Xác định thành phần chi Begomovirus hại cà chua tại Hải Phòng và phụ cận vụ xuân hè 2009, thử nghiệm biện pháp phòng trừ môi giới truyền bệnh

BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG NGHIỆP HÀ NỘI ----------eêf---------- NGÔ THỊ MẪU ĐƠN XÁC ĐỊNH THÀNH PHẦN CHI BEGOMOVIRUS HẠI CÀ CHUA TẠI HẢI PHÒNG VÀ PHỤ CẬN VỤ XUÂN HÈ 2009, THỬ NGHIỆM BIỆN PHÁP PHÒNG TRỪ MÔI GIỚI TRUYỀN BỆNH LUẬN VĂN THẠC SĨ NÔNG NGHIỆP Chuyên ngành: BẢO VỆ THỰC VẬT Mã số: 60.62.10 Người hướng dẫn khoa học: PGS.TS. NGÔ BÍCH HẢO HÀ NỘI - 2009 LỜI CAM ĐOAN Tôi xin cam đoan số liệu và kết quả nghiên cứu trong luận văn này là hoàn toàn trung thực và chưa từ

doc86 trang | Chia sẻ: huyen82 | Ngày: 09/12/2013 | Lượt xem: 1672 | Lượt tải: 10download
Tóm tắt tài liệu Xác định thành phần chi Begomovirus hại cà chua tại Hải Phòng và phụ cận vụ xuân hè 2009, thử nghiệm biện pháp phòng trừ môi giới truyền bệnh, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ng được sử dụng hoặc công bố trong bất kỳ công trình nào khác. Tôi xin cam đoan rằng mọi sự giúp đỡ cho việc thực hiện luận văn này đã được cám ơn và các thông tin trích dẫn trong luận văn đều được ghi rõ nguồn gốc. Tác giả luận văn Ngô Thị Mẫu Đơn LỜI CẢM ƠN Có được kết quả nghiên cứu này, tôi xin được bày tỏ lòng biết ơn sâu sắc đến: PGS.TS. Ngô Bích Hảo – Trưởng bộ môn Bệnh cây – Nông dược, Khoa Nông học, Trường Đại học Nông nghiệp Hà Nội đã hướng dẫn, giúp đỡ tôi rất nhiệt tình và chu đáo. Cô đã truyền cho tôi những kiến thức và kinh nghiệm quý báu để tôi hoàn thành luận văn nghiên cứu khoa học này. TS. Hà Viết Cường – Giám đốc Trung tâm Bệnh cây nhiệt đới; Giảng viên Bộ môn Bệnh cây – Nông dược, Khoa Nông học, Trường Đại học Nông nghiệp Hà Nội đã quan tâm chỉ bảo, có những góp ý sâu sắc và quý báu cho đề tài của tôi. Tập thể các thầy cô giáo Bộ môn Bệnh cây – Nông dược, Khoa Nông học, Viện Đào tạo Sau đại học, Trường Đại học Nông nghiệp Hà Nội; toàn thể cán bộ của Trung tâm Bệnh cây nhiệt đới đã giúp đỡ, tạo điều kiện cho tôi trong thời gian học tập và thực hiện đề tài. Các đồng chí lãnh đạo xã Tú Sơn – Kiến Thụy; xã Hồng Phong – An Dương – Hải Phòng đã tạo điều kiện và giúp đỡ tôi trong quá trình thực hiện đề tài ở địa phương. Tôi xin chân thành cảm ơn gia đình, bạn bè đã động viên, tạo mọi điều kiện thuận lợi cho tôi trong quá trình học tập và thực hiện đề tài. Tác giả luận văn Ngô Thị Mẫu Đơn MỤC LỤC Lời cam đoan i Lời cảm ơn ii Mục lục iii Danh mục các chữ viết tắt vi Danh mục bảng vii Danh mục hình ix DANH MỤC CÁC CHỮ VIẾT TẮT CTAB DNA MĐBP TLB PCR ToLCVV TYLCVNV : Cetryl Ammonium Bromide : Deoxyribonucleic Acid : Mật độ bọ phấn : Tỉ lệ bệnh : Polymerase Chain Reaction : Tomato leaf curl Vietnam virus : Tomato yellow leaf curl Vietnam virus DANH MỤC BẢNG STT Tên bảng Trang 4.1. Các loại hình triệu chứng bệnh virus gây hại cà chua vụ xuân hè 2009 tại Hải Phòng và vùng phụ cận 33 4.2. Tỷ lệ bệnh xoăn vàng ngọn cà chua vụ xuân hè 2009 tại Hải Phòng và vùng phụ cận 36 4.3. Mật độ một số cây cỏ dại chủ yếu trên ruộng cà chua tại Hải Phòng và vùng phụ cận 37 4.4. Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên giống cà chua P 375 và Mec 89 vụ xuân hè 2009 tại xã Tú Sơn – Kiến Thụy – Hải Phòng 39 4.5. Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên giống cà chua VL-2000 và Mec 89 vụ xuân hè 2009 tại xã Hồng Phong - An Dương – Hải Phòng 41 4.6. Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên giống cà chua Magic và Savior vụ xuân hè 2009 tại xã Phúc Thành – Kim Thành – Hải Dương 44 4.7. Kết quả thử nghiệm các công thức đặt bẫy dính màu vàng trên một đơn vị diện tích ruộng trồng cà chua vụ xuân hè 2009 tại Hải Phòng 47 4.8. Diễn biến mật độ bọ phấn và tỷ lệ bệnh xoăn vàng ngọn giữa các công thức thay bẫy 48 4.9. Động thái bọ phấn vào bẫy vàng tại các công thức thay bẫy khác nhau trên giống cà chua 50 4.10. Diễn biến mật độ bọ phấn và tỷ lệ bệnh xoăn vàng ngọn giữa các công thức thay bẫy 52 4.11. Diễn biến mật độ bọ phấn và tỷ lệ bệnh giữa treo bẫy và phun thuốc trừ bọ phấn trên giống cà chua VL-2000 tại xã Hồng Phong – An Dương – Hải Phòng 54 4.12. So sánh hiệu quả kinh tế giữa phòng trừ bọ phấn bằng bẫy dính màu vàng và phun thuốc hóa học 56 4.13. Kết quả kiểm tra PCR begomovirus bằng cặp mồi chung begoAFor1/begoAReV1 58 4.14. Kết quả giám định PCR kiểm tra sự có mặt của ToLCVV trên các mẫu 60 4.15. Kết quả giám định mẫu bằng phương pháp PCR với cặp mồi đặc hiệu DNA-β 61 4.16. Kết quả lây nhiễm bệnh nhân tạo bệnh xoăn vàng ngọn cà chua bằng hai phương pháp: Agroinoculation và truyền qua bọ phấn 62 DANH MỤC HÌNH STT Tên hình Trang 4.1. Triệu chứng khảm vàng lá cà chua 30 4.2. Triệu chứng xoăn vàng ngọn cà chua 31 4.3. Triệu chứng khảm lá dương xỉ 32 4.4. Triệu chứng khảm lồi lõm 32 4.5. Tỷ lệ các loại hình triệu chứng bệnh virus gây hại cà chua vụ xuân hè 2009 tại Hải Phòng và vùng phụ cận 33 4.6. Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên giống cà chua P 375 và Mec 89 vụ xuân hè 2009 tại xã Tú Sơn – Kiến Thụy – Hải Phòng 39 4.7. Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên giống cà chua VL-2000 và Mec 89 vụ xuân hè 2009 tại xã Hồng Phong – An Dương – Hải Phòng 41 4.8. So sánh tỷ lệ bệnh xoăn ngọn và mật độ bọ phấn trên giống cà chua Mec 89 vụ xuân hè 2009 tại xã Tú Sơn – Kiến Thụy và xã Hồng Phong – An Dương – Hải Phòng 43 4.9. Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên giống cà chua Magic và Savior vụ xuân hè 2009 tại xã Phúc Thành – Kim Thành – Hải Dương 45 4.10. Thí nghiệm bẫy dính màu vàng tại Hải Phòng 46 4.11. Diễn biến mật độ bọ phấn và tỷ lệ bệnh xoăn vàng ngọn giữa các công thức thay bẫy 49 4.12. Diễn biến mật độ bọ phấn và tỷ lệ bệnh xoăn vàng ngọn giữa các công thức thay bẫy 52 4.13. Diễn biến mật độ bọ phấn và tỷ lệ bệnh giữa treo bẫy và phun thuốc trừ bọ phấn trên giống cà chua VL-2000 tại xã Hồng Phong – An Dương – Hải Phòng 54 4.13 Kết quả chạy PCR begomovirus mẫu cà chua bằng cặp mồi chung BegoAFor1/BegoAReV1 (M là thang DNA; giếng số 1 đến số 10 tương ứng với các mẫu từ mẫu số 1 đến mẫu số 10) 57 4.14. Kết quả chạy PCR kiểm tra sự có mặt của ToLCVV trên các mẫu 59 4.15. Kết quả chạy PCR kiểm tra sự có mặt của TYLCVNV trên các mẫu 59 4.16. Kết quả chạy PCR sử dụng cặp mồi đặc hiệu DNA-β 61 1. MỞ ĐẦU 1.1 Đặt vấn đề Một trong những họ virus thực vật lớn nhất là Geminiviridae. Begomovirus là một trong bốn chi của họ Geminiviridae. Begomovirus là chi quan trọng nhất cả về số lượng loài (185 loài năm 2005 (Fauques & Stanley, 2005) và 266 loài năm 2008 (Fauques et al., 2008)) cũng như các bệnh do chúng gây ra đối với cây trồng. Begomovirus (được đặt tên từ Bean golden mosaic virus) là các virus có bộ gen DNA sợi vòng đơn, kích thước khoảng 2,7 kb, lan truyền tự nhiên trên đồng ruộng bằng bọ phấn (Bemisia tabaci) theo kiểu bền vững tuần hoàn. Nhiều bệnh nghiêm trọng trên cây trồng đã được xác định là do begomovirus gây ra như bệnh xoăn vàng lá cà chua – một bệnh được xem là nguy hiểm nhất trên cà chua khắp thế giới (Motiones & Navas-Castillo, 2000). Theo nghiên cứu tình hình bệnh hại cà chua trong nhà lưới và ngoài đồng ruộng năm 2003 – 2005 tại Hà Nội đã tìm ra được 19 loài gây hại, trong đó có 2 bệnh do virus, 3 bệnh do vi khuẩn, 11 bệnh nấm, 2 bệnh sinh lý và tuyến trùng. Theo thống kê của nghiên cứu trên: bệnh hại do virus chiếm số lượng nhỏ nhất nhưng tỷ lệ lại lên tới 29,38% đối với bệnh xoăn vàng ngọn cà chua (Tomato yellow leaf curl virus). Bệnh xoăn vàng ngọn cà chua là một trong các bệnh hại chính trên cây cà chua, gây tổn thất lớn về năng suất và phẩm chất cà chua. Bệnh làm cho lá cà