Xác định thành phần cho Begomovirus hại cà chua tại Hải Phòng và phụ cận vụ xuân hè 2009, thử nghiệm biện pháp phòng trừ môi giới truyền

BỘ GIÁO DỤC VÀ ðÀO TẠO TRƯỜNG ðẠI HỌC NƠNG NGHIỆP HÀ NỘI -------------------- NGƠ THỊ MẪU ðƠN XÁC ðỊNH THÀNH PHẦN CHI BEGOMOVIRUS HẠI CÀ CHUA TẠI HẢI PHỊNG VÀ PHỤ CẬN VỤ XUÂN HÈ 2009, THỬ NGHIỆM BIỆN PHÁP PHỊNG TRỪ MƠI GIỚI TRUYỀN BỆNH LUẬN VĂN THẠC SĨ NƠNG NGHIỆP Chuyên ngành: BẢO VỆ THỰC VẬT Mã số: 60.62.10 Người hướng dẫn khoa học: PGS.TS. NGƠ BÍCH HẢO HÀ NỘI - 2009 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………i LỜI CAM ðOAN

pdf85 trang | Chia sẻ: huyen82 | Lượt xem: 1417 | Lượt tải: 0download
Tóm tắt tài liệu Xác định thành phần cho Begomovirus hại cà chua tại Hải Phòng và phụ cận vụ xuân hè 2009, thử nghiệm biện pháp phòng trừ môi giới truyền, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
Tơi xin cam đoan số liệu và kết quả nghiên cứu trong luận văn này là hồn tồn trung thực và chưa từng được sử dụng hoặc cơng bố trong bất kỳ cơng trình nào khác. Tơi xin cam đoan rằng mọi sự giúp đỡ cho việc thực hiện luận văn này đã được cám ơn và các thơng tin trích dẫn trong luận văn đều được ghi rõ nguồn gốc. Tác giả luận văn Ngơ Thị Mẫu ðơn Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………ii LỜI CẢM ƠN Cĩ được kết quả nghiên cứu này, tơi xin được bày tỏ lịng biết ơn sâu sắc đến: PGS.TS. Ngơ Bích Hảo – Trưởng bộ mơn Bệnh cây – Nơng dược, Khoa Nơng học, Trường ðại học Nơng nghiệp Hà Nội đã hướng dẫn, giúp đỡ tơi rất nhiệt tình và chu đáo. Cơ đã truyền cho tơi những kiến thức và kinh nghiệm quý báu để tơi hồn thành luận văn nghiên cứu khoa học này. TS. Hà Viết Cường – Giám đốc Trung tâm Bệnh cây nhiệt đới; Giảng viên Bộ mơn Bệnh cây – Nơng dược, Khoa Nơng học, Trường ðại học Nơng nghiệp Hà Nội đã quan tâm chỉ bảo, cĩ những gĩp ý sâu sắc và quý báu cho đề tài của tơi. Tập thể các thầy cơ giáo Bộ mơn Bệnh cây – Nơng dược, Khoa Nơng học, Viện ðào tạo Sau đại học, Trường ðại học Nơng nghiệp Hà Nội; tồn thể cán bộ của Trung tâm Bệnh cây nhiệt đới đã giúp đỡ, tạo điều kiện cho tơi trong thời gian học tập và thực hiện đề tài. Các đồng chí lãnh đạo xã Tú Sơn – Kiến Thụy; xã Hồng Phong – An Dương – Hải Phịng đã tạo điều kiện và giúp đỡ tơi trong quá trình thực hiện đề tài ở địa phương. Tơi xin chân thành cảm ơn gia đình, bạn bè đã động viên, tạo mọi điều kiện thuận lợi cho tơi trong quá trình học tập và thực hiện đề tài. Tác giả luận văn Ngơ Thị Mẫu ðơn Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………iii MỤC LỤC Lời cam đoan i Lời cảm ơn ii Mục lục iii Danh mục các chữ viết tắt vi Danh mục bảng vii Danh mục hình ix 1. MỞ ðẦU 1 1.1 ðặt vấn đề 1 1.2 Mục đích và yêu cầu 3 2. TỔNG QUAN TÀI LIỆU 4 2.1 Tình hình nghiên cứu trên thế giới 4 2.2 Tình hình nghiên cứu trong nước 14 3. ðỐI TƯỢNG, ðỊA ðIỂM, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 19 3.1 ðối tượng, vật liệu, địa điểm nghiên cứu 19 3.2 Nội dung nghiên cứu 20 3.3 Phương pháp nghiên cứu 21 4. KẾT QUẢ VÀ THẢO LUẬN 29 4.1 Mơ tả triệu chứng bệnh do virus gây ra trên cà chua vụ xuân hè 2009 tại Hải Phịng và vùng phụ cận 29 4.2 Các loại hình triệu chứng bệnh do virus gây hại cà chua vụ xuân hè 2009 tại Hải Phịng và vùng phụ cận 33 4.3 Tình hình bệnh xoăn vàng ngọn cà chua vụ xuân hè 2009 và khảo sát mật độ cỏ dại trên đồng ruộng tại Hải Phịng và vùng phụ cận 35 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………iv 4.3.1 Tình hình bệnh xoăn vàng ngọn cà chua vụ xuân hè 2009 tại Hải Phịng và vùng phụ cận 35 4.3.2 Kết quả khảo sát mật độ cỏ dại trên đồng ruộng cà chua tại Hải Phịng và vùng phụ cận 36 4.4 Mối quan hệ bọ phấn (Bemisia tabaci) và bệnh xoăn vàng ngọn cà chua vụ xuân hè 2009 tại Hải Phịng và vùng phụ cận 38 4.4.1 Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên cà chua vụ xuân hè 2009 tại xã Tú Sơn – Kiến Thụy – Hải Phịng 38 4.4.2 Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên cà chua vụ xuân hè 2009 tại xã Hồng Phong – An Dương – Hải Phịng 40 4.4.3 So sánh tỷ lệ bệnh xoăn ngọn và mật độ bọ phấn trên giống cà chua Mec 89 vụ xuân hè 2009 tại xã Tú Sơn – Kiến Thụy và xã Hồng Phong – An Dương – Hải Phịng 42 4.4.4 ðiều tra diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên cà chua vụ xuân hè 2009 tại Phúc Thành – Kim Thành – Hải Dương 44 4.5 Kết quả phịng trừ bệnh xoăn vàng ngọn bằng bẫy dính màu vàng 45 4.5.1 Thử nghiệm đặt bẫy dính màu vàng trên một đơn vị diện tích ruộng trồng cà chua vụ xuân hè 2009 tại Hải Phịng 46 4.5.2 ðộng thái bọ phấn vào bẫy dính màu vàng tại các cơng thức thay bẫy khác nhau 49 4.6 ðiều tra mật độ bọ phấn và tỷ lệ bệnh giữa treo bẫy và phun thuốc trừ bọ phấn trên cà chua tại xã Hồng Phong-An Dương - Hải Phịng 53 4.6.1 Diễn biến mật độ bọ phấn và tỷ lệ bệnh giữa treo bẫy và phun thuốc trừ bọ phấn trên cà chua tại xã Hồng Phong – An Dương – Hải Phịng 53 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………v 4.6.2 So sánh hiệu quả kinh tế giữa phịng trừ bệnh xoăn vàng ngọn cà chua bằng bẫy dính màu vàng và phun thuốc hĩa học phịng trừ bọ phấn 55 4.7 Kết quả giám định virus bằng PCR 57 4.7.1 Kết quả kiểm tra PCR begomovirus mẫu cà chua bằng cặp mồi chung begoAFor1/begoAReV1 57 4.7.2 Kết quả giám định virus gây bệnh xoăn vàng ngọn cà chua sử dụng hai cặp mồi đặc hiệu TYLCVNV và ToLCVV 58 4.7.3 Kết quả kiểm tra PCR sự cĩ mặt của phân tử DNA-β 61 4.8 Kết quả lây nhiễm bệnh nhân tạo bệnh xoăn vàng ngọn cà chua bằng hai phương pháp: Agroinoculation và truyền qua bọ phấn 62 5. KẾT LUẬN VÀ ðỀ NGHỊ 64 5.1 Kết luận 64 5.2 ðề nghị 65 TÀI LIỆU THAM KHẢO 66 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………vi DANH MỤC CÁC CHỮ VIẾT TẮT CTAB DNA MðBP TLB PCR ToLCVV TYLCVNV : Cetryl Ammonium Bromide : Deoxyribonucleic Acid : Mật độ bọ phấn : Tỉ lệ bệnh : Polymerase Chain Reaction : Tomato leaf curl Vietnam virus : Tomato yellow leaf curl Vietnam virus Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………vii DANH MỤC BẢNG STT Tên bảng Trang 4.1. Các loại hình triệu chứng bệnh virus gây hại cà chua vụ xuân hè 2009 tại Hải Phịng và vùng phụ cận 33 4.2. Tỷ lệ bệnh xoăn vàng ngọn cà chua vụ xuân hè 2009 tại Hải Phịng và vùng phụ cận 36 4.3. Mật độ một số cây cỏ dại chủ yếu trên ruộng cà chua tại Hải Phịng và vùng phụ cận 37 4.4. Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên giống cà chua P 375 và Mec 89 vụ xuân hè 2009 tại xã Tú Sơn – Kiến Thụy – Hải Phịng 39 4.5. Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên giống cà chua VL-2000 và Mec 89 vụ xuân hè 2009 tại xã Hồng Phong - An Dương – Hải Phịng 41 4.6. Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên giống cà chua Magic và Savior vụ xuân hè 2009 tại xã Phúc Thành – Kim Thành – Hải Dương 44 4.7. Kết quả thử nghiệm các cơng thức đặt bẫy dính màu vàng trên một đơn vị diện tích ruộng trồng cà chua vụ xuân hè 2009 tại Hải Phịng 47 4.8. Diễn biến mật độ bọ phấn và tỷ lệ bệnh xoăn vàng ngọn giữa các cơng thức thay bẫy 48 4.9. ðộng thái bọ phấn vào bẫy vàng tại các cơng thức thay bẫy khác nhau trên giống cà chua 50 4.10. Diễn biến mật độ bọ phấn và tỷ lệ bệnh xoăn vàng ngọn giữa các cơng thức thay bẫy 52 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………viii 4.11. Diễn biến mật độ bọ phấn và tỷ lệ bệnh giữa treo bẫy và phun thuốc trừ bọ phấn trên giống cà chua VL-2000 tại xã Hồng Phong – An Dương – Hải Phịng 54 4.12. So sánh hiệu quả kinh tế giữa phịng trừ bọ phấn bằng bẫy dính màu vàng và phun thuốc hĩa học 56 4.13. Kết quả kiểm tra PCR begomovirus bằng cặp mồi chung begoAFor1/begoAReV1 58 4.14. Kết quả giám định PCR kiểm tra sự cĩ mặt của ToLCVV trên các mẫu 60 4.15. Kết quả giám định mẫu bằng phương pháp PCR với cặp mồi đặc hiệu DNA-β 61 4.16. Kết quả lây nhiễm bệnh nhân tạo bệnh xoăn vàng ngọn cà chua bằng hai phương pháp: Agroinoculation và truyền qua bọ phấn 62 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………ix DANH MỤC HÌNH STT Tên hình Trang 4.1. Triệu chứng khảm vàng lá cà chua 30 4.2. Triệu chứng xoăn vàng ngọn cà chua 31 4.3. Triệu chứng khảm lá dương xỉ 32 4.4. Triệu chứng khảm lồi lõm 32 4.5. Tỷ lệ các loại hình triệu chứng bệnh virus gây hại cà chua vụ xuân hè 2009 tại Hải Phịng và vùng phụ cận 33 4.6. Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên giống cà chua P 375 và Mec 89 vụ xuân hè 2009 tại xã Tú Sơn – Kiến Thụy – Hải Phịng 39 4.7. Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên giống cà chua VL-2000 và Mec 89 vụ xuân hè 2009 tại xã Hồng Phong – An Dương – Hải Phịng 41 4.8. So sánh tỷ lệ bệnh xoăn ngọn và mật độ bọ phấn trên giống cà chua Mec 89 vụ xuân hè 2009 tại xã Tú Sơn – Kiến Thụy và xã Hồng Phong – An Dương – Hải Phịng 43 4.9. Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên giống cà chua Magic và Savior vụ xuân hè 2009 tại xã Phúc Thành – Kim Thành – Hải Dương 45 4.10. Thí nghiệm bẫy dính màu vàng tại Hải Phịng 46 4.11. Diễn biến mật độ bọ phấn và tỷ lệ bệnh xoăn vàng ngọn giữa các cơng thức thay bẫy 49 4.12. Diễn biến mật độ bọ phấn và tỷ lệ bệnh xoăn vàng ngọn giữa các cơng thức thay bẫy 52 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………x 4.13. Diễn biến mật độ bọ phấn và tỷ lệ bệnh giữa treo bẫy và phun thuốc trừ bọ phấn trên giống cà chua VL-2000 tại xã Hồng Phong – An Dương – Hải Phịng 54 4.13 Kết quả chạy PCR begomovirus mẫu cà chua bằng cặp mồi chung BegoAFor1/BegoAReV1 (M là thang DNA; giếng số 1 đến số 10 tương ứng với các mẫu từ mẫu số 1 đến mẫu số 10) 57 4.14. Kết quả chạy PCR kiểm tra sự cĩ mặt của ToLCVV trên các mẫu 59 4.15. Kết quả chạy PCR kiểm tra sự cĩ mặt của TYLCVNV trên các mẫu 59 4.16. Kết quả chạy PCR sử dụng cặp mồi đặc hiệu DNA-β 61 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………1 1. MỞ ðẦU 1.1 ðặt vấn đề Một trong những họ virus thực vật lớn nhất là Geminiviridae. Begomovirus là một trong bốn chi của họ Geminiviridae. Begomovirus là chi quan trọng nhất cả về số lượng lồi (185 lồi năm 2005 (Fauques & Stanley, 2005) và 266 lồi năm 2008 (Fauques et al., 2008)) cũng như các bệnh do chúng gây ra đối với cây trồng. Begomovirus (được đặt tên từ Bean golden mosaic virus) là các virus cĩ bộ gen DNA sợi vịng đơn, kích thước khoảng 2,7 kb, lan truyền tự nhiên trên đồng ruộng bằng bọ phấn (Bemisia tabaci) theo kiểu bền vững tuần hồn. Nhiều bệnh nghiêm trọng trên cây trồng đã được xác định là do begomovirus gây ra như bệnh xoăn vàng lá cà chua – một bệnh được xem là nguy hiểm nhất trên cà chua khắp thế giới (Motiones & Navas-Castillo, 2000). Theo nghiên cứu tình hình bệnh hại cà chua trong nhà lưới và ngồi đồng ruộng năm 2003 – 2005 tại Hà Nội đã tìm ra được 19 lồi gây hại, trong đĩ cĩ 2 bệnh do virus, 3 bệnh do vi khuẩn, 11 bệnh nấm, 2 bệnh sinh lý và tuyến trùng. Theo thống kê của nghiên cứu trên: bệnh hại do virus chiếm số lượng nhỏ nhất nhưng tỷ lệ lại lên tới 29,38% đối với bệnh xoăn vàng ngọn cà chua (Tomato yellow leaf curl virus). Bệnh xoăn vàng ngọn cà chua là một trong các bệnh hại chính trên cây cà chua, gây tổn thất lớn về năng suất và phẩm chất cà chua. Bệnh làm cho lá cà chua xoăn nhỏ lại, cây gần như khơng cĩ quả. Thiệt hại 60-70% năng suất, thâm chí thất thu hồn tồn. Bệnh xoăn vàng ngọn cà chua thường phát sinh và gây hại nặng vào mùa khơ, một số vùng như Hà Nội, Hưng Yên, Hải Phịng..., đơi khi vẫn thấy bệnh xuất hiện trong mùa mưa nhưng khơng đại trà như mùa khơ. Chỉ riêng tại huyện ðơn Dương (Lâm ðồng) tháng 2 năm 2007 đã cĩ trên 70 ha bị bệnh trong đĩ cĩ hơn 30 ha bị thiệt hại nặng phải phá bỏ để trồng cây khác. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………2 Cĩ hàng chục lồi begomovirus gây bệnh xoăn vàng lá trên cà chua khắp thế giới. Tại Việt Nam, bệnh xoăn vàng lá cà chua đã được quan sát thấy từ những năm 70. Gần đây, dựa vào các nghiên cứu phân tử, ít nhất 3 lồi begomovirus đã được xác định trên cà chua tại miền Bắc Việt Nam là Tomato leaf curl Vietnam virus (ToLCVV), Tomato yellow leaf curl Vietnam virus (TYLCVNV) và Papaya leaf curl China virus (PaLCCNV). Các nghiên cứu phân tử cũng cho thấy dường như khu vực ðơng Nam Á là một trong những trung tâm đa dạng của chi Begomovirus. ðiều này gợi ý rằng sẽ cịn nhiều lồi begomovirus đang chờ được khám phá trên cà chua và nhiều lồi cây khác ở Việt Nam. Một trong những đặc điểm gây bệnh của begomovirus là các bệnh trên một lồi cây trồng thường do nhiều lồi begomovirus gây ra với triệu chứng khơng thể phân biệt được. Trên cà chua hiện nay cĩ khoảng 40 lồi begomovirus gây bệnh xoăn vàng lá với triệu chứng điển hình là lá bị biến vàng nhỏ hẹp, cuốn cong lại thành hình thìa, cây lùn, cịi cọc. Danh tính của virus gây bệnh chỉ được xác định dựa trên phân tích phân tử. Gần đây, một loại phân tử DNA vịng đơn nữa, cĩ kích thước khoảng 1 nửa bộ gen begomovirus thường được phát hiện thấy cĩ liên quan với nhiều bệnh do begomovirus gây ra và được gọi là các DNA - β. Các phân tử DNA-β này phụ thuộc vào begomovirus để nhân lên và do đĩ được xem là các phân tử vệ tinh của begomovirus. Vai trị của phân tử DNA-β trong hình thành triệu chứng bệnh khơng thống nhất, một số lồi begomovirus chỉ cĩ thể tạo ra triệu chứng cùng với sự cĩ mặt của phân tử DNA-β trong khi các lồi khác lại khơng cần. Việc phịng trừ bệnh xoăn vàng lá cà chua (và các bệnh do begomovirus khác) nhìn chung là khĩ vì virus cĩ tốc độ đột biến và tái tổ hợp rất cao. Một trong các chiến lược phịng trừ bệnh là phịng trừ vector bọ phấn. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………3 Mặc dù bọ phấn rất khĩ phịng trừ triệt để vì là lồi đa thực nhưng nhiều cơng bố cho thấy cĩ thể hạn chế được bệnh nếu duy trì cây sạch bọ phấn trong thời gian sinh trưởng ban đầu. Xuất phát từ những vấn đề trên, được sự phân cơng của Bộ mơn Bệnh cây – Nơng dược, Khoa Nơng học, trường ðại học Nơng nghiệp Hà Nội, dưới sự hướng dẫn của PGS.TS. Ngơ Bích Hảo và TS. Hà Viết Cường, chúng tơi tiến hành thực hiện đề tài: “Xác định thành phần chi Begomovirus hại cà chua tại Hải Phịng và phụ cận vụ xuân hè 2009, thử nghiệm biện pháp phịng trừ mơi giới truyền bệnh”. 1.2 Mục đích và yêu cầu 1.2.1 Mục đích - Xác định thành phần chi Begomovirus hại cà chua và một số kí chủ khác tại Hải Phịng và phụ cận fvụ xuân hè 2009, khảo sát một số biện pháp phịng trừ mơi giới. 1.2.2 Yêu cầu - ðiều tra tình hình bệnh xoăn vàng ngọn cà chua tại Hải Phịng và phụ cận vụ xuân hè 2009 - Xác định sự cĩ mặt của các begomovirus và DNA vệ tinh trên cà chua dùng mồi đặc hiệu chi Begomovirus và DNA-β - Xác định mức độ phổ biến của lồi ToLCVV và TYLCVNV bằng PCR với mồi đặc hiệu. - Xác định tính gây bệnh của TYLCVNV bằng lây nhiễm nhân tạo dùng vi khuẩn Agrobacterum tumerfaciens làm vectơ lây nhiễm (agroinoculation) trên cà chua. - Thử nghiệm biện pháp phịng trừ mơi giới truyền bệnh xoăn vàng ngọn cà chua bằng bẫy dính màu vàng. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………4 2. TỔNG QUAN TÀI LIỆU 2.1 Tình hình nghiên cứu trên thế giới Cây cà chua bị nhiều lồi dịch hại tấn cơng, theo số liệu thống kê của CABI, 2005, [24], hiện cĩ 499 lồi dịch hại gây hại trên cà chua, trong đĩ virus cĩ 41 lồi. Mặc dù chỉ chiếm một phần nhỏ trong tổng số tất cả các lồi dịch hại trên cà chua nhưng bệnh hại do virus gây thiệt hại rất lớn cho các vùng trồng cà chua trên thế giới. Chính vì vậy, bệnh virus hại cà chua đã và đang được rất nhiều nhà khoa học trên thế giới quan tâm, nghiên cứu về đặc điểm sinh học, sinh thái học cũng như phương thức lan truyền để đưa ra biện pháp phịng trừ hiệu quả nhất. 2.1.1 Những thiệt hại do Begomovirus gây ra Bệnh xoăn vàng ngọn cà chua do begomovirus gây hại được ghi nhận đầu tiên trên thế giới từ những năm 1939 – 1940 tại Isarel. Dịch bệnh đã xuất hiện rải rác vào những năm 60 và trở nên nghiêm trọng vào đầu những năm 70, tất cả những vùng cà chua ở Trung ðơng đều bị nhiễm bệnh. Bệnh đã được phát hiện ở ðơng Nam Á (tại Thái Lan và ðài Loan), châu Phi và châu Âu vào những năm 80 (Makkouk & Laterrot, 1983, [44]; Czosnek et al., 1990 [30]). Bệnh lần đầu tiên được cơng bố tại châu Mỹ vào năm 1998 (Nakhla et al., 1994)[48]. Gần đây, bệnh cịn lan truyền tới phía Tây ðịa Trung Hải (Ý), Nhật, Iran và các nước cộng hịa nằm trong khu vực châu Á thuộc Liên Xơ cũ như Azebaidan, Turmenistan, Uzebikistan. Ngày nay, nhờ sự trợ giúp của các nghành cơng nghê mới, số lượng begomovirus được xác định ngày càng nhiều khắp thế giới. Trên khắp các châu lục đều tìm thấy các lồi begomovirus khác nhau; ở châu Âu là các nước như Italia, Thổ Nhĩ Kỳ, Tây Ba Nha, Thụy Sĩ, …; ở châu Á như Trung Quốc, Ấn ðộ, Iran, Isarel, Pakistan, Philipin, Thái Lan, Malaysia, Indonesia, …; ở Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………5 châu Phi như Angiria, Libi, Nigeria, Sudan, Tunisia, Ai Cập, …; ở châu Mỹ như CuBa, Dominica, Jamaica, Hoa Kỳ, …; ở châu ðại Dương: Australia (Gafni, 2003)[36]. Số lượng begomovirus được xác định khơng ngừng tăng, năm 2005 là 185 lồi (Fauques & Stanley 2005)[33], năm 2008 là 266 lồi (Fauques et al., 2008)[34]. Nhiều bệnh nghiêm trọng trên cây trồng đã được xác định là do begomovirus gây ra như bệnh xoăn vàng cà chua – một trong những bệnh được xem là nguy hiểm nhất trên cà chua khắp thế giới (Moriones và Navas – Castillo, 2000); bệnh khảm lá sắn (Legg & Fauquet, 2004); bệnh cuốn lá bơng (Briddon, 2003). Bệnh xoăn vàng ngọn cà chua gây thiệt hại lớn về năng suất và chất lượng. ðây là bệnh virus quan trọng nhất gây hại trên cà chua khắp thế giới, đặc biệt là vùng nhiệt đới và vùng cận nhiệt đới (Pico et al., 1996)[49]. Ngồi cà chua, begomovirus gây bệnh xoăn vàng lá ngọn cịn gây giảm năng suất trên cây đậu (Phaseolus vulgaris) ở Isarel và ở phía bắc Tây Ba Nha (Brunt et al., 1996). 2.1.2 Phạm vi kí chủ của begomovirus Begomovirus cĩ phạm vi kí chủ khá phong phú gồm các loại cây trồng và cỏ dại. Trong đĩ, TYLCV là một trong những begomovirus cĩ phạm vi kí chủ rộng trên nhiều lồi thuộc 63 họ thực vật khác nhau. Năm 1991, Zakay cho biết lồi cà chua trồng L. esculentum là kí chủ chính của virus gây bệnh. Bên cạnh đĩ hầu hết các lồi cà chua dại như L. chinense, L. hirsutum, L. peruvianum, L. pimpinellifolium, ... cũng đều mang triệu chứng do virus TYLCV hại. Tác giả cịn nêu lên một số cây kí chủ thứ yếu khác như cây Lisianthus (Eustoma grandiflorum), cây dã yên thảo (Petunia hybrida), cây đậu cơ ve (Phaseolus vulgaris), cây thuốc lá (Nicotiana tabacum) và cây cà độc dược (Datura stramonium). Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………6 Theo nghiên cứu của Cohen và Nitzany (1996)[26], kí chủ của virus TYLCV gồm 15 lồi cây trồng thuộc 5 họ thực vật. Các tác giả Brunt và cộng sự (1996) cho biết cĩ từ 3 – 9 họ thực vật là kí chủ của bệnh. Hầu hết các cây họ cà đều là kí chủ của virus gây bệnh (Jones et al., 1991)[51]. 2.1.3 Triệu chứng bệnh Một trong những đặc điểm gây bệnh của begomovirus là các bệnh trên một lồi cây trồng thường do nhiều lồi begomovirus gây ra với triệu chứng khơng thể phân biệt được. Chẳng hạn, trên cà chua, hiện nay cĩ khoảng 40 lồi begomovirus gây bệnh xoăn vàng lá. Danh tính của chúng chỉ được xác định dựa trên phân tích phân tử. Tên của bệnh virus xoăn vàng ngọn cà chua xuất phát từ sự mơ tả triệu chứng bệnh. Bệnh xoăn vàng ngọn xuất hiện triệu chứng trong vịng 2 – 4 tuần sau khi nhiễm bệnh và phát triển đầy đủ triệu chứng trong vịng 2 tháng. Triệu chứng cĩ thể thay đổi theo điều kiện mơi trường, giai đoạn sinh trưởng và điều kiện sinh lý của cây tại thời điểm nhiễm bệnh (Pico et al., 1996)[49]. Triệu chứng sớm nhất là lá cong xuống dưới và phía trong. Về sau, lá khơng cĩ hình dạng, nhỏ hẹp, biến vàng từ mép và chĩt lá lan vào giữa gân lás, lá cuốn cong lên phía trên thành hình thìa lìa, lá non biến vàng nhỏ hẹp, giịn. Cuống lá cĩ thể vặn xoắn. Cây lùn cịi cọc, mọc nhiều cành nhánh nhỏ, đốt thân ngắn. Cây nhiễm sớm thường khơng ra quả do hoa bị rụng nhiều (Pico et al., 1996)[49]. Quan sát triệu chứng của bệnh virus xoăn vàng ngọn cĩ thể nhầm lẫn với một số tình trạng bệnh lý khác của cây cà chua, ví dụ như bệnh xoăn lá sinh lý; bệnh do thiếu phosphate, magie. Biểu hiện của bệnh nhiều trường hợp giống triệu chứng do virus ToMV (Cohen S., Nitzany FE, 1996)[36]. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………7 2.1.4 Nguyên nhân gây bệnh Năm 1960, lần đầu tiên bệnh xoăn vàng ngọn cà chua được mơ tả và định tên Tomato yellow leaf curl virus (TYLCV) tại Isarel (Cohen S. & Harpaz I., 1964). Sau đĩ nhiều năm người ta mới xác định chính xác được nguyên nhân gây bệnh. Năm 2000, Ủy ban phân loại virus quốc tế ICTV (International Committee on Taxonomy of Viruses) xác định virus TYLCV thuộc giống Begomovirus, họ Geminniviridae. Virus cĩ hình chày nhỏ, kích thước 20 x 30 nm. Sợi DNA của virus cĩ dạng sợi đơn gồm 2800 nucleotit chứa trong 6 gen; ở dạng sợi đơi gồm 2 phân tử DNA: DNA A và DNA B, mỗi phân tử cĩ khoảng 2600 nucleotit, sợi DNA A cơ bản như sợi đơn cịn sợi DNA B chỉ gồm 2 gen (Fancelli M. & Jose Djair Verdramin, 2002). Từ thể phân lập đầu tiên được cơng bố tại Isarel (1960), cùng với sự lan truyền của bệnh theo các vùng sinh thái khác nhau dựa trên cơ sở giám định sợi DNA về số lượng, trình tự sắp xếp, vị trí các nucleotit. Các chủng virus này ngày càng biến đổi phức tạp do sự tái tổ hợp giữa các lồi xảy ra thường xuyên trong họ Geminidae. 