Khóa luận Nghiên cứu begomovirus trên ớt và cà chua ở khu vực Miền Trung và Miền Nam Việt Nam

LỜI CẢM ƠN Trong suốt quá trình làm thực tập ngoài nỗ lực của bản thân tôi đã nhận được rất nhiều sự giúp đỡ tận tình từ các cá nhân và tổ chức. Trước tiên, tôi xin bày tỏ sự biết ơn sâu sắc tới TS. Hà Viết Cường – Giám độc trung tâm nghiên cứu Bệnh cây nhiệt đới – trường Đại học Nông nghiệp Hà Nội, Phó khoa Nông học đã trực tiếp hướng dẫn, dẫn dắt, tận tình chỉ bảo và tạo mọi điều kiện để tôi hoàn thành báo cáo này. Tôi xin gửi lời cảm ơn chân thành nhất đến cán bộ, công nhân viên thuộc Trun

docx69 trang | Chia sẻ: huong20 | Ngày: 12/01/2022 | Lượt xem: 338 | Lượt tải: 0download
Tóm tắt tài liệu Khóa luận Nghiên cứu begomovirus trên ớt và cà chua ở khu vực Miền Trung và Miền Nam Việt Nam, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
g tâm Bệnh cây nhiệt đới - Trường Đại học Nộng nghiệp Hà Nội đã nhiệt tình giúp đỡ và tạo điều kiện cho tôi làm việc trong suốt quá trình thực tập tại Trung tâm. Đồng thời tôi cũng xin bày tỏ sự biết ơn chân thành tới các Thầy giáo, Cô giáo trong bộ môn Công nghệ sinh học thực vật cũng như các thầy cô trong khoa Công nghệ sinh học, trường Đại học Nông nghiệp Hà Nội đã nhiệt tình dạy dỗ, chỉ bảo tôi trong suốt thời gian tôi học tập ở trường. Cuối cùng tôi xin cảm ơn tới gia đình, người thân các anh chị em và bạn bè đã giúp đỡ, động viên tôi trong suốt quá trình học tập cũng như hoàn thành báo cáo tốt nghiệp này. Tôi xin chân thành cảm ơn! DANH MỤC TỪ VIẾT TẮT Ký hiệu Từ viết tắt A. tumefaciens Agrobacterium tumefaciens AS Acetosyringone ATP Adenosine triphosphate Bb Base pair CP Capsid protein CTAB Cetryl Ammonium Bromide ddNTP Dideoxynucleoside triphosphate DNA Deoxyribonucleic acid dNTP Deoxynucleoside triphosphate dsDNA Double strand DNA E.coli Escherichia coli EDTA Ethylene diamine tetra acetic acid ICTV International Committee on Taxonomy of Viruses IR Itergenic region Kb Kilo base LB Luria and Bertani ORF Open reading frame PCR Polymerase Chain Reaction RCA Rolling circle amplification RE Restriction enzyme Rep Replication protein RNA Ribonucleic acid Rnase Ribonuclease SDS Sodium Dodecyl Sulphate SsDNA Singe strand DNA TAE Tris – acetate – EDTA Taq Thermus aquatic Vir Virulence region β- ME Beta- Mercaptoethanol TÓM TẮT Trong nghiên cứu này chúng tôi tiến hành nhân dòng và giải trình tự toàn bộ bộ gen của mộtbipartite begomovirus, được cho là chưa từng được phát hiện ở Việt Nam gây hại trên cây ớt đã được Nguyễn Đức Anh phân lập năm 2013. Kết quả là toàn bộ bộ gen của mẫu begomovirus đã được nhân dòng thành công vào tế bào E.coli chủng XL1-Blue. Chúng tôi cũng đã giải trình tự và thu được toàn bộ bộ gen của mẫu virus với kích thước khoảng 2.7 kb. Chúng tôi tiến hành nghiên cứu về begomovirus trên ớt và cà chua ở miền Trung và miền Nam