chua xoăn nhỏ lại, cây gần như không có quả. Thiệt hại 60-70% năng suất, thâm chí thất thu hoàn toàn. Bệnh xoăn vàng ngọn cà chua thường phát sinh và gây hại nặng vào mùa khô, một số vùng như Hà Nội, Hưng Yên, Hải Phòng..., đôi khi vẫn thấy bệnh xuất hiện trong mùa mưa nhưng không đại trà như mùa khô. Chỉ riêng tại huyện Đơn Dương (Lâm Đồng) tháng 2 năm 2007 đã có trên 70 ha bị bệnh trong đó có hơn 30 ha bị thiệt hại nặng phải phá bỏ để trồng cây khác. Có hàng chục loài begomovirus gây bệnh xoăn vàng lá trên cà chua khắp thế giới. Tại Việt Nam, bệnh xoăn vàng lá cà chua đã được quan sát thấy từ những năm 70. Gần đây, dựa vào các nghiên cứu phân tử, ít nhất 3 loài begomovirus đã được xác định trên cà chua tại miền Bắc Việt Nam là Tomato leaf curl Vietnam virus (ToLCVV), Tomato yellow leaf curl Vietnam virus (TYLCVNV) và Papaya leaf curl China virus (PaLCCNV). Các nghiên cứu phân tử cũng cho thấy dường như khu vực Đông Nam Á là một trong những trung tâm đa dạng của chi Begomovirus. Điều này gợi ý rằng sẽ còn nhiều loài begomovirus đang chờ được khám phá trên cà chua và nhiều loài cây khác ở Việt Nam. Một trong những đặc điểm gây bệnh của begomovirus là các bệnh trên một loài cây trồng thường do nhiều loài begomovirus gây ra với triệu chứng không thể phân biệt được. Trên cà chua hiện nay có khoảng 40 loài begomovirus gây bệnh xoăn vàng lá với triệu chứng điển hình là lá bị biến vàng nhỏ hẹp, cuốn cong lại thành hình thìa, cây lùn, còi cọc. Danh tính của virus gây bệnh chỉ được xác định dựa trên phân tích phân tử. Gần đây, một loại phân tử DNA vòng đơn nữa, có kích thước khoảng 1 nửa bộ gen begomovirus thường được phát hiện thấy có liên quan với nhiều bệnh do begomovirus gây ra và được gọi là các DNA - β. Các phân tử DNA-β này phụ thuộc vào begomovirus để nhân lên và do đó được xem là các phân tử vệ tinh của begomovirus. Vai trò của phân tử DNA-β trong hình thành triệu chứng bệnh không thống nhất, một số loài begomovirus chỉ có thể tạo ra triệu chứng cùng với sự có mặt của phân tử DNA-β trong khi các loài khác lại không cần. Việc phòng trừ bệnh xoăn vàng lá cà chua (và các bệnh do begomovirus khác) nhìn chung là khó vì virus có tốc độ đột biến và tái tổ hợp rất cao. Một trong các chiến lược phòng trừ bệnh là phòng trừ vector bọ phấn. Mặc dù bọ phấn rất khó phòng trừ triệt để vì là loài đa thực nhưng nhiều công bố cho thấy có thể hạn chế được bệnh nếu duy trì cây sạch bọ phấn trong thời gian sinh trưởng ban đầu.        Xuất phát từ những vấn đề trên, được sự phân công của Bộ môn Bệnh cây – Nông dược, Khoa Nông học, trường Đại học Nông nghiệp Hà Nội, dưới sự hướng dẫn của PGS.TS. Ngô Bích Hảo và TS. Hà Viết Cường, chúng tôi tiến hành thực hiện đề tài: “Xác định thành phần chi Begomovirus hại cà chua tại Hải Phòng và phụ cận vụ xuân hè 2009, thử nghiệm biện pháp phòng trừ môi giới truyền bệnh”. 1.2 Mục đích và yêu cầu 1.2.1 Mục đích - Xác định thành phần chi Begomovirus hại cà chua và một số kí chủ khác tại Hải Phòng và phụ cận fvụ xuân hè 2009, khảo sát một số biện pháp phòng trừ môi giới. 1.2.2 Yêu cầu - Điều tra tình hình bệnh xoăn vàng ngọn cà chua tại Hải Phòng và phụ cận vụ xuân hè 2009 - Xác định sự có mặt của các begomovirus và DNA vệ tinh trên cà chua dùng mồi đặc hiệu chi Begomovirus và DNA-β - Xác định mức độ phổ biến của loài ToLCVV và TYLCVNV bằng PCR với mồi đặc hiệu. - Xác định tính gây bệnh của TYLCVNV bằng lây nhiễm nhân tạo dùng vi khuẩn Agrobacterum tumerfaciens làm vectơ lây nhiễm (agroinoculation) trên cà chua.  - Thử nghiệm biện pháp phòng trừ môi giới truyền bệnh xoăn vàng ngọn cà chua bằng bẫy dính màu vàng. 2. TỔNG QUAN TÀI LIỆU 2.1 Tình hình nghiên cứu trên thế giới Cây cà chua bị nhiều loài dịch hại tấn công, theo số liệu thống kê của CABI, 2005, [24], hiện có 499 loài dịch hại gây hại trên cà chua, trong đó virus có 41 loài. Mặc dù chỉ chiếm một phần nhỏ trong tổng số tất cả các loài dịch hại trên cà chua nhưng bệnh hại do virus gây thiệt hại rất lớn cho các vùng trồng cà chua trên thế giới. Chính vì vậy, bệnh virus hại cà chua đã và đang được rất nhiều nhà khoa học trên thế giới quan tâm, nghiên cứu về đặc điểm sinh học, sinh thái học cũng như phương thức lan truyền để đưa ra biện pháp phòng trừ hiệu quả nhất. 2.1.1 Những thiệt hại do Begomovirus gây ra Bệnh xoăn vàng ngọn cà chua do begomovirus gây hại được ghi nhận đầu tiên trên thế giới từ những năm 1939 – 1940 tại Isarel. Dịch bệnh đã xuất hiện rải rác vào những năm 60 và trở nên nghiêm trọng vào đầu những năm 70, tất cả những vùng cà chua ở Trung Đông đều bị nhiễm bệnh. Bệnh đã được phát hiện ở Đông Nam Á (tại Thái Lan và Đài Loan), châu Phi và châu Âu vào những năm 80 (Makkouk & Laterrot, 1983, [44]; Czosnek et al., 1990 [30]). Bệnh lần đầu tiên được công bố tại châu Mỹ vào năm 1998 (Nakhla et al., 1994)[48]. Gần đây, bệnh còn lan truyền tới phía Tây Địa Trung Hải (Ý), Nhật, Iran và các nước cộng hòa nằm trong khu vực châu Á thuộc Liên Xô cũ như Azebaidan, Turmenistan, Uzebikistan. Ngày nay, nhờ sự trợ giúp của các nghành công nghê mới, số lượng begomovirus được xác định ngày càng nhiều khắp thế giới. Trên khắp các châu lục đều tìm thấy các loài begomovirus khác nhau; ở châu Âu là các nước như Italia, Thổ Nhĩ Kỳ, Tây Ba Nha, Thụy Sĩ, …; ở châu Á như Trung Quốc, Ấn Độ, Iran, Isarel, Pakistan, Philipin, Thái Lan, Malaysia, Indonesia, …; ở châu Phi như Angiria, Libi, Nigeria, Sudan, Tunisia, Ai Cập, …; ở châu Mỹ như CuBa, Dominica, Jamaica, Hoa Kỳ, …; ở châu Đại Dương: Australia (Gafni, 2003)[36]. Số lượng begomovirus được xác định không ngừng tăng, năm 2005 là 185 loài (Fauques & Stanley 2005)[33], năm 2008 là 266 loài (Fauques et al., 2008)[34]. Nhiều bệnh nghiêm trọng trên cây trồng đã được xác định là do begomovirus gây ra như bệnh xoăn vàng cà chua – một trong những bệnh được xem là nguy hiểm nhất trên cà chua khắp thế giới (Moriones và Navas – Castillo, 2000); bệnh khảm lá sắn (Legg & Fauquet, 2004); bệnh cuốn lá bông (Briddon, 2003). Bệnh xoăn vàng ngọn cà chua gây thiệt hại lớn về năng suất và chất lượng. Đây là bệnh virus quan trọng nhất gây hại trên cà chua khắp thế giới, đặc biệt là vùng nhiệt đới và vùng cận nhiệt đới (Pico et al., 1996)[49]. Ngoài cà chua, begomovirus gây bệnh xoăn vàng lá ngọn còn gây giảm năng suất trên cây đậu (Phaseolus vulgaris) ở Isarel và ở phía bắc Tây Ba Nha (Brunt et al., 1996). 2.1.2 Phạm vi kí chủ của begomovirus Begomovirus có phạm vi kí chủ khá phong phú gồm các loại cây trồng và cỏ dại. Trong đó, TYLCV là một trong những begomovirus có phạm vi kí chủ rộng trên nhiều loài thuộc 63 họ thực vật khác nhau. Năm 1991, Zakay cho biết loài cà chua trồng L. esculentum là kí chủ chính của virus gây bệnh. Bên cạnh đó hầu hết các loài cà chua dại như L. chinense, L. hirsutum, L. peruvianum, L. pimpinellifolium, ... cũng đều mang triệu chứng do virus TYLCV hại. Tác giả còn nêu lên một số cây kí chủ thứ yếu khác như cây Lisianthus (Eustoma grandiflorum), cây dã yên thảo (Petunia hybrida), cây đậu cô ve (Phaseolus vulgaris), cây thuốc lá (Nicotiana tabacum) và cây cà độc dược (Datura stramonium). Theo nghiên cứu của Cohen và Nitzany (1996)[26], kí chủ của virus TYLCV gồm 15 loài cây trồng thuộc 5 họ thực vật. Các tác giả Brunt và cộng sự (1996) cho biết có từ 3 – 9 họ thực vật là kí chủ của bệnh. Hầu hết các cây họ cà đều là kí chủ của virus gây bệnh (Jones et al., 1991)[51]. 