai sữa Tổng số.............Mắc bệnh...............Chết............ Tự hồi phục....... Thịt Tổng số...........Mắc bệnh..............Chết.............. Tự hồi phục......... Nái hậu bị Tổng số..........Mắc bệnh..............Chết............. Tự hồi phục........... Nái mang thai: Tổng số..........Mắc bệnh...........Chết............ Tự hồi phục.......... Nái nuôi con: Tổng số...........Mắc bệnh..............Chết.......... Tự hồi phục......... Đực giống Tổng số...........Mắc bệnh.............Chết............ Tự hồi phục............ Khác (ghi rõ): Tổng số..........Mắc bệnh...............Chết............ Tự hồi phục........ Tổng số..........Mắc bệnh................Chết........... Tự hồi phục........... Tổng cộng:.......................Mắc bệnh...............Chết.............. Tự hồi phục........... Các biện pháp xử lý đối với lợn mắc bệnh này? Giết huỷ tại…………Số lượng:……………Ngày………..……................ Bán tại…………….. Số lượng:…………………Ngày………….…..…… Chôn/đốt huỷ tại……… Số lượng:…………..…Ngày………..………….. Điều trị bằng……………………….………Số ngày điều trị……...…..…. Khác (ghi rõ) …………………………………………………….………….. B. đẶC ĐIỂM CỦA Ổ DỊCH Dấu hiệu lâm sàng của lợn mắc bệnh (đánh dấu x vào ô phù hợp) Sốt trên 40 độ Biếng/bỏ ăn Tiêu chảy Viêm khớp Ho Da có mảng đỏ hoặc tím Tai màu đỏ hoặc tím xanh Da có điểm, đốm xuất huyết Uể oải, chậm chạp Sảy thai Lợn con chết yểu sau khi sinh Thai chết lưu hoặc biến dạng Chết đột ngột Khác (ghi rõ) Nếu mổ khám, hãy mô tả bệnh tích quan sát được C. TIÊM PHÒNG VẮC XIN VÀ LẤY MẪU BỆNH PHẨM Đàn lợn có được tiêm phòng vắc xin PRRS không? Không Có Nếu có, số lượng tiêm phòng cụ thể: Tổng đàn lợn....., số được tiêm phòng...... Nếu có, là nhân viên thú y tiêm? Không phải nhân viên thú y tiêm? Tên vắc xin ……….….. Ngày tiêm vắc xin PRRS gần đây nhất………… Đàn lợn có được tiêm các loại vắc xin phòng bệnh khác không? Không Có Nếu có, là nhân viên thú y tiêm? Không phải nhân viên thú y tiêm? Loại vắc xin Ngày tiêm phòng Tổng đàn gia súc Số lượng được tiêm phòng Lấy mẫu bệnh phẩm Không lấy, lý do (chuyển xuống câu 18) Có, trả lời tiếp các câu hỏi từ số 15 - 17) Loại mẫu bệnh phẩm đã lấy để gửi đến phòng thí nghiệm? Nguyên con Phổi Hạch Amidan, hạch khác Lách Thận Máu Thai chết lưu Dịch nhau thai Khác (ghi rõ)..................................... Mẫu được gửi tới (tên và địa chỉ của phòng xét nghiệm) D. CÁC YẾU TỐ RỦI RO CÓ THỂ GÂY RA Ổ DỊCH Lịch sử ổ dịch (trước đây đã có ổ dịch như thế này chưa?) Chưa có Có rồi Ngày phát dịch Ngày hết dịch Có kết quả xét nghiệm của phòng thí nghiệm không? Không Có Nếu có, dương tính với bệnh …………………………………………………. Các biện pháp xử lý (mô tả chi tiết) Nguồn thức ăn, nước uống Cám (thức ăn tận dụng thu gom từ nhiều nơi) do gia đình nấu Cám (thức ăn tận dụng thu gom từ nhiều nơi) gia đình không nấu Cám công nghiệp Khác (ghi rõ)…………………………………………………….......……….. Nước uống Qua xử lý KHÔNG qua xử lý Nếu gia đình sử dụng thức ăn tận dụng cho lợn, hãy mô tả quá trình chuẩn bị cám……………………………………….…………..…………………… ……………………………………………………..……………………..