Việt Nam, begomovirus mới gây bệnh xoăn vàng lá trên ớt ở hai vùng này. Nhân dòng thành công và giải được bộ gen DNA-A của virus này, thông qua phân tích trình tự, đặc trưng phân tử và phả hệ cho thấy đây là 1 loài mới thuộc chi Begomovirus gây hại trên ớt và được chúng tôi đặt tên là Chilli leaf curl virus (CLCV). ĐẶT VẤN ĐỀ Giới thiệu Họ Geminiviridae là họ virus thực vật lớn nhất, có khoảng 200 loài(Fauquet và Stanley, 2005).Trong đó begomovirus là chi lớn nhất và quan trọng nhất trong họ Geminiviridae cả về số lượng loài và bệnh do chúng gây ra với cây trồng.Begomovirus(được đặt tên từ Bean golden mosaic virus) có hình thái phân tử dạng hình cầu kép (hình chùy) và bộ gen DNA sợi vòng đơn, kích thước khoảng 2,7 kb (Fauquet và Stanley, 2005), lan truyền trên đồng ruộng bằng bọ phấn (Bemisia tabaci) theo kiểu bền vững tuần hoàn. Begomovirus có thể có bộ gen đơn (gồm một phân tử DNA-A) hoặc có bộ gen kép (gồm hai phân tử DNA-A và DNA-B). Ở một số loại cây chỉ cần phân tử DNA-A đã gây triệu chứng điển hình, còn ở một số loại cấy khác thì cần có cả phân tử DNA-A và DNA-B mới gây ra triệu chứng bệnh. Gần đây, một loại phân tử DNA vòng đơn nữa, có kích thước khoảng 1 nửa bộ gen begomovirus thường được phát hiện thấy có liên quan với nhiều bệnh do begomovirus gây ra và được gọi là các DNA-β. Các phân tử DNA-β này phụ thuộc vào begomovirus để nhân lên và do đó được xem là các phần tử vệ tinh của begomovirus. Vai trò của phân tử DNA-β trong hình thành triệu chứng bệnh không thống nhất, một số begomovirus chỉ có thể tạo ra triệu chứng bệnh với sự có mặt của phân tử DNA-β trong khi các loài khác lại không cần. Do đó việc phòng trừ bệnh xoăn vàng lá càng trở nên khó khăn hơn. Nhiều bệnh nghiêm trọng trên cây trồng được xác định là do begomovirus gây ra như bệnh xoăn vàng lá cà chua – một bệnh được xem là nguy hiểm nhất trên cà chua khắp thế giới(Moriones và cộng sự, 2007). Hiện nay, có tới 50 begomovirusphân lập từ cà chua (có từ tomato ở đầu tên virus) đã được công bố trên thế giới (Fauquet và cộng sự, 2008). Trên cây cà chua, các begomovirus tạo triệu chứng giống nhau, điển hình là: cuốn lá (cong lại hình thìa); mép lá (đặc biệt ở lá non) biến vàng; lá nhỏ hẹp; cây nhiễm sớm còi cọc với tỷ lệ đậu quả rất thấp. Danh tính virus chỉ có thể được xác định dựa vào các phân tích phân tử (Moriones và Navas-Castillo, 2000). Việt Nam được chứng minh là trung tâm đa dạng quan trọng của begomovirus(Ha, 2007). Mặc dù vậy số lượng loài begomovirus xác định trên thực vật của Việt Nam vẫn còn ít chỉ gồm 19 loài được phân lập từ nhiều loài cây, trong đó có nhiều cây dại(Green và cộng sự, 2001),(Ha, 2007).Theo điều tra hiện nay, bệnh do begomovirus gây hại trên diện rộng và không chỉ gây bệnh trên cà chua, chúng còn gây bệnh trên nhiều loài cây khác như ớt, họ đậu đỗ, đu đủ, bầu bí.... Chính vì vậy