2.1.3 Triệu chứng bệnh Một trong những đặc điểm gây bệnh của begomovirus là các bệnh trên một loài cây trồng thường do nhiều loài begomovirus gây ra với triệu chứng không thể phân biệt được. Chẳng hạn, trên cà chua, hiện nay có khoảng 40 loài begomovirus gây bệnh xoăn vàng lá. Danh tính của chúng chỉ được xác định dựa trên phân tích phân tử. Tên của bệnh virus xoăn vàng ngọn cà chua xuất phát từ sự mô tả triệu chứng bệnh. Bệnh xoăn vàng ngọn xuất hiện triệu chứng trong vòng 2 – 4 tuần sau khi nhiễm bệnh và phát triển đầy đủ triệu chứng trong vòng 2 tháng. Triệu chứng có thể thay đổi theo điều kiện môi trường, giai đoạn sinh trưởng và điều kiện sinh lý của cây tại thời điểm nhiễm bệnh (Pico et al., 1996)[49]. Triệu chứng sớm nhất là lá cong xuống dưới và phía trong. Về sau, lá không có hình dạng, nhỏ hẹp, biến vàng từ mép và chót lá lan vào giữa gân lás, lá cuốn cong lên phía trên thành hình thìa lìa, lá non biến vàng nhỏ hẹp, giòn. Cuống lá có thể vặn xoắn. Cây lùn còi cọc, mọc nhiều cành nhánh nhỏ, đốt thân ngắn. Cây nhiễm sớm thường không ra quả do hoa bị rụng nhiều (Pico et al., 1996)[49]. Quan sát triệu chứng của bệnh virus xoăn vàng ngọn có thể nhầm lẫn với một số tình trạng bệnh lý khác của cây cà chua, ví dụ như bệnh xoăn lá sinh lý; bệnh do thiếu phosphate, magie. Biểu hiện của bệnh nhiều trường hợp giống triệu chứng do virus ToMV (Cohen S., Nitzany FE, 1996)[36]. 2.1.4 Nguyên nhân gây bệnh Năm 1960, lần đầu tiên bệnh xoăn vàng ngọn cà chua được mô tả và định tên Tomato yellow leaf curl virus (TYLCV) tại Isarel (Cohen S. & Harpaz I., 1964). Sau đó nhiều năm người ta mới xác định chính xác được nguyên nhân gây bệnh. Năm 2000, Ủy ban phân loại virus quốc tế ICTV (International Committee on Taxonomy of Viruses) xác định virus TYLCV thuộc giống Begomovirus, họ Geminniviridae. Virus có hình chày nhỏ, kích thước 20 x 30 nm. Sợi DNA của virus có dạng sợi đơn gồm 2800 nucleotit chứa trong 6 gen; ở dạng sợi đôi gồm 2 phân tử DNA: DNA A và DNA B, mỗi phân tử có khoảng 2600 nucleotit, sợi DNA A cơ bản như sợi đơn còn sợi DNA B chỉ gồm 2 gen (Fancelli M. & Jose Djair Verdramin, 2002). Từ thể phân lập đầu tiên được công bố tại Isarel (1960), cùng với sự lan truyền của bệnh theo các vùng sinh thái khác nhau dựa trên cơ sở giám định sợi DNA về số lượng, trình tự sắp xếp, vị trí các nucleotit. Các chủng virus này ngày càng biến đổi phức tạp do sự tái tổ hợp giữa các loài xảy ra thường xuyên trong họ Geminidae. 2.1.5 Vector truyền lan và sự lan truyền Begomovirus Begomovirus lan truyền ngoài tự nhiên nhờ bọ phấn Bemisia tabaci theo kiểu bền vững tuần hoàn (Cohen & Harpaz, 1964). Năm 1996, Cohen và Antignus cho biết có ít nhất 6 họ thực vật là kí chủ của bọ phấn. Bọ phấn trắng Bemisia tabaci thuộc họ rầy phấn (Aleyrodidae), bộ Homoptera. Khả năng truyền virus TYLCV đã được nhiều nghiên cứu khẳng định, do đó diễn biến của loài cây này trên đồng ruộng có ảnh hưởng lớn tới cây trồng, đặc biệt là cây cà chua. Trong một hội nghị khoa học ở Isarel năm 1939, bệnh xoăn vàng ngọn được truyền bởi bọ phấn Bemisia tabaci trên cà chua, thuốc lá lần đầu tiên tạo được sự chú ý của dư luận khi liên tiếp 3 năm liền gây thất thu lớn trên cà chua từ 28 – 92% năng suất ở Địa Trung Hải. Sau đó bệnh xoăn vàng ngọn cà chua cùng sự lan truyền của nó bởi bọ phấn lần lượt được công bố khắp nơi trên thế giới: Ấn Độ năm 1984 (Vasude & Samjai, 1984), ở Mỹ thập kỷ 60 (Castas, 1969; Debrot et al., 1963), ở Địa Trung Hải năm 1960 (Cohen et al., 1964, 1966), Xu Đăng năm 1965 (Yassin et al., 1965), Campuchia (Rowell et al., 1989), Indonesia (AVRDC, 1985), Nhật Bản thập kỷ 80 (Kobatake et al., 1981; Osaki et al., 1978, 1981), Đài Loan (AVRDC, 1987; Green et al., 1987); Philippin năm 1971 (Retuerma, 1971); Thái Lan thập kỷ 80 (Giatgang, 1980; Thongsit et al., 1986), . . . (dẫn theo Green S.K và Kallo G.). Cho đến nay, hơn 100 nước ở hầu hết các châu lục đã công bố về mối nguy hại do bọ phấn gây ra. Cà chua được trồng ở vùng sông Mêkông trong mùa khô từ tháng 10 đến tháng 6 năm sau. Những điều kiện khí hậu thuận lợi trong thời gian này phù hợp cho sự phát triển của bọ phấn – vật trung gian truyền bệnh virus xoăn vàng ngọn cà chua. Theo Gerling và cộng sự (1996) bọ phấn trắng Bemisia tabaci hoàn thành một vòng đời khoảng 20 – 30 ngày ở điều kiện thích hợp, trung bình có khoảng 11 – 15 lứa/năm. Bọ phấn thích hợp và phát triển mạnh ở điều kiện khô nóng; mưa nhiều làm giảm mật độ bọ phấn. Bọ phấn không khỏe chỉ có thể dịch chuyển những khoảng ngắn để tìm những bộ phận non của cây. Tuy nhiên, nếu điều kiện thời tiết thay đổi bất lợi chúng có thể di chuyển hàng triệu con với khoảng cách dài hơn. Chúng thường chích hút và bay vào buổi sáng, buổi chiều mát. Để tránh ánh sáng mặt trời, chúng núp vào mặt dưới của lá. Điều này phù hợp với phân bố chủ yếu ở khí hậu nhiệt đới và cận nhiệt đới. Những nghiên cứu của Cohen và Nitzany (1966)[26], Mansour và Al-Musa (1982), Mehta và cộng sự (1994), Caciaghi và cộng sự (1995), Ghanim và cộng sự (2001) đều khẳng định bọ phấn truyền theo kiểu bền vững. Để hút dịch cây từ mạch phloem, bọ phấn dùng vòi chọc vào mô mạch dẫn. Virus được hút qua vòi, tới diều, thấm qua màng ruột vào xoang cơ thể, tới tuyến nước bọt và cuối cùng vào ống nước bọt. Bọ phấn hút dịch cây trong khoảng 15 – 30 phút và tiềm ẩn trong cơ thể chúng từ 8 – 24 giờ (thời gian để virus nâng cao nồng độ trong cơ thể bọ phấn) là chúng có khả năng truyền bệnh, khoảng thời gian để chúng truyền ngắn nhất là 15 phút (EPPO/CABI, 1996). Thời gian chích hút của bọ phấn dài hơn thời gian truyền dịch virus sang cây khỏe và thời gian tiềm ẩn là 21 giờ. Bọ phấn hút dịch cây ở giai đoạn sâu non và ngay sau khi hóa trưởng thành chúng có thể truyền nhiễm bệnh virus theo hệ thống và không truyền lại cho đời sau. Có thể phát hiện thấy virus ở bất kỳ giai đoạn phát triển nào của bọ phấn trừ giai đoạn trứng (Ghanim et al., 1998). Thí nghiệm với TYLCV cũng cho thấy, số lượng virus được tích lũy đạt cực đại (khoảng 600 triệu phân tử virus) nếu để bọ phấn chích nạp trên cây bệnh 12 giờ. Thời gian này đối với TYLCV là 24 giờ (Czosnek et al., 2002)[29]. Sau thời gian chích nạp khoảng 1 – 2 ngày, virus có thể duy trì trong cơ thể bọ phấn nhiều tuần: 3 tuần đối với TYLCSV hay cả đời như đối với TYLCV (Czosnek et al., 2002)[29]. Một cá thể bọ phấn có thể truyền bệnh sau khi chích nạp 24 giờ mặc dù tỷ lệ truyền bệnh không cao; tỷ lệ truyền bệnh đạt 100% nếu sử dụng 5 – 15 bọ phấn. Bọ phấn cái truyền virus hiệu quả hơn bọ phấn đực và hiệu quả truyền tốt nhất sau khi bọ phấn trưởng thành ở 1 – 2 tuần tuổi và giảm dần theo thời gian sinh trưởng của bọ phấn. Hiệu quả truyền virus giảm theo tuổi thọ là do lượng virus được chích nạp giảm (Czosnek et al., 2002)[29]. Virus có thể truyền qua giao phối từ bọ phấn đực sang bọ phấn cái và ngược lại. Virus TYLCV không truyền bằng cơ học, đây là tiêu chí quan trọng để phân biệt loài virus này với loài virus khác trong họ Genimidae. Cho đến nay, chưa có một công trình nghiên cứu nào công bố về khả năng truyền nhiễm bệnh xoăn vàng ngọn qua hạt giống. Những nghiên cứu trên cho thấy bọ phấn Bemisia tabaci là con đường duy nhất có thể truyền lan virus TYLCV, phòng trừ bọ phấn cũng là phòng trừ bệnh xoăn vàng ngọn cà chua. Theo Coudiet và cộng sự (1985), trên thế giới có tới 500 loài cây là ký chủ của bọ phấn, trong đó ở Florida có tới 50 loài như khoai lang, dưa chuột, dưa thơm, dưa hấu, bí ngô, cà tím, ớt, cà chua, xà lách, súp lơ xanh, . . . Bọ phấn thích sống ở trên cây trồng này hay cây trồng khác tùy theo vùng sinh thái. Ở Florida, bọ phấn thích sống trên khoai lang, dưa chuột, bí ngồi hơn là súp lơ xanh và cà rốt. Ở Đài Loan thì thứ tự đó là: cà tím, cà chua, khoai lang, dưa chuột, đậu xanh. Một số cây trồng khác và cỏ dại là ký chủ của bọ phấn Bemisia tabaci giúp bọ phấn sống sót khi trên đồng ruộng không có những cây trồng là ký chủ chính tạo thành sự gối lứa trên đồng ruộng. 