2.1.5 Vector truyền lan và sự lan truyền Begomovirus Begomovirus lan truyền ngồi tự nhiên nhờ bọ phấn Bemisia tabaci theo kiểu bền vững tuần hồn (Cohen & Harpaz, 1964). Năm 1996, Cohen và Antignus cho biết cĩ ít nhất 6 họ thực vật là kí chủ của bọ phấn. Bọ phấn trắng Bemisia tabaci thuộc họ rầy phấn (Aleyrodidae), bộ Homoptera. Khả năng truyền virus TYLCV đã được nhiều nghiên cứu khẳng định, do đĩ diễn biến của lồi cây này trên đồng ruộng cĩ ảnh hưởng lớn tới cây trồng, đặc biệt là cây cà chua. Trong một hội nghị khoa học ở Isarel năm 1939, bệnh xoăn vàng ngọn được truyền bởi bọ phấn Bemisia tabaci trên cà chua, thuốc lá lần đầu tiên tạo được sự chú ý của dư luận khi liên tiếp 3 năm liền gây thất thu lớn trên cà chua Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………8 từ 28 – 92% năng suất ở ðịa Trung Hải. Sau đĩ bệnh xoăn vàng ngọn cà chua cùng sự lan truyền của nĩ bởi bọ phấn lần lượt được cơng bố khắp nơi trên thế giới: Ấn ðộ năm 1984 (Vasude & Samjai, 1984), ở Mỹ thập kỷ 60 (Castas, 1969; Debrot et al., 1963), ở ðịa Trung Hải năm 1960 (Cohen et al., 1964, 1966), Xu ðăng năm 1965 (Yassin et al., 1965), Campuchia (Rowell et al., 1989), Indonesia (AVRDC, 1985), Nhật Bản thập kỷ 80 (Kobatake et al., 1981; Osaki et al., 1978, 1981), ðài Loan (AVRDC, 1987; Green et al., 1987); Philippin năm 1971 (Retuerma, 1971); Thái Lan thập kỷ 80 (Giatgang, 1980; Thongsit et al., 1986), . . . (dẫn theo Green S.K và Kallo G.). Cho đến nay, hơn 100 nước ở hầu hết các châu lục đã cơng bố về mối nguy hại do bọ phấn gây ra. Cà chua được trồng ở vùng sơng Mêkơng trong mùa khơ từ tháng 10 đến tháng 6 năm sau. Những điều kiện khí hậu thuận lợi trong thời gian này phù hợp cho sự phát triển của bọ phấn – vật trung gian truyền bệnh virus xoăn vàng ngọn cà chua. Theo Gerling và cộng sự (1996) bọ phấn trắng Bemisia tabaci hồn thành một vịng đời khoảng 20 – 30 ngày ở điều kiện thích hợp, trung bình cĩ khoảng 11 – 15 lứa/năm. Bọ phấn thích hợp và phát triển mạnh ở điều kiện khơ nĩng; mưa nhiều làm giảm mật độ bọ phấn. Bọ phấn khơng khỏe chỉ cĩ thể dịch chuyển những khoảng ngắn để tìm những bộ phận non của cây. Tuy nhiên, nếu điều kiện thời tiết thay đổi bất lợi chúng cĩ thể di chuyển hàng triệu con với khoảng cách dài hơn. Chúng thường chích hút và bay vào buổi sáng, buổi chiều mát. ðể tránh ánh sáng mặt trời, chúng núp vào mặt dưới của lá. ðiều này phù hợp với phân bố chủ yếu ở khí hậu nhiệt đới và cận nhiệt đới. Những nghiên cứu của Cohen và Nitzany (1966)[26], Mansour và Al- Musa (1982), Mehta và cộng sự (1994), Caciaghi và cộng sự (1995), Ghanim và cộng sự (2001) đều khẳng định bọ phấn truyền theo kiểu bền vững. ðể hút dịch cây từ mạch phloem, bọ phấn dùng vịi chọc vào mơ mạch dẫn. Virus Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………9 được hút qua vịi, tới diều, thấm qua màng ruột vào xoang cơ thể, tới tuyến nước bọt và cuối cùng vào ống nước bọt. Bọ phấn hút dịch cây trong khoảng 15 – 30 phút và tiềm ẩn trong cơ thể chúng từ 8 – 24 giờ (thời gian để virus nâng cao nồng độ trong cơ thể bọ phấn) là chúng cĩ khả năng truyền bệnh, khoảng thời gian để chúng truyền ngắn nhất là 15 phút (EPPO/CABI, 1996). Thời gian chích hút của bọ phấn dài hơn thời gian truyền dịch virus sang cây khỏe và thời gian tiềm ẩn là 21 giờ. Bọ phấn hút dịch cây ở giai đoạn sâu non và ngay sau khi hĩa trưởng thành chúng cĩ thể truyền nhiễm bệnh virus theo hệ thống và khơng truyền lại cho đời sau. Cĩ thể phát hiện thấy virus ở bất kỳ giai đoạn phát triển nào của bọ phấn trừ giai đoạn trứng (Ghanim et al., 1998). Thí nghiệm với TYLCV cũng cho thấy, số lượng virus được tích lũy đạt cực đại (khoảng 600 triệu phân tử virus) nếu để bọ phấn chích nạp trên cây bệnh 12 giờ. Thời gian này đối với TYLCV là 24 giờ (Czosnek et al., 2002)[29]. Sau thời gian chích nạp khoảng 1 – 2 ngày, virus cĩ thể duy trì trong cơ thể bọ phấn nhiều tuần: 3 tuần đối với TYLCSV hay cả đời như đối với TYLCV (Czosnek et al., 2002)[29]. Một cá thể bọ phấn cĩ thể truyền bệnh sau khi chích nạp 24 giờ mặc dù tỷ lệ truyền bệnh khơng cao; tỷ lệ truyền bệnh đạt 100% nếu sử dụng 5 – 15 bọ phấn. Bọ phấn cái truyền virus hiệu quả hơn bọ phấn đực và hiệu quả truyền tốt nhất sau khi bọ phấn trưởng thành ở 1 – 2 tuần tuổi và giảm dần theo thời gian sinh trưởng của bọ phấn. Hiệu quả truyền virus giảm theo tuổi thọ là do lượng virus được chích nạp giảm (Czosnek et al., 2002)[29]. Virus cĩ thể truyền qua giao phối từ bọ phấn đực sang bọ phấn cái và ngược lại. Virus TYLCV khơng truyền bằng cơ học, đây là tiêu chí quan trọng để phân biệt lồi virus này với lồi virus khác trong họ Genimidae. Cho đến nay, chưa cĩ một cơng trình nghiên cứu nào cơng bố về khả năng truyền Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………10 nhiễm bệnh xoăn vàng ngọn qua hạt giống. Những nghiên cứu trên cho thấy bọ phấn Bemisia tabaci là con đường duy nhất cĩ thể truyền lan virus TYLCV, phịng trừ bọ phấn cũng là phịng trừ bệnh xoăn vàng ngọn cà chua. Theo Coudiet và cộng sự (1985), trên thế giới cĩ tới 500 lồi cây là ký chủ của bọ phấn, trong đĩ ở Florida cĩ tới 50 lồi như khoai lang, dưa chuột, dưa thơm, dưa hấu, bí ngơ, cà tím, ớt, cà chua, xà lách, súp lơ xanh, . . . Bọ phấn thích sống ở trên cây trồng này hay cây trồng khác tùy theo vùng sinh thái. Ở Florida, bọ phấn thích sống trên khoai lang, dưa chuột, bí ngồi hơn là súp lơ xanh và cà rốt. Ở ðài Loan thì thứ tự đĩ là: cà tím, cà chua, khoai lang, dưa chuột, đậu xanh. Một số cây trồng khác và cỏ dại là ký chủ của bọ phấn Bemisia tabaci giúp bọ phấn sống sĩt khi trên đồng ruộng khơng cĩ những cây trồng là ký chủ chính tạo thành sự gối lứa trên đồng ruộng. 2.1.6 Biện pháp phịng trừ TYLCV cĩ phổ ký chủ rất rộng, phân bố rộng khắp trên thế giới nên việc phịng trừ là rất khĩ khăn. Nhiều nhà khoa học đã và đang nghiên cứu để tìm ra cách phịng trừ hiệu quả nhất. Những nghiên cứu trong nhiều năm qua đã khẳng định bọ phấn Bemisia tabaci là phương thức truyền lan duy nhất của virus TYLCV. Với những hiểu biết nhất định về lồi cơn trùng này cũng như cách thức lan truyền virus của chúng cĩ thể đưa ra các biện pháp phịng trừ bệnh xoăn vàng ngọn cà chua như: điều khiển mơi giới truyền bệnh thơng qua các lồi bắt mồi hay ký sinh, sử dụng hàng rào tự nhiên để cách li bọ phấn với nguồn bệnh và bọ phấn với cây trồng, chọn tạo giống cĩ đặc điểm khơng ưa thích đối với bọ phấn, loại bỏ chúng trước khi chúng kịp truyền virus. * Biện pháp cơ giới vật lý Việc phịng chống bệnh hại cà chua, hạn chế khả năng gây bệnh thơng qua biện pháp canh tác đã được nghiên cứu tại Ủy ban bảo vệ cây trồng Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………11 Fanham (Vương quốc Anh) thực hiện. Thí nghiệm được tiến hành trên nguyên lý trồng các loại cây trồng trong cùng một khu vực cùng với diện tích trồng cà chua (diện tích trồng cà chua khơng lớn hơn 5000 m2). Kết quả là cách này đã hạn chế được sự lây lan của virus do bọ phấn khơng tiếp xúc trực tiếp với cà chua (Hilje L., 2000). Viện nghiên cứu làm vườn Quivican (Cuba) đã nghiên cứu ảnh hưởng của các chế độ canh tác trong khi trồng cà chua: bĩn chất xử lý và phân hữu cơ, phịng trừ sinh học, cây làm rào chắn (cây ngơ), cơng thức bĩn 50% phân hữu cơ kết hợp với phân hĩa học. Kết quả cho thấy, ở hệ thống canh tác nơng sinh (Agroecological) số lượng bọ phấn giảm 8 lần và cây cĩ biểu hiện nhiễm bệnh và mức độ gây hại giảm một nửa so với áp dụng các biện pháp canh tác truyền thống (Cohen et al., 1966)[26]. Bọ phấn cĩ thể chuyển từ cây trồng, từ vùng khơng cĩ cây ký chủ trên đồng ruộng đến nơi cĩ cây ký chủ hoặc thơng qua cỏ dại. Dựa vào xu tính ánh sáng của bọ phấn Bemisia tabaci, Shuter D. và các cộng sự thuộc Trung tâm Nghiên cứu và Giáo dục vùng vịnh Pradenton bang Florida (Mỹ) đã tiến hành nghiên cứu các biện pháp che phủ đất bằng nilon cĩ màu sắc khác nhau để hạn chế mật độ bọ phấn trên cây cà chua. Kết quả cho thấy năng suất cà chua cao nhất ở cơng thức che phủ lynon vàng (62.3 tấn/ ha), sau đĩ là da cam (54.8 tấn/ ha), rồi đến mầu ánh bạc (52.7 tấn/ ha). Ở Ai Cập, các thí nghiệm đồng ruộng từ năm 1988 – 1990 cho thấy khi che phủ vườn ươm cà chua bằng vải muslin trắng để bảo vệ cây con khơng bị bọ phấn xâm nhập đã làm giảm sự truyền lan của bệnh xoăn vàng ngọn, vườn ươm được che phủ vải đã làm tăng năng suất từ 413 – 490% (M.F Haydar). Murugan (2001) quan sát trưởng thành bọ phấn trên bẫy dính màu vàng đặt trên những r._.uộng trồng các giống bơng khác nhau tại Ấn ðộ trong 17 tuần mùa đơng và 16 tuần mùa hè cho thấy bẫy dính màu vàng đã làm giảm mật độ bọ phấn trên ruộng trồng bơng. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………12 Biện pháp canh tác nhằm cách ly bọ phấn là phương pháp dễ thực hiện và cĩ chi phí đầu tư thấp. Cĩ thể luân canh cây cà chua với cây khơng ưa thích của bọ phấn như lúa nước, ngơ... . Ngồi ra cịn cĩ thể kết hợp biện pháp canh tác với nhổ bỏ cây cà chua bị bệnh nhằm hạn chế nguồn bệnh trên đồng ruộng. Năm 1982, Al – Musa cho biết nên tránh xen canh cà chua với những cây là ký chủ của bọ phấn như bí ngơ, dưa chuột... bởi vì chúng là nguồn thu hút bọ phấn đến ruộng cà chua. *Biện pháp giống chống chịu Những năm gần đây, cùng với tiến bộ của khoa học kỹ thuật, các nhà khoa học đã tạo ra những giống cà chua kháng bệnh xoăn vàng ngọn cà chua. Khả năng kháng bệnh của cây là chống chịu bọ phấn hoặc chống lại sự xâm nhiễm, tái tổ hợp của virus trong tế bào cây. Theo Nakhla và cộng sự (1998)[48], cơ sở khoa học của sử dụng giống cà chua chống chịu bọ phấn là sử dụng những giống cĩ nhiều túm lơng tơ ngăn cản bọ phấn chích hút dịch cây, những giống cĩ lơng tiết ra nhựa dính giống như bẫy dính hoặc cây trồng cĩ tuyến tiết dịch để xua đuổi bọ phấn. Trong các giống cà chua thì các giống cĩ nguồn gốc hoang dại như L. Hirsutum. L. Glabratum, L. Penellii cĩ những đặc điểm trên. Trung tâm nghiên cứu và phát triển rau châu Á (AVRDC) đã lai tạo ra những dịng cà chua cĩ tính kháng rất cao với bọ phấn Besmisia tabaci cũng như bệnh xoăn vàng ngọn cà chua như: LA 1777, LA 1418, LA 407, LA 716, LA 171418, PI 344818. Một số dịng cà chua đã được Fancelli M. (2003) đánh giá ảnh hưởng đến sự phát triển của bọ phấn Bemisia tabaci trong điều kiện nhà lưới tại Agricola. Kết quả là: dịng LA 1548 cĩ tính kháng làm giảm sự sống sĩt của sâu non và làm tăng thời gian phát dục của bọ phấn; các dịng LA 1739, PI 134417 làm cho trưởng thành cái khĩ cư trú dẫn đến giảm khả năng đẻ trứng; dịng PI 134417 cịn làm giảm khả năng sống sĩt của sâu non. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………13 Nghiên cứu về giống chống chịu địi hỏi thời gian dài mà các lồi cơn trùng nĩi chung và bọ phấn nĩi riêng cĩ khả năng thích nghi nhanh, hơn nữa rất khĩ qui tụ được các đặc điểm nơng sinh học cĩ lợi cho con người cùng tính kháng bệnh. Sử dụng giống chống chịu cần phối hợp với các biện pháp khác để giúp tăng hiệu quả phịng trừ đồng thời hạn chế sự thích nghi của bọ phấn. * Biện pháp sinh học Theo Ryvany và Gerling (1987)[52], 2 lồi ong Encasia ruteola và Eretmocerus đã đưa vào phịng trừ bọ phấn trên cây bơng ở Israel. Theo Hoddle MS (1998) thì lồi ong Encasia formora được sử dụng rộng rãi trên thế giới để phịng trừ bọ phấn trên rau và cây cảnh trong điều kiện nhà lưới. Biện pháp phịng trừ bọ phấn bằng biện pháp sinh học cĩ rất nhiều ưu điểm, cần được các nhà khoa học tiếp tục nghiên cứu để mở rộng. *Biện pháp hĩa học Biện pháp dùng thuốc hĩa học để tiêu diệt bọ phấn là biện pháp được sử dụng rộng rãi và phổ biến, cho hiệu quả phịng trừ bệnh khá cao. Vào những năm 90 của thế kỷ 20 thì một số loại thuốc hĩa học được sử dụng trừ bọ phấn rất hiệu quả như Applaud, Sumilarv, Pegasus, Armir. Theo Shasraf (1986), phịng trừ bọ phấn Bemisia tabaci là cơng việc khĩ khăn bởi bọ phấn cĩ phổ ký chủ rộng tới 500 lồi, các giai đoạn phát dục đều ở mặt dưới của lá, trưởng thành di động mạnh và cĩ tính kháng thuốc trừ sâu mạnh. Nakhla và cộng sự ở Ai Cập cho rằng những năm 1981, 1990 – 1991 nơng dân đã phun 8 – 10 lần/vụ cà chua mà vẫn mất năng suất khoảng 30 – 35%. Việc lạm dụng biện pháp hĩa học gây ra một số nguy cơ như: ngộ độc cho người tiêu dùng, tăng tính chống thuốc của bọ phấn và đặc biệt là nguy cơ ơ nhiễm mơi trường. Năm 1990, Elbert đã thơng báo về tính kháng thuốc của bọ phấn với thuốc Imidaclopoid chỉ sau một vài năm sử dụng. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………14 Ngồi việc sử dụng thuốc hĩa học thì dầu khống cũng được dùng để trừ bọ phấn (Smith et al., 1973). N.S. Butter và cộng sự (1973) đã sự dụng dầu khống sữa 0,37 – 2% để trừ bọ phấn cho kết quả tốt. 2.2 Tình hình nghiên cứu trong nước Dựa vào phân tích phân tử, Việt Nam đã phát hiện được 19 lồi begomovirus: Lồi đã được cơng bố: Squash leaf curl China virus (SLCCV) trên họ bầu bí; Loofa yellow mosaic virus (LYMV) trên họ bầu bí (Revill et al.,2003); Tomato yellow leaf curl Việt Nam virus (ToLCVV); Tomato yellow leaf curl Kanchanaburi virus (TYLCKV) trên cây cà chua (Green et al., 2001); Papaya leaf curl China virus (PaLCuCNV) trên cây thuốc lá; Lindernia anagallis yellow vein virus (LaYVV) trên cây lữ đằng; Alternanthera yellow vein virus (AlYVV) trên hoa dina, nhọ nồi; Sida leaf curl virus (SiLCV) trên cây cối xay; Ludwigia yellow vein virus (LuYVV) trên cây rau mương. Lồi chưa cơng bố: Corchorus yellow vein virus (CoYVV); Corchorus golden mosaic virus (CoMV) trên cây rau đay; Kudzu mosaic virus (KuMV) trên cây sắn dây; Clerodendrum golden mosaic virus (ClGMV) trên cây mị hoa trắng; Spilanthes yellow vein virus (SpYVV) trên cây cúc nút áo; Mimosa yellow leaf curl virus (MiLVV) trên cây trinh nữ mĩc; Sida yellow vein Vietnam virus (SiYVVNV) trên cây ké hoa vàng; Tomato leaf curl Vietnam virus (TYLCVNV) trên cây cà chua; Erectites yellow mosaic virus (ErYMV) trên cây rau tàu bay; Ludwigia yellow vein Vietnam virus (LuYVVNV) trên cây rau mương (Ha et al., 2006, 2008)[28],[37]. Ở Việt Nam, đã cĩ 2 lồi begomovirus được phát hiện gây ra bệnh xoăn vàng ngọn cà chua. Lồi thứ nhất là Tomato leaf curl Vietnam virus (ToLCVV), được phân lập từ cây cà chua bị bệnh xoăn vàng ngọn ở miền Bắc vào năm 2001 (Green et al., 2001). Lồi thứ hai là Tomato yellow leaf curl Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………15 Kanchanaburi (TYLCKaV), được phân lập đầu tiên ở tỉnh Kanchanaburi (Thái Lan) vào năm 2002 (Green et al., 2002) và được phát hiện trên cây cà chua tại Việt Nam vào năm 2005 (mã số Genbank của mẫu Việt Nam là DQ169054, -55). Gần đây, từ một mẫu cà chua bị bệnh xoăn vàng ngọn thu thập tại Hà Nội, cùng với ToLCVV, một lồi begomovirus thứ ba cũng đã được phân lập. Lồi này được đặt tên là Tomato yellow leaf curl Vietnam virus (TYLCVNV). Trên mẫu cà chua này, một phân tử DNA -β mới cũng đã được phát hiện (Ha et al., 2007). Phân tử DNA - β là một phân tử DNA vịng đơn, cĩ kích thước khoảng 1,35 kb. Các phân tử DNA - β phụ thuộc vào begomovirus để nhân lên và được xem là các phân tử vệ tinh của begomovirus. Vai trị của phân tử DNA - β trong hình thành triệu chứng bệnh khơng thống nhất, một số lồi begomovirus chỉ cĩ thể tạo triệu chứng cùng với sự cĩ mặt của phân tử DNA - β trong khi đĩ một số lồi khác lại khơng cần. Nguyễn Thơ và Bùi Văn Ích (1968) đã xác định được bệnh xoăn vàng ngọn cà chua (TYLCV) ở Việt Nam là khá phổ biến và gây thiệt hại lớn trên cà chua. Bệnh lan truyền qua bọ phấn (Bemisia tabaci) từ 3 – 4 bọ phấn tiếp xúc cây bệnh và lây lên cây khỏe đã cĩ khả năng truyền bệnh tốt. Bùi Văn Ích và cộng sự (1970) bước đầu nghiên cứu nguyên nhân gây bệnh và vectơ truyền bệnh xoăn vàng ngọn cà chua. Tác giả nhận định đĩ là bệnh virus, triệu chứng chủ yếu là mép lá cong lên, lá ngọn vàng. Nguyễn Thơ (1967 – 1969) cho biết mức độ phát sinh bệnh xoăn vàng ngọn cà chua cĩ quan hệ rất chặt với mật độ bọ phấn. Tác giả cho biết tỷ lệ bệnh vụ hè thu và vụ xuân hè cao hơn nhiều so với vụ đơng. Nguyên nhân là do nhiệt độ hai vụ này cao hơn, thích hợp cho bọ phấn phát triển cũng như tăng khả năng truyền bệnh. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………16 Theo Viện Bảo vệ thực vật (1970)[19], mặt lá non của cây bị bệnh nhăn nheo, lồi lõm, dọc theo gân lá cĩ màu lục đậm, mép lá biến vàng và cong lên, lá ra sau càng bị nhỏ, nhăn nheo, lá màu vàng cĩ khi gân lá màu nâu tím, cây sinh trưởng phát triển chậm, cây bị mắc bệnh sớm chỉ cao 20 – 30 cm. Những lá ra trước khi cây bị bệnh vẫn giữ màu xanh bình thường nhưng mép lá hơi cong lên. Kết quả nghiên cứu của Trần Khánh Bửu (1973) ở trại thí nghiệm Viện Bảo vệ thực vật cho thấy cà chua vụ xuân hè gieo trồng muộn, bệnh virus xoăn lá nặng, chỉ thu hoạch được 26 kg quả/4000m2. Kiều Thị Thư và cộng tác viên (1994) khảo sát tập đồn giống cà chua thấy ở tất cả các nhĩm giống ngắn ngày, trung bình và dài ngày đều bị nhiễm virus. Cũng theo Kiều Thị Thư và cộng tác viên (1995), giống MV1 và các dịng chọn từ MV1 tỷ lệ cây bệnh virus cao song triệu chứng nhẹ, khơng ảnh hưởng đến năng suất. Nguyễn Thơ (1984)[17] cho biết bệnh xoăn vàng ngọn cà chua gây thiệt hại đến 80 – 90% năng suất. Cũng theo tác giả, khi mật độ bọ phấn (Besmisia tabaci) từ 56 – 58 con/ cây cà chua thì tỷ lệ bệnh xoăn vàng lên tới 99,44%. Khi ghép cây mang mầm bệnh với gốc cây khỏe thì tỷ lệ bệnh là 100%. Theo tác giả Nguyễn Văn Viên (1999)[21] bệnh làm giảm năng suất 37,8% khi nhiễm ở giai đoạn sau ra hoa và giảm tới 83,2% khi cây nhiễm ở thời kỳ trước ra hoa, thậm chí gây thất thu ở nhiều vùng sản xuất cục bộ. Theo Lê Thị Liễu (2004)[11] trên cây cà chua ở giai đoạn cịn non cĩ 2 con bọ phấn cĩ thể truyền được bệnh xoăn lá, với số lượng bọ phấn 5 con/ cây tiếp xúc liên tục trong 6 giờ đồng hồ thì bắt đầu truyền được bệnh và tiếp xúc lâu hơn thì khả năng truyền bệnh lớn hơn. Bệnh phát sinh và gây hại hầu hết ở các vùng trong cả nước như: Hà Nội, Hải Phịng, Hải Dương, Hưng Yên, Bắc Ninh, Bắc Giang, Vĩnh Phúc, ... Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………17 (Vũ Triệu Mân và Lê Lương Tề, 2001)[14]. Bệnh trên ruộng cà chua thường xuất hiện với những triệu chứng hỗn hợp do nhiều loại virus gây ra. Thường một cây cĩ thể cĩ tới 2 loại virus trở lên, cĩ trường hợp cĩ tới 4 – 5 loại virus. Trên những ruộng bệnh nặng rất khĩ tìm thấy một cây nhiễm riêng một loại virus. Tuy nhiên, thiệt hại nặng nhất vẫn là bệnh xoăn vàng ngọn cà chua (TYLCV) (Vũ Triệu Mân và Lê Lương Tề, 1999)[13]. Bệnh virus xoăn vàng ngọn ở nước ta là phổ biến, tỷ lệ bệnh cao hơn nhiều so với bệnh khảm lá dương xỉ và khảm vàng lá. Bệnh gây hại khá nặng trên đồng ruộng, cây cà chua bị bệnh virus xoăn vàng ngọn sẽ làm cho hoa và nụ bị rụng nhiều, quả xốp, khơ nước, phẩm chất kém, năng suất thấp (Vũ Văn Hải, 2007). ðể phịng trừ bệnh xoăn vàng ngọn cà chua, Bùi Văn Ích, Lê Trường, Nguyễn Thơ (1971) đã sử dụng thuốc Bi 58 diệt bọ phấn bằng cách phun định kỳ và tưới đã cĩ hiệu quả. Theo Lê Trường và cộng tác viên (1971) dùng thuốc Wofatox hoặc Bi58 nồng độ 0.1% phun mỗi tuần từ khi trồng đến khi cây ra 5 chùm hoa đã hạn chế được tác hại của bọ phấn và bệnh xoăn lá. Vũ Triệu Mân và cộng sự (1993)[12] đã sử dụng biện pháp tổng hợp là phun thuốc kết hợp với nhỏ bỏ cây bệnh để phịng trừ bọ phấn và bệnh virus trên cà chua cĩ hiệu quả rất cao. Trần Khắc Thi (1999) cho biết cĩ thể sử dụng Mornitor và Nuvacron để phịng trừ bọ phấn. Nguyễn Văn Tuất và cộng sự, Phạm Văn Biên cho rằng sử dụng Trebon, Padan, Pegasus, Sherpa, Admire, Bassa cùng việc tỉa bỏ lá già để phịng trừ bọ phấn. Theo Lê Thị Liễu & Trần ðình Chiến (2004)[11], sau 2 năm nghiên cứu các tác giả khuyến cáo sử dụng thuốc Pegasus 500SC và dầu khống SK Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………18 EN 99 nồng độ 0,1% và 0,2% đều trừ được bọ phấn ở thời kỳ ấu trùng, nhộng và trưởng thành. Trong hệ thống canh tác người ta cĩ thể luân canh cà chua với những cây trồng bọ phấn tỏ ra khơng ưa thích như lúa, rau họ thập tự. Cho tới nay, người ta chưa phát hiện thấy gen kháng R chống lại begomovirus trên cây cà chua trồng (Lycopersicon esculentum). Tuy nhiên, một số gen kháng chống lại begomovirus đã được phát hiện thấy trên một số giống cà chua dại. Ví dụ gen Ty-1 được phân lập từ cây cà chua dại (Lycopersicon chilense) là một gen kháng trội khơng hồn tồn. Ty-1 dường như tương tác với các protein chịu trách nhiệm di chuyển của virus để tạo tính kháng. Ty-1 đã được chuyển vào cà chua trồng để tạo giống kháng (Hà Viết Cường, 2008). Theo Bùi Xuân ðáng (2009), muốn diệt trừ bọ phấn, chúng ta cĩ 2 cách là phun thuốc và dùng bẫy. Cĩ thể phun loại thuốc ít độc nhất như xà phịng diệt trùng (Insecticide soap, Safe soap) hoặc với Malathion 50 hay Diazinon nhưng phải phun liên tiếp 4 lần, mỗi lần cách nhau một tuần lễ vì thuốc khơng diệt được ấu trùng trong vở trứng. Sử dụng bẫy dính cĩ thể đề phịng được sự lây lan khắp nơi của bọ phấn. Bọ phấn ưa thích nhất là màu vàng sáng hay vàng chanh nên cĩ thể treo những miếng giấy hay nhựa màu vàng cĩ trét keo để thu hút bọ phấn. Ở nước ta, bọ phấn hại trên nhiều loại cây trồng và cây dại, chúng cĩ thể phát triển quanh năm trên đồng ruộng. Vì vậy, phịng trừ bọ phấn cũng như phịng trừ bệnh virus xoăn vàng ngọn gặp nhiều khĩ khăn. Các biện pháp phịng trừ bệnh xoăn vàng ngọn cà chua đã được đưa ra như: nhổ bỏ cây bệnh, diệt cỏ dại là kí chủ của bọ phấn, luân canh với cây trồng khơng phải là kí chủ của bọ phấn, sử dụng thuốc hĩa học phịng trừ bọ phấn. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………19 3. ðỐI TƯỢNG, ðỊA ðIỂM, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1. ðối tượng, vật liệu, địa điểm nghiên cứu 3.1.1. ðối tượng nghiên cứu - Virus xoăn vàng ngọn cà chua - Bọ phấn (Bemisia tabaci Genn.) 3.1.2. Vật liệu nghiên cứu - Mẫu bệnh trên cây cà chua thu ở Hải Phịng và vùng phụ cận - Cơn trùng mơi giới: bọ phấn trắng (Bemisia tabaci Genn.) - Nhà lưới trồng cách li, lồng nuơi bọ phấn, đĩa petri, bút lơng, kẹp cơn trùng, kính lúp. - Cặp mồi sử dụng trong phản ứng PCR + Cặp mồi chung DNA-A của begomovirus là BegoAReV1 & BegoAFor1 (Ha et al., 2006) BegoAReV1: 5’- ATHCCMDCHATCKTBCTiTGCAATCC*- 3’ BegoAFor1: 5’- TGYGARGGiCCiTGYAARGTYCARTC* - 3’ * Y (C/T), R (G/A), H (A/C/T), M (A/C), B (C/G/T), D(A/G/T), K (G/T) và i = inosine + Cặp mồi đặc hiệu ToLCVV (sản phẩm = 454 bp) Mồi xuơi dịng là ToLCVV-sp-F2 cĩ trình tự: (vị trí 1245) 5’ GACCAGTCTGAAGGTGTGAGTTC 3’ (vị trí 1276) Mồi ngược dịng là ToLCVV-sp-R2 cĩ trình tự: (vị trí 1683) 5’ ACTCAAGCTATAAAGAATACCTAGAC 3’ (vị trí 1708) + Cặp mồi đặc hiệu TYLCVNV (sản phẩm = 1386 bp) Mồi xuơi dịng là TYLCVNV-sp-F1 cĩ trình tự: (vị trí 1094) 5’ TGTGTTACATATTCTGTGTTTTCC 3’ (vị trí 1117) Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………20 Mồi ngược dịng là TYLCVNV-sp-R1 cĩ trình tự: (vị trí 2456) 5’ AAATACATCAAAATCTGCAGAGAGC 3’ (vị trí 2480) + Cặp mồi đặc hiệu DNA-β của begomovirus BetaFor2 & BetaRev2 BetaFor2: 5’-TAGCTACGCCGGAGCTTAGCTCG-3’ BetaRev2: 5’-AAGGCTGCTGCGTAGCGTAGTGG-3’ Cặp mồi này khuếch đại cả phân tử DNA-β cĩ kích thước 1300 – 1400 bp. Các hĩa chất cần thiết, dụng cụ máy mĩc dùng trong phương pháp PCR. - Bẫy dính màu vàng 3.1.3 ðịa điểm, thời gian nghiên cứu - ðịa điểm nghiên cứu: + Các vùng trồng cà chua tại Hải Phịng và vùng phụ cận + Trung tâm Bệnh cây nhiệt đới – Trường ðại học Nơng nghiệp Hà Nội - Thời gian nghiên cứu: từ tháng 12/2008 – tháng 6/2009 3.2. Nội dung nghiên cứu - ðiều tra tình hình bệnh xoăn vàng ngọn cà chua tại Hải Phịng và phụ cận vụ xuân hè 2009 - Mơ tả triệu chứng bệnh và giám định virus gây bệnh bằng phương pháp PCR - Tìm hiểu phương thức lan truyền và phạm vi ký chủ của virus gây bệnh xoăn vàng ngọn cà chua - Thử nghiệm phịng trừ mơi giới truyền bệnh xoăn vàng ngọn cà chua bằng bẫy dính màu vàng - Xác định tính gây bệnh của TYLCVNV trên cà chua bằng kỹ thuật lây nhiễm Agroinoculation Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………21 3.3. Phương pháp nghiên cứu 3.3.1. Phương pháp điều tra diễn biến tỷ lệ bệnh và mật độ bọ phấn trên đồng ruộng - ðiều tra tỷ lệ bệnh: Tiến hành điều tra theo TC10 TCN – 224 – 95 Hà Nội của Cục Bảo vệ thực vật [3]. ðiều tra định kì 7 ngày/lần, trên mỗi giống điều tra theo phương pháp 5 điểm chéo gĩc, mỗi điểm điều tra 50 cây đối với ruộng lớn (trên 1 sào) và tồn bộ số cây đối với ruộng nhỏ (dưới 1 sào). - ðiều tra diễn biến mật độ bọ phấn: Tiến hành điều tra theo 5 điểm chéo gĩc, mỗi điểm cố định 5 cây, điều tra ngẫu nhiên 20 lá/ điểm dải đều ở 3 tầng lá. + Chỉ tiêu theo dõi: * Tỷ lệ bệnh: Số cây bệnh TLB (%) = —————————— x 100 Tổng số cây điều tra * Mật độ bọ phấn: Tổng số bọ phấn điều tra MðBP (con/lá) = ——————————— Số lá điều tra 3.3.2. Tiến hành thu mẫu nghiên cứu - Phương pháp thu mẫu: Mẫu thu đựng riêng trong từng túi cĩ ghi đầy đủ các thơng tin sau: + Tên mẫu + ðịa điểm ruộng + Thời gian lấy mẫu + ðặc điểm triệu chứng bệnh Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………22 + Tỷ lệ nhiễm bệnh xoăn vàng lá (ngọn) chung cả ruộng - Phương pháp bảo quản mẫu: cĩ 2 phương pháp bảo quản mẫu + Phương pháp 1: Bảo quản khơ Bước 1: Sấy mẫu ở nhiệt độ 40oC đến khi mẫu khá khơ Bước 2: Mẫu được gĩi trong giấy mỏng nhằm ngăn cách hai silicagel và mẫu sau đĩ để trong túi, ống chứa hạt silicagel. Cần chú ý thay hạt silicagel (dựa vào sự thay đổi màu sắc của hạt khi chưa hút ẩm và khi khơng cịn khả năng hút ẩm nữa) đến khi mẫu khơ giịn. + Phương pháp 2: Bảo quản tươi Mẫu thu về được để nguyên trong túi giữ lạnh ở tủ - 20oC. Chú ý khơng đưa mẫu ra ngồi khi chưa sử dụng 3.3.3. Giám định virus gây bệnh bằng phương pháp PCR * Chiết tách DNA tổng số từ mẫu mơ thực vật Cĩ 2 phương pháp chiết DNA: - Phương pháp 1: DNA tổng số từ mơ lá được chiết nhanh bằng kiềm (NaOH) theo phương pháp của Wang et al. (1993) như sau: Bước 1: Cho khoảng 50 mg mơ lá vào tube 1,5 ml; tiếp tục cho 0,5 ml dung dịch NaOH 0,5M vào tube. Dùng chày nhựa nghiền nhuyễn mẫu lá. Bước 2: Hịa lỗng dịch nghiền 50 lần với đệm Tris 0,1M; pH 8 (5µl dịch nghiền hịa lỗng với 245 µl đệm Tris). Bước 3: Lưu trữ mẫu trong tủ lạnh – 20oC - Phương pháp 2: Chiết tách DNA tổng số bằng CTAB Bước 1: + Cho 0,1g mơ lá tươi hoặc 0,02g mơ lá khơ vào tube 1,5ml + Cho 0,5ml đệm CTAB + βME đã ủ ở 60oC trong 10 phút vào tube. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………23 Dùng chày nhựa nghiền nhuyễn. + Ủ 10 phút ở 65oC sau đĩ để nguội ở nhiệt độ phịng Bước 2: + Cho 0,5 ml hỗn hợp (Chlorofom : isoamyl alcohol = 24 : 1) vào tube lắc đều. + Sau đĩ ly tâm 12.000/phút trong 10 phút; hút dịch trên của tủa sang một tube mới (0,35ml). Bước 3: + Cho tiếp thể tích tương đương 0,35 ml hỗn hợp (Chlorofom : isoamyl alcohol = 24 : 1) vào tube lắc đều + Ly tâm 10 phút, hút dịch trên của phần kết tủa san một tube mới (0,25 ml) Bước 4: + Cho một thể tích tương đương Propanol vào tube, lắc đều, để lạnh -20oC trong 10 phút + Ly tâm 10 phút, hút bỏ dịch trên, giữ lại cặn (DNA). Bước 5, 6: + Rửa cặn hai lần Ethanol 70o (0,7 ml/lần), đảo nhẹ, đổ hết Etol. Sau đĩ spin và dùng pipet hút hết ethanol thừa Bước 7: + ðể khơ cạn trong khơng khí ít nhất 30 phút Bước 8: + Hịa cặn trong 0,1 ml nước cất 2 lần và giữ ở -20oC * Tiến hành phản ứng PCR (Polymerase Chain Reaction) và điện di sản phẩm PCR - Chu trình phản ứng PCR + Thành phần của mỗi phản ứng PCR Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………24 H2O : 18,75µl Buffer : 2,5µl dNTPs : 0,5µl Mồi F : 0,5µl Mồi R : 0,5µl MgCl2 : 1,5µl Taq (Fermantas): 0,25µl DNA : 0,5µl Tổng thể tích : 25µl + Quy trình thực hiện phản ứng PCR 94oC 5 phút x 1 94 oC 50 oC 72 oC 30 giây 35 giây 1 phút 35 giây x 35 72 oC 5 phút x 1 - ðiện di sản phẩm PCR + Sản phẩm PCR được điện di trên gel agarose 1% được chuẩn bị bằng đệm TAE và chứa 0,5 mg/ml Ethidium bromide. + Gel được chạy trên thiết bị điện di là Mini-Sub Cell (Biorad) với đệm TAE ở điện thế 110V trong 30 – 40 phút. + Bản gel được kiểm tra dưới ánh sáng tử ngoại và được chụp lại bằng máy ảnh kỹ thuật số. 3.3.4. Xác định tính gây bệnh của TYLCVBV trên cà chua bằng kỹ thuật lây nhiễm Agroiculation và lây nhiễm bằng bọ phấn * Phương pháp Agroiculation: - Cĩ 3 kỹ thuật agroinoculation chính là: + Thấm chân khơng Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………25 + Tiêm trực tiếp vi khuẩn vào mơ + Tưới trực tiếp dịch vi khuẩn vào đất. Chúng tơi sử dụng kỹ thuật tiêm trực tiếp dịch vi khuẩn vào mơ: - Bước 1: Nuơi cây dịng vi khuẩn chứa cấu trúc xâm nhiễm trong 200ml mơi trường LB lỏng chứa 3 loại kháng sinh (streptomicin 200µg/ml, refampicin 34µg/ml và kanamicin 100µg/ml) trong tủ nuơi cấy cĩ lắc (250rpm/28oC/2ngày). - Bước 2: Ly tâm dịch vi khuẩn (3000g/ 5 phút) - Bước 3: Hịa cặn vi khuẩn với 5 ml mơi trường LB chứa 3 loại kháng sinh trên. - Bước 4: Dùng kim tiêm tiêm dịch vi khuẩn vào chồi và 4 nách lá tiếp theo, mỗi vị trí tiêm 10µl. - ðể đảm bảo cây khơng bị lây nhiễm bọ phấn, thí nghiệm được thực hiện tại nhà lưới trung tâm Bệnh cây nhiệt đới. Chuẩn bị tế bào E. coli tiềm năng 1. Chuẩn bị mơi trường - Mơi trường LB lỏng 1 l 250 ml Trypton 10 g 2.5 g Yest extract 5 g 1.25 g NaCl 5 g 1.25 g Agar 15 g 3.75 g Cho các thành phần vào. Lên thể tích. Lắc cho tan. Hấp ở 121 oC/ 15 phút. (mơi trường LB cĩ thể là lỏng (khơng cĩ agar) hoặc đặc (cĩ agar), để rĩt ra đĩa Petri. Nếu bổ xung kháng sinh thì phải để mơi trường nguội khoảng 55 oC. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………26 Trình tự 1. Lấy 1 tube XL1 blue (giữ trong tủ - 80o). ðể trên khay đá khoảng 15 – 30 phút cho tan đơng. 2. Dùng que cấy vi khuẩn, cấy vi khuẩn lên mơi trường LB đặc (khơng chứa kháng sinh). Ủ qua đêm ở 37oC. 3. Cấy độ 4-5 khuẩn lạc XL1 blue vào tube chứa 5 mL LB lỏng chứa Tetracillin. Ủ tube qua đêm ở 37oC cĩ lắc (phịng TN JICA). 