………………………………………………………………………………………. Thời tiết trong khu vực 2 tuần trước khi xảy ra ổ dịch Nóng Lạnh Ẩm Gió mạnh Mưa Lụt lội Khác (ghi rõ) Trong vòng 2 tuần trước khi xảy ra ổ dịch, có sự việc vận chuyển lợn trong khu vực ổ dịch không? Không (chuyển xuống câu hỏi số 25) Có, ghi rõ ngày vận chuyển Ngày………….tháng………..năm………….. Vận chuyển vào khu vực ổ dịch, từ …………………………………. Ra khỏi khu vực ổ dịch, tới ………………………………………………. Vận chuyển qua khu vực ổ dịch Sự kiện vận chuyển trên là hợp pháp? Không Có Trong vòng 2 tuần trước khi xảy ra ổ dịch, có người nào đến thăm chuồng lợn, hỏi mua lợn không? Không Có: Thương lái (Ghi rõ tên, địa chỉ) …………………………..... Thú y (Ghi rõ tên, địa chỉ) …………………......................... Người khác: (Ghi rõ tên, địa chỉ) ………………….............. Trong vòng 2 tuần trước khi xảy ra ổ dịch, gia chủ có cho lợn phối giống? Không Có (Ghi rõ tên, địa chỉ) ………………………………………………..... Trong vòng bán kính 1 km, có chợ buôn bán hoặc điểm trung chuyển lợn không? Không Có (Ghi rõ tên, địa chỉ và khoảng cách đối với ổ dịch) Tên chợ Địa chỉ Khoảng cách đối với ổ dịch (Km) Trong vòng bán kính 1 km, có lò/cơ sở giết mổ động vật? Không Có (Ghi rõ tên, địa chỉ và khoảng cách đối với ổ dịch) Tên lò mổ/chủ lò mổ Địa chỉ Khoảng cách đối với ổ dịch (Km) Trong vòng bán kính 1 km, đã từng có ổ dịch tai xanh nào chưa? Chưa Có (ghi rõ địa chỉ, toạ độ) Địa chỉ Thôn/làng Xã/phường Huyện/quận Tỉnh/thành phố Toạ độ (nếu có GPS) Vĩ độ Kinh độ Ngày phát dịch Ngày hết dịch Có kết quả xét nghiệm dương tính của phòng thí nghiệm không? Không Có E. QUẢN LÝ Ổ DỊCH Ổ dịch được quản lý như thế nào? Nuôi giữ lợn trong chuồng để chăm sóc, theo dõi Tiêu huỷ số lợn còn lại Giết mổ lợn trong ổ dịch Bán chạy hoặc biếu tặng lợn/sản phẩm lợn trong ổ dịch (ghi rõ vào phần dưới) Tiêu độc khử trùng khu vực ổ dịch Tiêm phòng vắc xin cho lợn còn lại Các vấn đề liên quan đến cộng đồng (VD: giáo dục và tuyên truyền) Khác (ghi rõ) Mô tả chi tiết thêm các biện pháp đã áp dụng mà anh/chị lựa chọn nêu trên G. THÔNG TIN VỀ CÁN BỘ ĐIỀU TRA Họ và tên Vị trí công tác Địa chỉ cơ quan Ngày điều tra Ngày………….Tháng ………..Năm…………………. Bé gi¸o dôc vµ ®µo t¹o Tr­êng ®¹i häc n«ng nghiÖp hµ néi -------------- Lª v¨n th¾ng T×nh h×nh héi chøng rèi lo¹n h« hÊp vµ sinh s¶n ë lîn trªn ®Þa bµn tØnh b¾c giang vµ mét sè chØ tiªu n¨ng suÊt sinh s¶n cña ®µn lîn n¸i sau dÞch LuËn v¨n th¹c sÜ n«ng nghiÖp Chuyªn ngµnh : Thó y M· sè: 60.62.50 Ng­êi h­íng dÉn khoa häc: PGS.TS. Tr­¬ng Quang Hµ néi - 2009 LỜI CAM ĐOAN - T«i xin cam ®oan r»ng, sè liÖu vµ kÕt qu¶ nghiªn cøu trong luËn v¨n lµ trung thùc vµ ch­a tõng ®­îc sö dông ®Ó b¶o vÖ mét häc vÞ nµo. - T«i xin cam ®oan r»ng c¸c th«ng tin trÝch dÉn trong luËn v¨n nµy ®· ®­îc chØ râ nguån gèc. Hµ Néi, ngµy 15 th¸ng 09 n¨m 2009 T¸c gi¶ Lª V¨n Th¾ng LỜI CẢM ƠN T«i xin ch©n thµnh c¶m ¬n ViÖn §µo t¹o Sau ®¹i häc, Khoa Thó y tr­êng §¹i häc N«ng nghiÖp Hµ Néi cïng c¸c thÇy c« gi¸o ®· t¹o ®iÒu kiÖn gióp ®ì t«i ®­îc tiÕp cËn víi nh÷ng kiÕn thøc trong thêi gian häc tËp ë tr­êng. Trong suèt qu¸ tr×nh häc tËp, ngoµi sù nç lùc cña b¶n th©n t«i cßn nhËn ®­îc rÊt nhiÒu sù gióp ®ì cña c¸c tËp thÓ, c¸ nh©n trong vµ ngoµi nhµ tr­êng. §Ó hoµn thµnh luËn v¨n nµy, t«i ®· nh©n ®­îc sù gióp ®ì nhiÖt t×nh cña c¸c thÇy c« trong bé m«n Vi sinh vËt - TruyÒn nhiÔm, khoa Thó y, tr­êng §¹i häc N«ng nghiÖp Hµ Néi mµ trùc tiÕp lµ thÇy gi¸o, PGS.TS. Tr­¬ng Quang. Bªn c¹nh ®ã, t«i còng nhËn ®­îc sù gióp ®ì, ®éng viªn vµ t¹o ®iÒu kiÖn cña l·nh ®¹o Chi côc Thó y B¾c Giang, Trung t©m ChÈn ®o¸n Thó y TW, C¬ quan Thó y vïng II cïng toµn thÓ b¹n bÌ, ®ång nghiÖp trong chuyªn ngµnh thó y B¾c Giang. Nh©n dÞp hoµn thµnh luËn v¨n, t«i xin bµy tá lßng biÕt ¬n ch©n thµnh tíi nhµ tr­êng, c¸c thÇy c« gi¸o, c¸c c¬ quan, b¹n bÌ ®ång nghiÖp cïng ng­êi th©n ®· ®éng viªn vµ t¹o ®iÒu kiÖn gióp ®ì t«i trong thêi gian häc tËp vµ nghiªn cøu thùc hiÖn ®Ò tµi. Hµ Néi, ngµy 15 th¸ng 9 n¨m 2009 T¸c gi¶ Lª V¨n Th¾ng MỤC LỤC Lời cam đoan lxxii Lời cảm ơn lxxii Mục lục lxxii Danh mục những chữ viết tắt lxxii Danh mục bảng lxxii DANH MỤC NHỮNG CHỮ VIẾT TẮT HCRLHH và SS: Hội chứng rối loạn hô hấp và sinh sản PRRS : Porcine Reproductive and Respiratory Syndrome PRRSV : Porcine Reproductive and Respiratory Syndrome virus TCID50 : 50% Tissue Culture Infectius Dose ELISA : Enzym Linked Immuno Sorbent Assay PCR : Polymerase Chain Reaction RT-PCR : Realtime Polymerase Chain Reaction OIE : Office International des Epizooties FAO : Food and Agriculture Organization of the United Nations CT : Cycle of Threshold DANH MỤC BẢNG STT Tên bảng Trang 4.1. Tổng hợp chung tình hình HCRLHH và SS ở lợn trên địa bàn tỉnh Bắc Giang 34 4.2. Tình hình HCRLHH và SS ở đàn lợn nái trên địa bàn tỉnh Bắc Giang 38 4.3. Tình hình HCRLHH và SS ở đàn lợn thịt trên địa bàn tỉnh Bắc Giang 40 4.4. Tình hình HCRLHH và SS ở đàn lợn con theo mẹ trên địa bàn tỉnh Bắc Giang 42 4.5. Kết quả xét nghiệm mẫu bệnh phẩm xác định PRRSV 43 4.6. Kết quả điều tra về số lần phối giống của nái hậu bị trong đàn nái xảy ra HCRLHH và SS được giữ lại sản xuất con giống 46 4.7. Kết quả điều tra về thời gian động dục lại và số lần phối giống của nái cai sữa trong đàn nái xảy ra HCRLHH và SS được giữ lại để sản xuất con giống 48 4.8. Kết quả điều tra về thời gian động dục lại và số lần phối giống của lợn nái đẻ non, sảy thai, thai chết lưu …. trong đàn nái xảy ra HCRLHH và SS được giữ lại để sản xuất con giống 51 4.9. Kết quả điều tra về thời gian động dục lại và tỷ lệ đẻ ở các lứa đẻ sau dịch của những nái hậu bị trong đàn nái xảy ra HCRLHH và SS được giữ lại sản xuất con giống 54 4.10. Kết quả điều tra về thời gian động dục lại và tỷ lệ đẻ ở các lứa đẻ sau dịch của những lợn nái cai sữa trong đàn nái xảy ra HCCRLHH và SS được giữ lại sản xuất con giống 56 4.11. Kết quả điều tra về thời gian động dục lại và tỷ lệ đẻ ở các lứa đẻ sau dịch của những nái bị bệnh (sảy thai, đẻ non, thai chết lưu…) trong đàn nái xảy ra HCRLHH và SS được giữ lại để sản xuất con giống 58 4.12. Một số chỉ tiêu về khả năng sinh sản và chất lượng đàn con của những nái hậu bị trong đàn lợn nái xảy ra HCRLHH và SS được giữ lại để sản xuất con giống 61 4.13. Một số chỉ tiêu về khả năng sinh sản và chất lượng đàn con của những nái cai sữa chờ phối trong đàn lợn nái xảy ra HCRLHH và SS được giữ lại để sản xuất con giống 63 4.14. Một số chỉ tiêu về khả năng sinh sản và chất lượng đàn con của những nái bị bệnh trong đàn lợn nái xảy ra HCRLHH và SS được giữ lại đẻ sản xuất con giống 65 4.15. So sánh khả năng tăng trọng của lợn cai sữa trước và sau HCRLHH và SS 67 ._.

Các file đính kèm theo tài liệu này:

  • docLuận văn up.doc
Tài liệu liên quan