2.1.6 Biện pháp phòng trừ TYLCV có phổ ký chủ rất rộng, phân bố rộng khắp trên thế giới nên việc phòng trừ là rất khó khăn. Nhiều nhà khoa học đã và đang nghiên cứu để tìm ra cách phòng trừ hiệu quả nhất. Những nghiên cứu trong nhiều năm qua đã khẳng định bọ phấn Bemisia tabaci là phương thức truyền lan duy nhất của virus TYLCV. Với những hiểu biết nhất định về loài côn trùng này cũng như cách thức lan truyền virus của chúng có thể đưa ra các biện pháp phòng trừ bệnh xoăn vàng ngọn cà chua như: điều khiển môi giới truyền bệnh thông qua các loài bắt mồi hay ký sinh, sử dụng hàng rào tự nhiên để cách li bọ phấn với nguồn bệnh và bọ phấn với cây trồng, chọn tạo giống có đặc điểm không ưa thích đối với bọ phấn, loại bỏ chúng trước khi chúng kịp truyền virus. * Biện pháp cơ giới vật lý Việc phòng chống bệnh hại cà chua, hạn chế khả năng gây bệnh thông qua biện pháp canh tác đã được nghiên cứu tại Ủy ban bảo vệ cây trồng Fanham (Vương quốc Anh) thực hiện. Thí nghiệm được tiến hành trên nguyên lý trồng các loại cây trồng trong cùng một khu vực cùng với diện tích trồng cà chua (diện tích trồng cà chua không lớn hơn 5000 m2). Kết quả là cách này đã hạn chế được sự lây lan của virus do bọ phấn không tiếp xúc trực tiếp với cà chua (Hilje L., 2000). Viện nghiên cứu làm vườn Quivican (Cuba) đã nghiên cứu ảnh hưởng của các chế độ canh tác trong khi trồng cà chua: bón chất xử lý và phân hữu cơ, phòng trừ sinh học, cây làm rào chắn (cây ngô), công thức bón 50% phân hữu cơ kết hợp với phân hóa học. Kết quả cho thấy, ở hệ thống canh tác nông sinh (Agroecological) số lượng bọ phấn giảm 8 lần và cây có biểu hiện nhiễm bệnh và mức độ gây hại giảm một nửa so với áp dụng các biện pháp canh tác truyền thống (Cohen et al., 1966)[26]. Bọ phấn có thể chuyển từ cây trồng, từ vùng không có cây ký chủ trên đồng ruộng đến nơi có cây ký chủ hoặc thông qua cỏ dại. Dựa vào xu tính ánh sáng của bọ phấn Bemisia tabaci, Shuter D. và các cộng sự thuộc Trung tâm Nghiên cứu và Giáo dục vùng vịnh Pradenton bang Florida (Mỹ) đã tiến hành nghiên cứu các biện pháp che phủ đất bằng nilon có màu sắc khác nhau để hạn chế mật độ bọ phấn trên cây cà chua. Kết quả cho thấy năng suất cà chua cao nhất ở công thức che phủ lynon vàng (62.3 tấn/ ha), sau đó là da cam (54.8 tấn/ ha), rồi đến mầu ánh bạc (52.7 tấn/ ha). Ở Ai Cập, các thí nghiệm đồng ruộng từ năm 1988 – 1990 cho thấy khi che phủ vườn ươm cà chua bằng vải muslin trắng để bảo vệ cây con không bị bọ phấn xâm nhập đã làm giảm sự truyền lan của bệnh xoăn vàng ngọn, vườn ươm được che phủ vải đã làm tăng năng suất từ 413 – 490% (M.F Haydar). Murugan (2001) quan sát trưởng thành bọ phấn trên bẫy dính màu vàng đặt trên những ruộng trồng các giống bông khác nhau tại Ấn Độ trong 17 tuần mùa đông và 16 tuần mùa hè cho thấy bẫy dính màu vàng đã làm giảm mật độ bọ phấn trên ruộng trồng bông. Biện pháp canh tác nhằm cách ly bọ phấn là phương pháp dễ thực hiện và có chi phí đầu tư thấp. Có thể luân canh cây cà chua với cây không ưa thích của bọ phấn như lúa nước, ngô... . Ngoài ra còn có thể kết hợp biện pháp canh tác với nhổ bỏ cây cà chua bị bệnh nhằm hạn chế nguồn bệnh trên đồng ruộng. Năm 1982, Al – Musa cho biết nên tránh xen canh cà chua với những cây là ký chủ của bọ phấn như bí ngô, dưa chuột... bởi vì chúng là nguồn thu hút bọ phấn đến ruộng cà chua. *Biện pháp giống chống chịu Những năm gần đây, cùng với tiến bộ của khoa học kỹ thuật, các nhà khoa học đã tạo ra những giống cà chua kháng bệnh xoăn vàng ngọn cà chua. Khả năng kháng bệnh của cây là chống chịu bọ phấn hoặc chống lại sự xâm nhiễm, tái tổ hợp của virus trong tế bào cây. Theo Nakhla và cộng sự (1998)[48], cơ sở khoa học của sử dụng giống cà chua chống chịu bọ phấn là sử dụng những giống có nhiều túm lông tơ ngăn cản bọ phấn chích hút dịch cây, những giống có lông tiết ra nhựa dính giống như bẫy dính hoặc cây trồng có tuyến tiết dịch để xua đuổi bọ phấn. Trong các giống cà chua thì các giống có nguồn gốc hoang dại như L. Hirsutum. L. Glabratum, L. Penellii có những đặc điểm trên. Trung tâm nghiên cứu và phát triển rau châu Á (AVRDC) đã lai tạo ra những dòng cà chua có tính kháng rất cao với bọ phấn Besmisia tabaci cũng như bệnh xoăn vàng ngọn cà chua như: LA 1777, LA 1418, LA 407, LA 716, LA 171418, PI 344818. Một số dòng cà chua đã được Fancelli M. (2003) đánh giá ảnh hưởng đến sự phát triển của bọ phấn Bemisia tabaci trong điều kiện nhà lưới tại Agricola. Kết quả là: dòng LA 1548 có tính kháng làm giảm sự sống sót của sâu non và làm tăng thời gian phát dục của bọ phấn; các dòng LA 1739, PI 134417 làm cho trưởng thành cái khó cư trú dẫn đến giảm khả năng đẻ trứng; dòng PI 134417 còn làm giảm khả năng sống sót của sâu non. Nghiên cứu về giống chống chịu đòi hỏi thời gian dài mà các loài côn trùng nói chung và bọ phấn nói riêng có khả năng thích nghi nhanh, hơn nữa rất khó qui tụ được các đặc điểm nông sinh học có lợi cho con người cùng tính kháng bệnh. Sử dụng giống chống chịu cần phối hợp với các biện pháp khác để giúp tăng hiệu quả phòng trừ đồng thời hạn chế sự thích nghi của bọ phấn. * Biện pháp sinh học Theo Ryvany và Gerling (1987)[52], 2 loài ong Encasia ruteola và Eretmocerus đã đưa vào phòng trừ bọ phấn trên cây bông ở Israel. Theo Hoddle MS (1998) thì loài ong Encasia formora được sử dụng rộng rãi trên thế giới để phòng trừ bọ phấn trên rau và cây cảnh trong điều kiện nhà lưới. Biện pháp phòng trừ bọ phấn bằng biện pháp sinh học có rất nhiều ưu điểm, cần được các nhà khoa học tiếp tục nghiên cứu để mở rộng. *Biện pháp hóa học Biện pháp dùng thuốc hóa học để tiêu diệt bọ phấn là biện pháp được sử dụng rộng rãi và phổ biến, cho hiệu quả phòng trừ bệnh khá cao. Vào những năm 90 của thế kỷ 20 thì một số loại thuốc hóa học được sử dụng trừ bọ phấn rất hiệu quả như Applaud, Sumilarv, Pegasus, Armir. Theo Shasraf (1986), phòng trừ bọ phấn Bemisia tabaci là công việc khó khăn bởi bọ phấn có phổ ký chủ rộng tới 500 loài, các giai đoạn phát dục đều ở mặt dưới của lá, trưởng thành di động mạnh và có tính kháng thuốc trừ sâu mạnh. Nakhla và cộng sự ở Ai Cập cho rằng những năm 1981, 1990 – 1991 nông dân đã phun 8 – 10 lần/vụ cà chua mà vẫn mất năng suất khoảng 30 – 35%. Việc lạm dụng biện pháp hóa học gây ra một số nguy cơ như: ngộ độc cho người tiêu dùng, tăng tính chống thuốc của bọ phấn và đặc biệt là nguy cơ ô nhiễm môi trường. Năm 1990, Elbert đã thông báo về tính kháng thuốc của bọ phấn với thuốc Imidaclopoid chỉ sau một vài năm sử dụng. Ngoài việc sử dụng thuốc hóa học thì dầu khoáng cũng được dùng để trừ bọ phấn (Smith et al., 1973). N.S. Butter và cộng sự (1973) đã sự dụng dầu khoáng sữa 0,37 – 2% để trừ bọ phấn cho kết quả tốt. 2.2 Tình hình nghiên cứu trong nước Dựa vào phân tích phân tử, Việt Nam đã phát hiện được 19 loài begomovirus: Loài đã được công bố: Squash leaf curl China virus (SLCCV) trên họ bầu bí; Loofa yellow mosaic virus (LYMV) trên họ bầu bí (Revill et al.,2003); Tomato yellow leaf curl Việt Nam virus (ToLCVV); Tomato yellow leaf curl Kanchanaburi virus (TYLCKV) trên cây cà chua (Green et al., 2001); Papaya leaf curl China virus (PaLCuCNV) trên cây thuốc lá; Lindernia anagallis yellow vein virus (LaYVV) trên cây lữ đằng; Alternanthera yellow vein virus (AlYVV) trên hoa dina, nhọ nồi; Sida leaf curl virus (SiLCV) trên cây cối xay; Ludwigia yellow vein virus (LuYVV) trên cây rau mương. Loài chưa công bố: Corchorus yellow vein virus (CoYVV); Corchorus golden mosaic virus (CoMV) trên cây rau đay; Kudzu mosaic virus (KuMV) trên cây sắn dây; Clerodendrum golden mosaic virus (ClGMV) trên cây mò hoa trắng; Spilanthes yellow vein virus (SpYVV) trên cây cúc nút áo; Mimosa yellow leaf curl virus (MiLVV) trên cây trinh nữ móc; Sida yellow vein Vietnam virus (SiYVVNV) trên cây ké hoa vàng; Tomato leaf curl Vietnam virus (TYLCVNV) trên cây cà chua; Erectites yellow mosaic virus (ErYMV) trên cây rau tàu bay; Ludwigia yellow vein Vietnam virus (LuYVVNV) trên cây rau mương (Ha et al., 2006, 2008)[28],[37]. Ở Việt Nam, đã có 2 loài begomovirus được phát hiện gây ra bệnh xoăn vàng n._.gọn cà chua. Loài thứ nhất là Tomato leaf curl Vietnam virus (ToLCVV), được phân lập từ cây cà chua bị bệnh xoăn vàng ngọn ở miền Bắc vào năm 2001 (Green et al., 2001). Loài thứ hai là Tomato yellow leaf curl Kanchanaburi (TYLCKaV), được phân lập đầu tiên ở tỉnh Kanchanaburi (Thái Lan) vào năm 2002 (Green et al., 2002) và được phát hiện trên cây cà chua tại Việt Nam vào năm 2005 (mã số Genbank của mẫu Việt Nam là DQ169054, -55). Gần đây, từ một mẫu cà chua bị bệnh xoăn vàng ngọn thu thập tại Hà Nội, cùng với ToLCVV, một loài begomovirus thứ ba cũng đã được phân lập. Loài này được đặt tên là Tomato yellow leaf curl Vietnam virus (TYLCVNV). Trên mẫu cà chua này, một phân tử DNA -b mới cũng đã được phát hiện (Ha et al., 2007). Phân tử DNA - b là một phân tử DNA vòng đơn, có kích thước khoảng 1,35 kb. Các phân tử DNA - b phụ thuộc vào begomovirus để nhân lên và được xem là các phân tử vệ tinh của begomovirus. Vai trò của phân tử DNA - b trong hình thành triệu chứng bệnh không thống nhất, một số loài begomovirus chỉ có thể tạo triệu chứng cùng với sự có mặt của phân tử DNA - b trong khi đó một số loài khác lại không cần. Nguyễn Thơ và Bùi Văn Ích (1968) đã xác định được bệnh xoăn vàng ngọn cà chua (TYLCV) ở Việt Nam là khá phổ biến và gây thiệt hại lớn trên cà chua. Bệnh lan truyền qua bọ phấn (Bemisia tabaci) từ 3 – 4 bọ phấn tiếp xúc cây bệnh và lây lên cây khỏe đã có khả năng truyền bệnh tốt. Bùi Văn Ích và cộng sự (1970) bước đầu nghiên cứu nguyên nhân gây bệnh và vectơ truyền bệnh xoăn vàng ngọn cà chua. Tác giả nhận định đó là bệnh virus, triệu chứng chủ yếu là mép lá cong lên, lá ngọn vàng. Nguyễn Thơ (1967 – 1969) cho biết mức độ phát sinh bệnh xoăn vàng ngọn cà chua có quan hệ rất chặt với mật độ bọ phấn. Tác giả cho biết tỷ lệ bệnh vụ hè thu và vụ xuân hè cao hơn nhiều so với vụ đông. Nguyên nhân là do nhiệt độ hai vụ này cao hơn, thích hợp cho bọ phấn phát triển cũng như tăng khả năng truyền bệnh. Theo Viện Bảo vệ thực vật (1970)[19], mặt lá non của cây bị bệnh nhăn nheo, lồi lõm, dọc theo gân lá có màu lục đậm, mép lá biến vàng và cong lên, lá ra sau càng bị nhỏ, nhăn nheo, lá màu vàng có khi gân lá màu nâu tím, cây sinh trưởng phát triển chậm, cây bị mắc bệnh sớm chỉ cao 20 – 30 cm. Những lá ra trước khi cây bị bệnh vẫn giữ màu xanh bình thường nhưng mép lá hơi cong lên. Kết quả nghiên cứu của Trần Khánh Bửu (1973) ở trại thí nghiệm Viện Bảo vệ thực vật cho thấy cà chua vụ xuân hè gieo trồng muộn, bệnh virus xoăn lá nặng, chỉ thu hoạch được 26 kg quả/4000m2. Kiều Thị Thư và cộng tác viên (1994) khảo sát tập đoàn giống cà chua thấy ở tất cả các nhóm giống ngắn ngày, trung bình và dài ngày đều bị nhiễm virus. Cũng theo Kiều Thị Thư và cộng tác viên (1995), giống MV1 và các dòng chọn từ MV1 tỷ lệ cây bệnh virus cao song triệu chứng nhẹ, không ảnh hưởng đến năng suất. Nguyễn Thơ (1984)[17] cho biết bệnh xoăn vàng ngọn cà chua gây thiệt hại đến 80 – 90% năng suất. Cũng theo tác giả, khi mật độ bọ phấn (Besmisia tabaci) từ 56 – 58 con/ cây cà chua thì tỷ lệ bệnh xoăn vàng lên tới 99,44%. Khi ghép cây mang mầm bệnh với gốc cây khỏe thì tỷ lệ bệnh là 100%. Theo tác giả Nguyễn Văn Viên (1999)[21] bệnh làm giảm năng suất 37,8% khi nhiễm ở giai đoạn sau ra hoa và giảm tới 83,2% khi cây nhiễm ở thời kỳ trước ra hoa, thậm chí gây thất thu ở nhiều vùng sản xuất cục bộ. Theo Lê Thị Liễu (2004)[11] trên cây cà chua ở giai đoạn còn non có 2 con bọ phấn có thể truyền được bệnh xoăn lá, với số lượng bọ phấn 5 con/ cây tiếp xúc liên tục trong 6 giờ đồng hồ thì bắt đầu truyền được bệnh và tiếp xúc lâu hơn thì khả năng truyền bệnh lớn hơn. Bệnh phát sinh và gây hại hầu hết ở các vùng trong cả nước như: Hà Nội, Hải Phòng, Hải Dương, Hưng Yên, Bắc Ninh, Bắc Giang, Vĩnh Phúc, ... (Vũ Triệu Mân và Lê Lương Tề, 2001)[14]. Bệnh trên ruộng cà chua thường xuất hiện với những triệu chứng hỗn hợp do nhiều loại virus gây ra. Thường một cây có thể có tới 2 loại virus trở lên, có trường hợp có tới 4 – 5 loại virus. Trên những ruộng bệnh nặng rất khó tìm thấy một cây nhiễm riêng một loại virus. Tuy nhiên, thiệt hại nặng nhất vẫn là bệnh xoăn vàng ngọn cà chua (TYLCV) (Vũ Triệu Mân và Lê Lương Tề, 1999)[13]. Bệnh virus xoăn vàng ngọn ở nước ta là phổ biến, tỷ lệ bệnh cao hơn nhiều so với bệnh khảm lá dương xỉ và khảm vàng lá. Bệnh gây hại khá nặng trên đồng ruộng, cây cà chua bị bệnh virus xoăn vàng ngọn sẽ làm cho hoa và nụ bị rụng nhiều, quả xốp, khô nước, phẩm chất kém, năng suất thấp (Vũ Văn Hải, 2007). Để phòng trừ bệnh xoăn vàng ngọn cà chua, Bùi Văn Ích, Lê Trường, Nguyễn Thơ (1971) đã sử dụng thuốc Bi 58 diệt bọ phấn bằng cách phun định kỳ và tưới đã có hiệu quả. Theo Lê Trường và cộng tác viên (1971) dùng thuốc Wofatox hoặc Bi58 nồng độ 0.1% phun mỗi tuần từ khi trồng đến khi cây ra 5 chùm hoa đã hạn chế được tác hại của bọ phấn và bệnh xoăn lá. Vũ Triệu Mân và cộng sự (1993)[12] đã sử dụng biện pháp tổng hợp là phun thuốc kết hợp với nhỏ bỏ cây bệnh để phòng trừ bọ phấn và bệnh virus trên cà chua có hiệu quả rất cao. Trần Khắc Thi (1999) cho biết có thể sử dụng Mornitor và Nuvacron để phòng trừ bọ phấn. Nguyễn Văn Tuất và cộng sự, Phạm Văn Biên cho rằng sử dụng Trebon, Padan, Pegasus, Sherpa, Admire, Bassa cùng việc tỉa bỏ lá già để phòng trừ bọ phấn. Theo Lê Thị Liễu & Trần Đình Chiến (2004)[11], sau 2 năm nghiên cứu các tác giả khuyến cáo sử dụng thuốc Pegasus 500SC và dầu khoáng SK EN 99 nồng độ 0,1% và 0,2% đều trừ được bọ phấn ở thời kỳ ấu trùng, nhộng và trưởng thành. Trong hệ thống canh tác người ta có thể luân canh cà chua với những cây trồng bọ phấn tỏ ra không ưa thích như lúa, rau họ thập tự. Cho tới nay, người ta chưa phát hiện thấy gen kháng R chống lại begomovirus trên cây cà chua trồng (Lycopersicon esculentum). Tuy nhiên, một số gen kháng chống lại begomovirus đã được phát hiện thấy trên một số giống cà chua dại. Ví dụ gen Ty-1 được phân lập từ cây cà chua dại (Lycopersicon chilense) là một gen kháng trội không hoàn toàn. Ty-1 dường như tương tác với các protein chịu trách nhiệm di chuyển của virus để tạo tính kháng. Ty-1 đã được chuyển vào cà chua trồng để tạo giống kháng (Hà Viết Cường, 2008). Theo Bùi Xuân Đáng (2009), muốn diệt trừ bọ phấn, chúng ta có 2 cách là phun thuốc và dùng bẫy. Có thể phun loại thuốc ít độc nhất như xà phòng diệt trùng (Insecticide soap, Safe soap) hoặc với Malathion 50 hay Diazinon nhưng phải phun liên tiếp 4 lần, mỗi lần cách nhau một tuần lễ vì thuốc không diệt được ấu trùng trong vở trứng. Sử dụng bẫy dính có thể đề phòng được sự lây lan khắp nơi của bọ phấn. Bọ phấn ưa thích nhất là màu vàng sáng hay vàng chanh nên có thể treo những miếng giấy hay nhựa màu vàng có trét keo để thu hút bọ phấn. Ở nước ta, bọ phấn hại trên nhiều loại cây trồng và cây dại, chúng có thể phát triển quanh năm trên đồng ruộng. Vì vậy, phòng trừ bọ phấn cũng như phòng trừ bệnh virus xoăn vàng ngọn gặp nhiều khó khăn. Các biện pháp phòng trừ bệnh xoăn vàng ngọn cà chua đã được đưa ra như: nhổ bỏ cây bệnh, diệt cỏ dại là kí chủ của bọ phấn, luân canh với cây trồng không phải là kí chủ của bọ phấn, sử dụng thuốc hóa học phòng trừ bọ phấn. 3. ĐỐI TƯỢNG, ĐỊA ĐIỂM, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1. Đối tượng, vật liệu, địa điểm nghiên cứu 3.1.1. Đối tượng nghiên cứu - Virus xoăn vàng ngọn cà chua - Bọ phấn (Bemisia tabaci Genn.) 3.1.2. Vật liệu nghiên cứu - Mẫu bệnh trên cây cà chua thu ở Hải Phòng và vùng phụ cận - Côn trùng môi giới: bọ phấn trắng (Bemisia tabaci Genn.) - Nhà lưới trồng cách li, lồng nuôi bọ phấn, đĩa petri, bút lông, kẹp côn trùng, kính lúp. - Cặp mồi sử dụng trong phản ứng PCR + Cặp mồi chung DNA-A của begomovirus là BegoAReV1 & BegoAFor1 (Ha et al., 2006) BegoAReV1: 5’- ATHCCMDCHATCKTBCTiTGCAATCC*- 3’ BegoAFor1: 5’- TGYGARGGiCCiTGYAARGTYCARTC* - 3’ * Y (C/T), R (G/A), H (A/C/T), M (A/C), B (C/G/T), D(A/G/T), K (G/T) và i = inosine + Cặp mồi đặc hiệu ToLCVV (sản phẩm = 454 bp) Mồi xuôi dòng là ToLCVV-sp-F2 có trình tự: (vị trí 1245) 5’ GACCAGTCTGAAGGTGTGAGTTC 3’ (vị trí 1276) Mồi ngược dòng là ToLCVV-sp-R2 có trình tự: (vị trí 1683) 5’ ACTCAAGCTATAAAGAATACCTAGAC 3’ (vị trí 1708) + Cặp mồi đặc hiệu TYLCVNV (sản phẩm = 1386 bp) Mồi xuôi dòng là TYLCVNV-sp-F1 có trình tự: (vị trí 1094) 5’ TGTGTTACATATTCTGTGTTTTCC 3’ (vị trí 1117) Mồi ngược dòng là TYLCVNV-sp-R1 có trình tự: (vị trí 2456) 5’ AAATACATCAAAATCTGCAGAGAGC 3’ (vị trí 2480) + Cặp mồi đặc hiệu DNA-β của begomovirus BetaFor2 & BetaRev2 BetaFor2: 5’-TAGCTACGCCGGAGCTTAGCTCG-3’ BetaRev2: 5’-AAGGCTGCTGCGTAGCGTAGTGG-3’ Cặp mồi này khuếch đại cả phân tử DNA-β có kích thước 1300 – 1400 bp. Các hóa chất cần thiết, dụng cụ máy móc dùng trong phương pháp PCR. - Bẫy dính màu vàng 3.1.3 Địa điểm, thời gian nghiên cứu - Địa điểm nghiên cứu: + Các vùng trồng cà chua tại Hải Phòng và vùng phụ cận + Trung tâm Bệnh cây nhiệt đới – Trường Đại học Nông nghiệp Hà Nội - Thời gian nghiên cứu: từ tháng 12/2008 – tháng 6/2009 3.2. Nội dung nghiên cứu - Điều tra tình hình bệnh xoăn vàng ngọn cà chua tại Hải Phòng và phụ cận vụ xuân hè 2009 - Mô tả triệu chứng bệnh và giám định virus gây bệnh bằng phương pháp PCR - Tìm hiểu phương thức lan truyền và phạm vi ký chủ của virus gây bệnh xoăn vàng ngọn cà chua - Thử nghiệm phòng trừ môi giới truyền bệnh xoăn vàng ngọn cà chua bằng bẫy dính màu vàng - Xác định tính gây bệnh của TYLCVNV trên cà chua bằng kỹ thuật lây nhiễm Agroinoculation 3.3. Phương pháp nghiên cứu 3.3.1. Phương pháp điều tra diễn biến tỷ lệ bệnh và mật độ bọ phấn trên đồng ruộng - Điều tra tỷ lệ bệnh: Tiến hành điều tra theo TC10 TCN – 224 – 95 Hà Nội của Cục Bảo vệ thực vật [3]. Điều tra định kì 7 ngày/lần, trên mỗi giống điều tra theo phương pháp 5 điểm chéo góc, mỗi điểm điều tra 50 cây đối với ruộng lớn (trên 1 sào) và toàn bộ số cây đối với ruộng nhỏ (dưới 1 sào). - Điều tra diễn biến mật độ bọ phấn: Tiến hành điều tra theo 5 điểm chéo góc, mỗi điểm cố định 5 cây, điều tra ngẫu nhiên 20 lá/ điểm dải đều ở 3 tầng lá. + Chỉ tiêu theo dõi: * Tỷ lệ bệnh: Số cây bệnh TLB (%) = —————————— x 100 Tổng số cây điều tra * Mật độ bọ phấn: Tổng số bọ phấn điều tra MĐBP (con/lá) = ——————————— Số lá điều tra 3.3.2. Tiến hành thu mẫu nghiên cứu - Phương pháp thu mẫu: Mẫu thu đựng riêng trong từng túi có ghi đầy đủ các thông tin sau: + Tên mẫu + Địa điểm ruộng + Thời gian lấy mẫu + Đặc điểm triệu chứng bệnh + Tỷ lệ nhiễm bệnh xoăn vàng lá (ngọn) chung cả ruộng - Phương pháp bảo quản mẫu: có 2 phương pháp bảo quản mẫu + Phương pháp 1: Bảo quản khô Bước 1: Sấy mẫu ở nhiệt độ 40oC đến khi mẫu khá khô Bước 2: Mẫu được gói trong giấy mỏng nhằm ngăn cách hai silicagel và mẫu sau đó để trong túi, ống chứa hạt silicagel. Cần chú ý thay hạt silicagel (dựa vào sự thay đổi màu sắc của hạt khi chưa hút ẩm và khi không còn khả năng hút ẩm nữa) đến khi mẫu khô giòn. + Phương pháp 2: Bảo quản tươi Mẫu thu về được để nguyên trong túi giữ lạnh ở tủ - 20oC. Chú ý không đưa mẫu ra ngoài khi chưa sử dụng 3.3.3. Giám định virus gây bệnh bằng phương pháp PCR * Chiết tách DNA tổng số từ mẫu mô thực vật Có 2 phương pháp chiết DNA: - Phương pháp 1: DNA tổng số từ mô lá được chiết nhanh bằng kiềm (NaOH) theo phương pháp của Wang et al. (1993) như sau: Bước 1: Cho khoảng 50 mg mô lá vào tube 1,5 ml; tiếp tục cho 0,5 ml dung dịch NaOH 0,5M vào tube. Dùng chày nhựa nghiền nhuyễn mẫu lá. Bước 2: Hòa loãng dịch nghiền 50 lần với đệm Tris 0,1M; pH 8 (5µl dịch nghiền hòa loãng với 245 µl đệm Tris). Bước 3: Lưu trữ mẫu trong tủ lạnh – 20oC - Phương pháp 2: Chiết tách DNA tổng số bằng CTAB Bước 1: + Cho 0,1g mô lá tươi hoặc 0,02g mô lá khô vào tube 1,5ml + Cho 0,5ml đệm CTAB + βME đã ủ ở 60oC trong 10 phút vào tube. Dùng chày nhựa nghiền nhuyễn. + Ủ 10 phút ở 65oC sau đó để nguội ở nhiệt độ phòng Bước 2: + Cho 0,5 ml hỗn hợp (Chlorofom : isoamyl alcohol = 24 : 1) vào tube lắc đều. + Sau đó ly tâm 12.000/phút trong 10 phút; hút dịch trên của tủa sang một tube mới (0,35ml). Bước 3: + Cho tiếp thể tích tương đương 0,35 ml hỗn hợp (Chlorofom : isoamyl alcohol = 24 : 1) vào tube lắc đều + Ly tâm 10 phút, hút dịch trên của phần kết tủa san một tube mới (0,25 ml) Bước 4: + Cho một thể tích tương đương Propanol vào tube, lắc đều, để lạnh -20oC trong 10 phút + Ly tâm 10 phút, hút bỏ dịch trên, giữ lại cặn (DNA). Bước 5, 6: + Rửa cặn hai lần Ethanol 70o (0,7 ml/lần), đảo nhẹ, đổ hết Etol. Sau đó spin và dùng pipet hút hết ethanol thừa Bước 7: + Để khô cạn trong không khí ít nhất 30 phút Bước 8: + Hòa cặn trong 0,1 ml nước cất 2 lần và giữ ở -20oC * Tiến hành phản ứng PCR (Polymerase Chain Reaction) và điện di sản phẩm PCR - Chu trình phản ứng PCR + Thành phần của mỗi phản ứng PCR H2O : 18,75µl Buffer : 2,5µl dNTPs : 0,5µl Mồi F : 0,5µl Mồi R : 0,5µl MgCl2 : 1,5µl Taq (Fermantas): 0,25µl DNA : 0,5µl Tổng thể tích : 25µl + Quy trình thực hiện phản ứng PCR 94oC 5 phút x 1 94 oC 50 oC 72 oC 30 giây 35 giây 1 phút 35 giây x 35 72 oC 5 phút x 1 - Điện di sản phẩm PCR + Sản phẩm PCR được điện di trên gel agarose 1% được chuẩn bị bằng đệm TAE và chứa 0,5 mg/ml Ethidium bromide. + Gel được chạy trên thiết bị điện di là Mini-Sub Cell (Biorad) với đệm TAE ở điện thế 110V trong 30 – 40 phút. + Bản gel được kiểm tra dưới ánh sáng tử ngoại và được chụp lại bằng máy ảnh kỹ thuật số. 3.3.4. Xác định tính gây bệnh của TYLCVBV trên cà chua bằng kỹ thuật lây nhiễm Agroiculation và lây nhiễm bằng bọ phấn * Phương pháp Agroiculation: - Có 3 kỹ thuật agroinoculation chính là: + Thấm chân không + Tiêm trực tiếp vi khuẩn vào mô + Tưới trực tiếp dịch vi khuẩn vào đất. Chúng tôi sử dụng kỹ thuật tiêm trực tiếp dịch vi khuẩn vào mô: - Bước 1: Nuôi cây dòng vi khuẩn chứa cấu trúc xâm nhiễm trong 200ml môi trường LB lỏng chứa 3 loại kháng sinh (streptomicin 200µg/ml, refampicin 34µg/ml và kanamicin 100µg/ml) trong tủ nuôi cấy có lắc (250rpm/28oC/2ngày). - Bước 2: Ly tâm dịch vi khuẩn (3000g/ 5 phút) - Bước 3: Hòa cặn vi khuẩn với 5 ml môi trường LB chứa 3 loại kháng sinh trên. - Bước 4: Dùng kim tiêm tiêm dịch vi khuẩn vào chồi và 4 nách lá tiếp theo, mỗi vị trí tiêm 10µl. - Để đảm bảo cây không bị lây nhiễm bọ phấn, thí nghiệm được thực hiện tại nhà lưới trung tâm Bệnh cây nhiệt đới. Chuẩn bị tế bào E. coli tiềm năng Chuẩn bị môi trường - Môi trường LB lỏng 1 l 250 ml Cho các thành phần vào. Lên thể tích. Lắc cho tan. Hấp ở 121 oC/ 15 phút. (môi trường LB có thể là lỏng (không có agar) hoặc đặc (có agar), để rót ra đĩa Petri. Nếu bổ xung kháng sinh thì phải để môi trường nguội khoảng 55 oC. Trypton 10 g 2.5 g Yest extract 5 g 1.25 g NaCl 5 g 1.25 g Agar 15 g 3.75 g Trình tự 1. Lấy 1 tube XL1 blue (giữ trong tủ - 80o). Để trên khay đá khoảng 15 – 30 phút cho tan đông. 2. Dùng que cấy vi khuẩn, cấy vi khuẩn lên môi trường LB đặc (không chứa kháng sinh). Ủ qua đêm ở 37oC. 3. Cấy độ 4-5 khuẩn lạc XL1 blue vào tube chứa 5 mL LB lỏng chứa Tetracillin. Ủ tube qua đêm ở 37oC có lắc (phòng TN JICA). 