chúng tôi tiến hành đề tài: “ Nghiên cứu begomovirus trên ớt và cà chua ở khu vực Miền Trung và Miền Nam Việt Nam” Mục tiêu và yêu cầu của đề tài Mục tiêu Giải trình tự mẫu virus mới được phân lập Phân tích đặc trưng phân tử của các mẫu virus trên ớt và cà chua ở miền Trung và miền Nam Việt Nam. Yêu cầu Nhân dòng, giải trình tự và phân tích các đặc trưng phân tử mẫu virus đã được Nguyễn Đức Anh phân lập trên ớt ở Đà Nẵng năm 2013. Đánh giá tính gây bệnh thông qua lây nhiễm nhân tạo nhờ vi khuẩn A. tumefaciens (Agroinoculation). Chuẩn đoán begomovirus trên ớt và cà chuavới các mẫu thu được tại khu vực miền Trung và miền Nam Việt Nam sử dụng cặp mồi chung phát hiện begomovirus là BegoA-For1 và BegoA-Rev1. Chọn lọc các mẫu dương với BegoA để kiểm tra với các mồi đặc hiệu đã được xác định như mồi ToLVHnV (F1/R2); TB101 (F1/ R2); VB65 (F1/R1); TY (F4/R4);To (F4/R4); To100(F1/R1); TYKa-A (F1/R1), VNP93A (F1/R1), VNP93B (F1/R1) Nhân dòng và giải trình tự các mẫu virus trên ớt và cà chua đã được chọn, bước đầu định danh các virus. TỔNG QUAN TÀI LIỆU Những nghiên cứu nước ngoài Tầm quan trọng của ớt và cà chua Ớt  là một loại quả của các cây thuộc chi Capsicum của họ Cà (Solanaceae). Ớt có nguồn gốc từ châu Mỹ, ngày nay nó được trồng khắp nơi trên thế giới và được sử dụng làm gia vị, rau, và thuốc. Hiện nay, Ấn Độ là nước sản xuất ớt lớn nhất thế giới với khoảng 1 triệu tấn mỗi năm, nơi chỉ riêng Chợ Guntur (lớn nhất châu Á) có 1 triệu bao ớt. Cà chua (S.lycopersicum) có nguồn gốc từ Nam Mỹ, nó được người Tây Ban Nha lan truyền tới Pilippine, Đông Nam Á và toàn bộ Châu Á, cuối cùng là Châu Âu. Cà chua là loài trái cây vườn phổ biến nhất ở Hoa Kỳ. Khoảng 150 triệu tấn cà chua đã được sản xuất ra trên Thế giới trong năm 2009. Trung Quốc là nước sản xuất cà chua lớn nhất, chiếm khoảng một phần tư sản lượng toàn cầu, tiếp theo là Hoa Kỳ và Ấn Độ. Các khu vực chế biến tại California chiếm 90% lượng sản xuất ở Mỹ và 35% lượng sản xuất thế giới (Hartz và cộng sự, 1997). Những nghiên cứu về bệnh virus hại cây họ cà Lịch sử bệnh xoăn vàng lá cà chua Bệnh xoăn lá cà chua được ghi nhận đầu tiên trên thế giới từ cuối những năm 40 tại Israel. Các vụ dịch bệnh đã xuất hiện rải rác vào những năm 60, trở thành nghiêm trọng vào đầu những năm 70 khi thiệt hại năng suất có thể đạt 100 %. Vào cuối những năm 70, tất cả các vùng trồng cà chua tại Trung Đông đã bị nhiễm bệnh. Bệnh đã được báo cáo tại vùng Đông Nam Á (Thái Lan và Đài Loan) châu Phi và Châu Âu vào những năm 80. Bệnh lần đầu tiên được công bố tại Châu Mỹ vào năm 1993. Hiện nay, bệnh xoăn vàng lá đã trở thành bệnh virus quan trọng nhất trên cây cà chua khắp thế giới(Picó và cộng sự, 1996; Ghanim và cộng sự, 2001; Moriones và cộng sự, 2007). 