4. Cho tất cả 5 ml dịch XL1 blue trên vào bình cỡ 500 ml chứa 200 ml SOB. Ủ bình ở 18°C với lắc mạnh 200 – 250 rpm cho tới khi OD600 = 0.6 5. Ly tâm dịch vi khuẩn ở 2500 g/ 4oC/10 phút. Loại dich trên tủa. Giữ lại cặn vi khuẩn. 6. Cho vào trong tube ly tâm chứa cặn vi khuẩn 80 ml TB lạnh. Hịa tan vi khuẩn. 7. Ly tâm giống bước 5. Loại bỏ dịch trên tủa, giữ lại cặn. 8. Cho tiếp 80 ml TB lạnh và lặp lại giống bước 6 và 7. 9. Hịa cặn vi khuẩn với 20 ml TB lạnh. 10. Bổ sung DMSO tới nồng độ 7% (9.3 ml dịch TB/vi khuẩn + 0.7 ml DMSO). 11. Cho 150 µl dịch competent cells vào tube 0.5 ml. Giữ các tube ở - 80oC * Phương pháp lây nhiễm bằng bọ phấn Bọ phấn được thả trên cây nguồn bệnh cho chúng chích hút một ngày sau đĩ chuyển sang cây khỏe được trồng trong nhà lưới dùng để lây nhiễm, mỗi loại gồm 10 cây, mỗi cây đặt trong một hộp. Ở mỗi hộp thả 10 con bọ phấn cho chúng truyền virus một ngày sau đĩ đưa ra khỏi hộp. * Chỉ tiêu theo dõi: + Quan sát mơ tả triệu chứng. + Tỷ lệ nhiễm bệnh tính cho mỗi loại cây: Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………27 Số cây biểu hiện triệu chứng TLCNB (%) = ———————————— Số cây lây bệnh + Thời kì tiềm dục (TKTD): tính từ lúc lây nhiễm cho tới khi cây biểu hiện triệu chứng (ngày). 3.3.5. Phương pháp bố trí thí nghiệm đồng ruộng - ðịa điểm thí nghiệm: ruộng trồng cà chua ở xã Hồng Phong – An Dương – Hải Phịng - Bẫy dính màu vàng: kích thước 17,8 x 12,6 cm * Thí nghiệm 1: Xác định số lượng bẫy dính màu vàng trên một đơn vị diện tích trong phịng trừ bọ phấn - Thí nghiệm được bố trí theo kiểu RCB gồm 4 cơng thức và 3 lần nhắc lại - Cơng thức thí nghiệm: + Cơng thức 1: 2 bẫy/ 10 m2 + Cơng thức 2: 4 bẫy/ 10 m2 + Cơng thức 3: 6 bẫy/ 10 m2 + Cơng thức 4: 8 bẫy/ 10 m2 - Chỉ tiêu theo dõi: + ðiều tra 2 ngày/lần: mật độ bọ phấn vào bẫy (con/bẫy) + ðiều tra 7 ngày/lần: tỷ lệ bệnh (%) và mật độ bọ phấn (con/lá) * Thí nghiệm 2: Xác định thời gian thay bẫy dính màu vàng trong phịng trừ bọ phấn - Cơng thức thí nghiệm: + Cơng thức 1: Thay bẫy sau 2 ngày + Cơng thức 2: Thay bẫy sau 4 ngày + Cơng thức 3: Thay bẫy sau 6 ngày Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………28 + Cơng thức 4: Thay bẫy sau 8 ngày - Chỉ tiêu theo dõi: + Mật độ bọ phấn vào bẫy (con/bẫy) + ðiều tra 7 ngày/lần: tỷ lệ bệnh (%) và mật độ bọ phấn (con/lá) * Phương pháp xử lý số liệu: Số liệu được xử lý bằng chương trình Excel và phân tích bằng IRRISTAT 4.0. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………29 4. KẾT QUẢ VÀ THẢO LUẬN 4.1 Mơ tả triệu chứng bệnh do virus gây ra trên cà chua vụ xuân hè 2009 tại Hải Phịng và vùng phụ cận Kết quả nghiên cứu của Tạ Thu Cúc (1971) đã khẳng định ở vùng đồng bằng sơng Hồng cĩ thể gieo trồng thêm một vụ cà chua trái vụ (gọi là cà chua xuân hè) cùng tồn tại với cà chua đơng cĩ truyền thống lâu đời. Cà chua xuân hè đã được thử nghiệm trong sản xuất mấy thập kỷ và trở thành vụ cà chua chính trong năm, sau vụ cà chua đơng xuân. Ưu điểm của thời vụ này là đáp ứng được nhu cầu của người tiêu dùng vào những ngày nắng nĩng, oi bức của mùa hè, giá bán cao, cĩ lợi cho người sản xuất. Vụ xuân hè với điều kiện nhiệt độ, ẩm độ, ánh sáng thuận lợi cho cây trồng sinh trưởng phát triển thì đồng thời cũng tạo điều kiện cho sâu bệnh gây hại và phát triển mạnh. Cà chua cũng là một trong số những loại cây bị sâu bệnh gây hại mạnh. Trong phạm vi đề tài, chúng tơi đặc biệt quan tâm tới các loại virus hại cà chua. ðối với bệnh virus thực vật, một lồi virus cĩ thể gây hại trên nhiều lồi cây khác nhau với nhiều triệu chứng khác nhau. Trên một lồi cây, triệu chứng bệnh biểu hiện cũng khác nhau. Trên cây cà chua cĩ rất nhiều loại virus cùng phá hoại. Một loại virus cĩ thể cĩ nhiều triệu chứng tương đối giống nhau rất khĩ phân biệt. Tuy nhiên, một số loại virus gây hại cà chua cĩ biểu hiện các tính chất tương đối đặc trưng. Xuất phát từ thực tế trên, trong quá trình điều tra theo dõi diễn biến bệnh virus gây hại trên cà chua vụ xuân hè 2009 chúng tơi đã phân biệt triệu chứng bệnh virus trên cà chua thành một số dạng chính: xoăn ngọn, khảm vàng, khảm lá dương xỉ, khảm lồi lõm. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………30 * Triệu chứng khảm vàng Triệu chứng bệnh cĩ thể xuất hiện trong suốt thời kỳ sinh trưởng phát triển của cây nhưng triệu chứng bệnh đặc trưng từ giai đoạn ra hoa đến thu hoạch quả. Lá mới bị bệnh thường cĩ vết khảm xanh vàng xen kẽ. Lá bị bệnh thường vàng từ gốc lá, lá hơi cong xuống. Quả trên cây bị bệnh thường nhỏ, bị khảm vàng loang lổ hoặc bị biến vàng đơi khi cĩ vết đốm. Hình 4.1. Triệu chứng khảm vàng lá cà chua * Triệu chứng xoăn vàng ngọn Bệnh xoăn vàng ngọn xuất hiện từ giai đoạn cây con đến khi thu hoạch. Lá cây bị bệnh thường cong lõm và bị biến vàng từ mép lá vào trong. Triệu chứng điển hình thường quan sát thấy ở lá non gần ngọn. Ngọn lá non thường bị xoăn mạnh, cĩ màu vàng, kích thước lá thường nhỏ hơn so với lá khỏe. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………31 Cây bị bệnh trước khi ra hoa làm cây khơng thể ra hoa, đậu quả. Cây nhiễm bệnh sau khi ra hoa kết quả thì hoa dễ bị rụng, quả nhỏ, chất lượng kém. Hình 4.2. Triệu chứng xoăn vàng ngọn cà chua * Triệu chứng khảm lá dương xỉ Triệu chứng này thường xuất hiện vào giai đoạn cà chua bắt đầu ra hoa. Cây nhiễm bệnh thường cịi cọc. Lá trên ngọn bị biến dạng, mất thùy, chỉ cịn gân lá dạng dương xỉ. Cây bị bệnh thường khơng cĩ khả năng cho thu hoạch. Cây nhiễm bệnh vào giai đoạn đã ra hoa và hình thành quả thì thường bị rụng hoa, quả nhỏ và bị biến dạng. * Triệu chứng khảm lồi lõm Triệu chứng bệnh thường xuất hiện từ giai đoạn cây phân cành. Lá bị bệnh cĩ màu hơi xanh, lồi lõm, lá giịn. Cây bệnh thường thấp, sinh trưởng phát triển kém, ít quả và quả nhỏ. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………32 Hình 4.3. Triệu chứng khảm lá dương xỉ Hình 4.4. Triệu chứng khảm lồi lõm Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………33 4.2 Các loại hình triệu chứng bệnh do virus gây hại cà chua vụ xuân hè 2009 tại Hải Phịng và vùng phụ cận Với các triệu chứng được phân loại ở trên, chúng tơi tiến hành đánh giá mức độ phổ biến của từng loại triệu chứng bệnh do virus gây ra với từng giai đoạn sinh trưởng phát triển của cây cà chua vụ xuân hè 2009 tại Hải Phịng và vùng phụ cận. Kết quả thu được như sau: Bảng 4.1. Các loại hình triệu chứng bệnh virus gây hại cà chua vụ xuân hè 2009 tại Hải Phịng và vùng phụ cận Tỷ lệ cây nhiễm các loại hình triệu chứng (%) Giai đoạn sinh trưởng Khảm vàng Khảm lồi lõm Khảm lá dương xỉ Xoăn ngọn Cây con 0,00 0,00 0,00 0,00 Phân cành 3,18 0,60 0,01 0,04 Ra hoa 6,34 2,58 0,27 1,12 Quả non 8,09 3,62 1,13 5,06 Thu hoạch 11,37 5,24 2,03 8,82 0 2 4 6 8 10 12 Cây con Phân cành Ra hoa Quả non Thu hoạch Giai đoạn sinh trưởng Tỷ lệ (%) Khảm vàng Khảm lồi lõm Khảm lá dương xỉ Xoăn ngọn Hình 4.5. Tỷ lệ các loại hình triệu chứng bệnh virus gây hại cà chua vụ xuân hè 2009 tại Hải Phịng và vùng phụ cận Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sỹ khoa học Nơng nghiệp ………………………34 Kết quả ở bảng 4.1 cho thấy ở giai đoạn cây con khơng thể hiện một loại triệu chứng nào. Các giai đoạn tiếp theo trên cây bắt đầu xuất hiện các loại triệu chứng: khảm vàng, khảm lồi lõm, khảm lá dương xỉ và xoăn ngọn. Triệu chứng khảm lá dương xỉ ở giai đoạn._.

Các file đính kèm theo tài liệu này:

  • pdfCH2939.pdf
Tài liệu liên quan