4. Cho tất cả 5 ml dịch XL1 blue trên vào bình cỡ 500 ml chứa 200 ml SOB. Ủ bình ở 18°C với lắc mạnh 200 – 250 rpm cho tới khi OD600 = 0.6 5. Ly tâm dịch vi khuẩn ở 2500 g/ 4oC/10 phút. Loại dich trên tủa. Giữ lại cặn vi khuẩn. 6. Cho vào trong tube ly tâm chứa cặn vi khuẩn 80 ml TB lạnh. Hòa tan vi khuẩn. 7. Ly tâm giống bước 5. Loại bỏ dịch trên tủa, giữ lại cặn. 8. Cho tiếp 80 ml TB lạnh và lặp lại giống bước 6 và 7. 9. Hòa cặn vi khuẩn với 20 ml TB lạnh. 10. Bổ sung DMSO tới nồng độ 7% (9.3 ml dịch TB/vi khuẩn + 0.7 ml DMSO). 11. Cho 150 µl dịch competent cells vào tube 0.5 ml. Giữ các tube ở - 80oC * Phương pháp lây nhiễm bằng bọ phấn Bọ phấn được thả trên cây nguồn bệnh cho chúng chích hút một ngày sau đó chuyển sang cây khỏe được trồng trong nhà lưới dùng để lây nhiễm, mỗi loại gồm 10 cây, mỗi cây đặt trong một hộp. Ở mỗi hộp thả 10 con bọ phấn cho chúng truyền virus một ngày sau đó đưa ra khỏi hộp. * Chỉ tiêu theo dõi: + Quan sát mô tả triệu chứng. + Tỷ lệ nhiễm bệnh tính cho mỗi loại cây: Số cây biểu hiện triệu chứng TLCNB (%) = ———————————— Số cây lây bệnh + Thời kì tiềm dục (TKTD): tính từ lúc lây nhiễm cho tới khi cây biểu hiện triệu chứng (ngày). 3.3.5. Phương pháp bố trí thí nghiệm đồng ruộng - Địa điểm thí nghiệm: ruộng trồng cà chua ở xã Hồng Phong – An Dương – Hải Phòng - Bẫy dính màu vàng: kích thước 17,8 x 12,6 cm * Thí nghiệm 1: Xác định số lượng bẫy dính màu vàng trên một đơn vị diện tích trong phòng trừ bọ phấn - Thí nghiệm được bố trí theo kiểu RCB gồm 4 công thức và 3 lần nhắc lại - Công thức thí nghiệm: + Công thức 1: 2 bẫy/ 10 m2 + Công thức 2: 4 bẫy/ 10 m2 + Công thức 3: 6 bẫy/ 10 m2 + Công thức 4: 8 bẫy/ 10 m2 - Chỉ tiêu theo dõi: + Điều tra 2 ngày/lần: mật độ bọ phấn vào bẫy (con/bẫy) + Điều tra 7 ngày/lần: tỷ lệ bệnh (%) và mật độ bọ phấn (con/lá) * Thí nghiệm 2: Xác định thời gian thay bẫy dính màu vàng trong phòng trừ bọ phấn - Công thức thí nghiệm: + Công thức 1: Thay bẫy sau 2 ngày + Công thức 2: Thay bẫy sau 4 ngày + Công thức 3: Thay bẫy sau 6 ngày + Công thức 4: Thay bẫy sau 8 ngày - Chỉ tiêu theo dõi: + Mật độ bọ phấn vào bẫy (con/bẫy) + Điều tra 7 ngày/lần: tỷ lệ bệnh (%) và mật độ bọ phấn (con/lá) * Phương pháp xử lý số liệu: Số liệu được xử lý bằng chương trình Excel và phân tích bằng IRRISTAT 4.0. 4. KẾT QUẢ VÀ THẢO LUẬN 4.1 Mô tả triệu chứng bệnh do virus gây ra trên cà chua vụ xuân hè 2009 tại Hải Phòng và vùng phụ cận Kết quả nghiên cứu của Tạ Thu Cúc (1971) đã khẳng định ở vùng đồng bằng sông Hồng có thể gieo trồng thêm một vụ cà chua trái vụ (gọi là cà chua xuân hè) cùng tồn tại với cà chua đông có truyền thống lâu đời. Cà chua xuân hè đã được thử nghiệm trong sản xuất mấy thập kỷ và trở thành vụ cà chua chính trong năm, sau vụ cà chua đông xuân. Ưu điểm của thời vụ này là đáp ứng được nhu cầu của người tiêu dùng vào những ngày nắng nóng, oi bức của mùa hè, giá bán cao, có lợi cho người sản xuất. Vụ xuân hè với điều kiện nhiệt độ, ẩm độ, ánh sáng thuận lợi cho cây trồng sinh trưởng phát triển thì đồng thời cũng tạo điều kiện cho sâu bệnh gây hại và phát triển mạnh. Cà chua cũng là một trong số những loại cây bị sâu bệnh gây hại mạnh. Trong phạm vi đề tài, chúng tôi đặc biệt quan tâm tới các loại virus hại cà chua. Đối với bệnh virus thực vật, một loài virus có thể gây hại trên nhiều loài cây khác nhau với nhiều triệu chứng khác nhau. Trên một loài cây, triệu chứng bệnh biểu hiện cũng khác nhau. Trên cây cà chua có rất nhiều loại virus cùng phá hoại. Một loại virus có thể có nhiều triệu chứng tương đối giống nhau rất khó phân biệt. Tuy nhiên, một số loại virus gây hại cà chua có biểu hiện các tính chất tương đối đặc trưng. Xuất phát từ thực tế trên, trong quá trình điều tra theo dõi diễn biến bệnh virus gây hại trên cà chua vụ xuân hè 2009 chúng tôi đã phân biệt triệu chứng bệnh virus trên cà chua thành một số dạng chính: xoăn ngọn, khảm vàng, khảm lá dương xỉ, khảm lồi lõm. * Triệu chứng khảm vàng Triệu chứng bệnh có thể xuất hiện trong suốt thời kỳ sinh trưởng phát triển của cây nhưng triệu chứng bệnh đặc trưng từ giai đoạn ra hoa đến thu hoạch quả. Lá mới bị bệnh thường có vết khảm xanh vàng xen kẽ. Lá bị bệnh thường vàng từ gốc lá, lá hơi cong xuống. Quả trên cây bị bệnh thường nhỏ, bị khảm vàng loang lổ hoặc bị biến vàng đôi khi có vết đốm. Hình 4.1. Triệu chứng khảm vàng lá cà chua * Triệu chứng xoăn vàng ngọn Bệnh xoăn vàng ngọn xuất hiện từ giai đoạn cây con đến khi thu hoạch. Lá cây bị bệnh thường cong lõm và bị biến vàng từ mép lá vào trong. Triệu chứng điển hình thường quan sát thấy ở lá non gần ngọn. Ngọn lá non thường bị xoăn mạnh, có màu vàng, kích thước lá thường nhỏ hơn so với lá khỏe. Cây bị bệnh trước khi ra hoa làm cây không thể ra hoa, đậu quả. Cây nhiễm bệnh sau khi ra hoa kết quả thì hoa dễ bị rụng, quả nhỏ, chất lượng kém. Hình 4.2. Triệu chứng xoăn vàng ngọn cà chua * Triệu chứng khảm lá dương xỉ Triệu chứng này thường xuất hiện vào giai đoạn cà chua bắt đầu ra hoa. Cây nhiễm bệnh thường còi cọc. Lá trên ngọn bị biến dạng, mất thùy, chỉ còn gân lá dạng dương xỉ. Cây bị bệnh thường không có khả năng cho thu hoạch. Cây nhiễm bệnh vào giai đoạn đã ra hoa và hình thành quả thì thường bị rụng hoa, quả nhỏ và bị biến dạng. * Triệu chứng khảm lồi lõm Triệu chứng bệnh thường xuất hiện từ giai đoạn cây phân cành. Lá bị bệnh có màu hơi xanh, lồi lõm, lá giòn. Cây bệnh thường thấp, sinh trưởng phát triển kém, ít quả và quả nhỏ. Hình 4.3. Triệu chứng khảm lá dương xỉ Hình 4.4. Triệu chứng khảm lồi lõm 4.2 Các loại hình triệu chứng bệnh do virus gây hại cà chua vụ xuân hè 2009 tại Hải Phòng và vùng phụ cận Với các triệu chứng được phân loại ở trên, chúng tôi tiến hành đánh giá mức độ phổ biến của từng loại triệu chứng bệnh do virus gây ra với từng giai đoạn sinh trưởng phát triển của cây cà chua vụ xuân hè 2009 tại Hải Phòng và vùng phụ cận. Kết quả thu được như sau: Bảng 4.1. Các loại hình triệu chứng bệnh virus gây hại cà chua vụ xuân hè 2009 tại Hải Phòng và vùng phụ cận Giai đoạn sinh trưởng Tỷ lệ cây nhiễm các loại hình triệu chứng (%) Khảm vàng Khảm lồi lõm Khảm lá dương xỉ Xoăn ngọn Cây con 0,00 0,00 0,00 0,00 Phân cành 3,18 0,60 0,01 0,04 Ra hoa 6,34 2,58 0,27 1,12 Quả non 8,09 3,62 1,13 5,06 Thu hoạch 11,37 5,24 2,03 8,82 Hình 4.5. Tỷ lệ các loại hình triệu chứng bệnh virus gây hại cà chua vụ xuân hè 2009 tại Hải Phòng và vùng phụ cận Kết quả ở bảng 4.1 cho thấy ở giai đoạn cây con không thể hiện một loại triệu chứng nào. Các giai đoạn tiếp theo trên cây bắt đầu xuất hiện các loại triệu chứng: khảm vàng, khảm lồi lõm, khảm lá dương xỉ và xoăn ngọn. Triệu chứng khảm lá dương xỉ ở giai đoạn phân cành có tỷ lệ thấp nhất 0,01%. Triệu chứng khảm lá dương xỉ làm ảnh hưởng mạnh tới cây cà chua. Những lá thể hiện triệu chứng khảm lá dương xỉ lá bị thu hẹp làm ảnh hưởng tới quang hợp và ảnh hưởng trực tiếp tới năng suất, chất lượng cà chua. Giai đoạn phân cành tỷ lệ triệu chứng khảm vàng cao nhất 3,18%; lá cây bắt đầu xuất hiện những đốm màu vàng. Triệu chứng khảm lồi lõm và triệu chứng xoăn ngọn bắt đầu xuất hiện với tỷ lệ thấp; triệu chứng khảm lồi lõm xuất hiện với tỷ lệ là 0,60%, triệu chứng xoăn ngọn là 0,04%. Tỷ lệ các loại triệu chứng tăng dần theo các giai đoạn sinh trưởng phát triển của cây cà chua. Ở giai đoạn ra