2.2. Tình hình nghiên cứu bệnh xoăn vàng lá 2.3. Đặc điểm của Begomovirus gây bệnh xoăn vàng lá 2.3.1. Phân loại chi Begomovirus Việc phân loại virus gây bệnh được chẩn đoán theo Uỷ ban Quốc tế về Phân loại Virus (International Committee on Taxonomy of Viruses – ICTV) dựa vào đặc điểm cấu tạo, hình thái của virus cũng như mối quan hệ huyết thanh và các đặc tính khác như đặc điểm lan truyền, lây nhiễm, phạm vi kí chủ đặc biệt là các đặc điểm của DNA. Tên gọi của virus hại thực vật quy định dùng tiếng Anh bao gồm tên của cây kí chủ chính, triệu chứng bệnh trên cây kí chủ đó và cuối cùng là từ virus. Ví dụ: virus gây bệnh khảm thuốc lá - Tobacco mosaic virus - viết tắt là TMV. Nghiên cứu hệ thống phát sinh có thể chia begomovirus ra làm hai nhóm chính là nhóm Tân thế giới (New world) bao gồm Châu Mỹ và nhóm Cựu thế giới (Old world) là khu vực bán cầu đông bao gồm châu Âu, châu Phi, châu Á(Rybicki, 1994; Padidam và cộng sự, 1999). Các begomovirus của hai nhóm tân thế giới và cựu thế giới được phân biệt nhau bởi đặc điểm bộ gen. Tất cả các begomovirus ở cụm Tân thế giới đều có bộ gen kép, trong khi đó các begomovirus ở cụm Cựu thế giới có cả bộ gen đơn và kép, thêm vào đó tất cả các begomovirus của cụm Cựu thế giới có thêm một gen AV2 trên DNA-A, gen này không tồn tại ở các virus của cụm Tân thế giới (Rybicki, 1994). Begomovirus ở cụm Tân thế giới có chuỗi PWRsmaGT ở đầu N trong vỏ protein (CP) mã hóa bởi gen AV1, chuỗi này không có mặt ở begomovirus của cụm Cựu thế giới (Harrison và cộng sự, 2002). Rybicki (1994) dự đoán rằng bọ phấn di chuyển từ Châu Á sang châu Mỹ có thể đã mang tổ tiên virus của cụm Tân thế giới mà chúng ta quan sát thấy ngày nay. Các virus này sau đó tiến hóa theo một hướng khác với các virus ở cụm Cựu thế giới. Gần đây dựa trên phân tích hệ thống phát sinh phát hiện ra rằng CoYVV ở Việt Nam không có ORF AV2 và có chuỗi PWRsmaGT ở đầu N trong protein vỏ (CP), virus này giống với cụm Tân thế giới hơn là cụm Cựu thế giới. Sự có mặt của CoYVV ở Việt Nam đã đưa ra giả thuyết rằng virus giống với cụm Tân thế giới có thể đã có mặt ở Cựu thế giới trước khi bị phân chia ở kỷ Gondwana (Ha và cộng sự, 2008). Hiện nay, việc phân loại begomovirus chủ yếu dựa trên so sánh trình tự của chuỗi phân tử DNA-A. Theo Fauquet et al.,2008, việc phân loại loài trong chi begomovirus tuân thủ một số tiêu chuẩn sau: Thành phần của genome có hay không có DNA-B Tổ chức bộ gen có hay không có gen AV2 Protein Rep không có khả năng tái bản trans trong thành phần bộ gen thì có thể ghi nhận loài mới. Tuy nhiên cần lưu ý rằng chỉ một thay đổi nhỏ ở vị trí liên kết với Rep có thể ngăn cản sự tương tác chức năng và sự tái tổ hợp của virus. Đặc điểm của protein vỏ. Mức độ tương đồng của trình tự aminoacid <90% thì ghi nhận là loài mới, tuy nhiên mức độ tương đồng nucleotide của toàn bộ bộ gen vẫn là cần thiết cho việc xác nhận phân loại virus 2.3.2. Hình thái của Begomovirus Các begomovirus