hoa, tỷ lệ triệu chứng khảm lá dương xỉ vẫn ở mức thấp nhất là 0,27%. Tỷ lệ triệu chứng khảm vàng cao nhất là 6,34%; các đốm màu vàng lan rộng dần ra. Tỷ lệ triệu chứng khảm lá dương xỉ và xoăn ngọn vẫn ở mức thấp, triệu chứng lá dương xỉ có tỷ lệ là 0,27% và triệu chứng xoăn ngọn là 1,12%. Khi cây đã lớn, tán lá phát triển rộng làm lá cây bệnh và cây khỏe va chạm vào nhau kết hợp với sự chăm sóc như làm cỏ, xới xáo, làm giàn … đã làm tăng tỷ lệ bệnh do làm tăng sự truyền lan của các virus lan truyền theo kiểu tiếp xúc cơ học. Giai đoạn quả non, triệu chứng xoăn ngọn và triệu chứng khảm lá dương xỉ tăng nhanh. Tỷ lệ triệu chứng xoăn ngọn là 5,06%, tăng hơn 4 lần so với giai đoạn cây ra hoa. Tỷ lệ triệu chứng khảm lá dương xỉ là 1,13%, cũng tăng hơn 4 lần so với giai đoạn cây ra hoa. Triệu chứng xoăn ngọn giai đoạn này thể hiện rõ ràng hơn, ngọn lá non bị xoăn lại và có kích thước nhỏ hơn so với lá khỏe. Tỷ lệ triệu chứng khảm vàng và triệu chứng khảm lồi lõm tăng ít. Tỷ lệ khảm vàng giai đoạn quả non là 8,09% với những lá già gần gốc thể hiện triệu chứng rõ ràng các vết xanh vàng xen kẽ. Khảm lồi lõm với những lá hơi cứng, lồi lõm xuất hiện với tỷ lệ là 3,62%. Tỷ lệ các loại triệu chứng giai đoạn thu hoạch cũng tăng hơn so với giai đoạn quả non. Tỷ lệ triệu chứng khảm vàng là 11,37%; triệu chứng khảm lồi lõm là 5,24%; triệu chứng khảm lá dương xỉ là 5,03% và triệu chứng xoăn ngọn là 8,82%. Trong suốt giai đoạn sinh trưởng phát triển của cây cà chua vụ xuân hè 2009 tại Hải Phòng và các vùng phụ cận triệu chứng khảm vàng xuất hiện với tỷ lệ cao nhất, triệu chứng khảm lá dương xỉ xuất hiện với tỷ lệ thấp nhất, tỷ lệ triệu chứng xoăn ngọn cũng ở mức tương đối cao. 4.3 Tình hình bệnh xoăn vàng ngọn cà chua vụ xuân hè 2009 và khảo sát mật độ cỏ dại trên đồng ruộng tại Hải Phòng và vùng phụ cận Bệnh xoăn vàng ngọn hại cà chua khá phổ biến ở khu vực Đông Nam Á, các nước Trung Cận Đông và Đông Phi. Ở Việt Nam, bệnh được coi là tác nhân gây hại nghiêm trọng trên cà chua ở tất cả các vụ trong năm: xuân hè, đông sớm, đông chính, đông xuân và hè thu. Triệu chứng bệnh rất dễ phát hiện trên đồng ruộng. Cây bị bệnh các lá ngọn nhỏ, mép lá cong lên và xoăn lại, lá có dạng hình thìa. Lúc đầu phần thịt lá vàng, gân lá xanh, sau đó biến vàng toàn bộ lá. Toàn bộ phần ngọn xoăn vàng, mọc thẳng đứng, hơi giòn dễ gãy. Bệnh xuất hiện càng sớm trên đồng ruộng thì thiệt hại càng nghiêm trọng, làm cây cà chua chùn lại, thấp cây, phân nhiều nhánh, sau một thời gian cây sẽ chết, những cây còn sống thì thường không cho hoa, quả hoặc cho ít hoa quả và quả thường nhỏ. 4.3.1 Tình hình bệnh xoăn vàng ngọn cà chua vụ xuân hè 2009 tại Hải Phòng và vùng phụ cận Mức độ nhiễm bệnh xoăn vàng ngọn cà chua ở các khu vực trồng khác nhau là khác nhau nên chúng tôi đã tiến hành điều tra để tìm hiểu tình hình bệnh xoăn vàng ngọn cà chua ở Hải Phòng và một số vùng phụ cận. Kết quả thu được như sau: Bảng 4.2. Tỷ lệ bệnh xoăn vàng ngọn cà chua vụ xuân hè 2009 tại Hải Phòng và vùng phụ cận STT Địa điểm Giai đoạn sinh trưởng Tỷ lệ bệnh (%) 1 Hồng Phong – An Dương – Hải Phòng Ra hoa 2,4 2 Tú Sơn – Kiến Thụy – Hải Phòng Ra hoa 1,7 3 Kiến Thiết – Tiên Lãng – Hải Phòng Quả xanh 1,3 4 Dũng Tiến – Vĩnh Bảo – Hải Phòng Quả xanh 1,1 5 Phúc Thành – Kim Thành – Hải Dương Thu hoạch 0,8 6 Tam Kỳ - Kim Thành – Hải Dương Thu hoạch 2,1 Tất cả các vùng điều tra đều thấy xuất hiện bệnh nhưng với tỷ lệ thấp (từ 0,8% đến 2,4%). Tỷ lệ bệnh ở các vùng chủ yếu phụ thuộc vào cơ cấu giống cây trồng. Do sử dụng nhiều giống kháng bệnh xoăn vàng ngọn cà chua nên Phúc Thành – Kim Thành – Hải Dương có tỷ lệ bệnh khá thấp. Tại xã Tam Kỳ - Kim Thành – Hải Dương tỷ lệ lệ bệnh cao gần gấp 3 lần so với xã Phúc Thành – Kim Thành – Hải Dương nhưng do ruộng cà chua đang ở giai đoạn thu hoạch nên không ảnh hưởng nhiều tới năng suất. Cây nhiễm bệnh ở giai đoạn ra hoa và quả xanh như ở các xã tại Hải Phòng có thể gây ảnh hưởng nghiêm trọng tới năng suất cà chua. 4.3.2 Kết quả khảo sát mật độ cỏ dại trên đồng ruộng cà chua tại Hải Phòng và vùng phụ cận Cỏ dại trên đồng ruộng là một trong những nguồn bệnh gây hại trực tiếp tới cây trồng. Chúng tôi đã tiến hành điều tra mật độ bốn loài cỏ dại thường gặp trên ruộng cà chua là: rau dền cơm (Amaranthus lividus), rau muối (Chenopodium quinoa), cây tầm bóp (Physalis angulata) và cây nhọ nồi (Eclipta proschata). Làm cỏ là một trong những biện pháp canh tác có thể phòng trừ sâu bệnh hại cây trồng. Trên các ruộng điều tra, cùng với mỗi lần thăm đồng là mỗi lần làm cỏ nên mật độ cỏ dại trên ruộng cà chua nói chung còn thấp. Trên ruộng cà chua chủ yếu là rau dền cơm và rau muối, mật độ cây tầm bóp và cây nhọ nồi rất thấp. Ruộng cà chua tại xã Hồng Phong – An Dương – Hải Phòng có mật độ các loài cỏ dại cao nhất. Ngoài ra, dọc các đường mương tại xã An Dương còn có cây trinh nữ móc. Đây là loài cây sinh trưởng phát triển mạnh và là ký chủ của begomovirus. Kết quả điều tra mật độ 4 loài cỏ dại phổ biến trên ruộng cà chua được thể hiện ở bảng sau: Bảng 4.3. Mật độ một số cây cỏ dại chủ yếu trên ruộng cà chua tại Hải Phòng và vùng phụ cận Mật độ cây (cây/m2) Tên cây Tú Sơn – Kiến Thụy – Hải Phòng Hồng Phong – An Dương – Hải Phòng Phúc Thành – Kim Thành – Hải Dương Rau dền cơm (Amaranthus lividus) 0,7 0,9 0,5 Rau muối (Chenopodium quinoa) 0,5 0,7 0,4 Tầm bóp (Physalis angulata) 0,1 0,3 0,2 Nhọ nồi (Eclipta proschata) 0,2 0,1 0,1 Bệnh xoăn vàng ngọn cà chua được truyền qua bọ phấn Bemisia tabaci. Bọ phấn có phổ ký chủ rộng. Ngoài cỏ dại, một số loài cây trồng trên đồng ruộng như dưa hấu, dưa lê, dưa chuột, ớt, . . . cũng là ký chủ của bọ phấn. 4.4 Mối quan hệ bọ phấn (Bemisia tabaci) và bệnh xoăn vàng ngọn cà chua vụ xuân hè 2009 tại Hải Phòng và vùng phụ cận Bọ phấn Bemisia tabaci là môi giới truyền virus gây bệnh xoăn vàng ngọn cà chua. Chúng thường đẻ trứng ở mặt dưới của lá, bọ phấn non tuổi 1 di chuyển xuống mặt dưới lá cố định tại một điểm để chích hút dịch cây cho tới khi vũ hóa thành bọ phấn trưởng thành. Bọ phấn trưởng thành thường ẩn nấp ở mặt dưới của lá, khi có động chúng thường bay sang ngọn cây khác. Trên đồng ruộng chúng tôi thấy sự phát triển của bệnh xoăn vàng ngọn cà chua có mối quan hệ với mật độ bọ phấn. Để góp phần vào công tác nghiên cứu xác định quy luật phát sinh phát triển của bệnh chúng tôi đã tiến hành điều tra diễn biến bệnh xoăn vàng ngọn hại cà chua và mật độ bọ phấn. 4.4.1 Diễn biến bệnh xoăn vàng ngọn và mật độ bọ phấn trên cà chua vụ xuân hè 2009 tại xã Tú Sơn – Kiến Thụy – Hải Phòng Chúng tôi tiến hành điều tra mật độ bọ phấn Bemisia tabaci và tỷ lệ bệnh xoăn vàng ngọn trên hai giống cà chua P 375 và Mec 89. Đây là hai giống được trồng khá rộng rãi, cho năng suất cao, mẫu quả đẹp và có khả năng kháng nhiều loại sâu bệnh. Trong quá trình điều tra các hộ nông dân cho biết bệnh xoăn vàng ngọn cà chua là bệnh gây hại nặng trong mỗi vụ cà chua, đồng thời họ cũng biết giống P 375 là giống cà chua bị nhiễm bệnh nặng hơn so với những giống cà chua khác trồng tại Tú Sơn – Kiến Thụy – Hải Phòng. Kết quả điều tra được thể hiện qua bảng sau: Qua số liệu của bảng trên có thể thấy cả hai giống cà chua P 375 và Meg89 đều nhiễm bệnh xoăn vàng ngọn. Tuy nhiên, bệnh chỉ xuất hiện từ giai đoạn phân cành, giai đoạn cây con cả hai giống đều chưa thấy xuất hiện bệnh xoăn vàng ngọn. Ngay từ giai đoạn phân cành tỷ lệ bệnh giữa hai giống đã có sự khác biệt khá rõ rệt, tỷ lệ bệnh trên giống P 375 là 2,4%, cao gấp 3 lần so với giống Meg 89. Vào giai đoạn thu hoạ._.

Các file đính kèm theo tài liệu này:

  • docCHBVTV09006.doc
Tài liệu liên quan