gây bệnh xoăn vàng lá cà chua nói riêng và begomovirrus nói chung thuộc chi Begomovirus (họ Geminivirus). Các Geminivirus đều có cấu trúc phân tử (virion) tương tự nhau bao gồm 2 hình cầu 20 mặt (icosahedron), mỗi mặt là 1 tam giác đều với số đơn vị tam giác (T) trên mỗihình cầu đa diện kép (gemini). Do nối với nhau nên 2 hình cầu này không 2.1Hinh thái của begomovirus ( hoàn thiện dẫn tới trên mỗi hình cầu chỉ có 55 tiểu phần protein (protein vỏ) được xắp xếp thành 11 đơn vị hình thái, mỗi đơn vị gồm 5 tiểu phần protein (pentameric capsomer). Kết quả là toàn bộ phân tử có 110 tiểu phần và 22 đơn vị hình thái(Gafni và Epel, 2002; Zhang và cộng sự, 2010). 2.3.3. Cấu trúc genome của Begomovirus Begomovirus có bộ gen đơn có phân tử DNA-A hoặc bộ gen kép bao gồm hai phân tử DNA-A và DNA-B. Cấu trúc của DNA-A là tương tự nhau ở hai nhóm virus này. 2.3.3.1. Cấu trúc của phân tử DNA-A Cấu trúc của một DNA-A điển hình gồm có 6 ORF được sắp xếp theo hai chiều ngược nhau. Theo chiều kim đồng hồ có hai gen AV1 và AV2. Gen AV1(CP) mã hóa vỏ protein có chức năng lan truyền Begomovirus qua vector và nhập nhân tế bào. Gen AV2 mã hóa Protein có chức năng cảm ứng triệu chứng, di chuyển hệ thống và tích lũy DNA của virus. Ngược chiều kim đồng hồ gồm có 4 gen AC1, AC2, AC3, AC4. Trong đó, gen AC1(rep) mã hóa protein tái bản (Rep protein) có chức năng tái sinh và tương tác với Protein của ký chủ điều khiển chu kỳ tế bào. Gen AC2 (TrAP) mã hóa Protein hoạt hóa phiên mã có chức năng ức chế phản ứng phòng thủ cuả cây. Gen AC4 (Ren) mã hóa protein tăng cường tái sinh có chức năng tương tác với protein ký chủ điều khiển chu kỳ tế bào. Gen AC4 mã hóa protein có chức năng cảm ứng triệu chứng và di chuyển hệ thống (Ha và cộng sự, 2008). Hình 2.2. Cấu trúc phân tử DNA-A của Begomovirus ( 2.3.3.2. Cấu trúc của phân tử DNA-B. DNA-B của các begomovirus kép mã hóa cho 2 protein BV1 và BC1 cả hai protein này đều liên quan trong việc di chuyển của virus. BV1 là một protein con thoi:BV1 có chức năng như là một protein con thoi, nó có chức năng vận chuyển virus vào và ra khỏi tế bào, tuy vậy nó không liên quan đến việc nhập nhân của virus trong lúc xâm nhiễm, chức năng này được kiểm soát bởi CP. BV1 tương tác với BC1 trong việc di chuyển giữa các tế bào:Bắt đầu từ nhân BV1 tạo một phức hợp với ssDNA, phức hợp này đi ra tế bào chất và kết hợp với BC1 tạo thành phức hợp BV1 : ssDNA : BC1 sau đó di chuyển đến sợi liên bào và chuyển sang tế bào khác(Gafni và Epel, 2002).Vùng C cuối của BV1 Squash leaf curl virus (SqLCV) được xác định là yếu tố cần thiết cho sự tương tác với BC1. BC1 là một protein vận chuyển.Chức năng của BV1 giống như là một protein vận chuyển đã được làm rõ trong hai trường hợp sau: (1) BV1 của virus Bean dwarf mosaic virus (BDMV) đã làm tăng size exclusion limit (SEL) của sợi liên bào (Tice và cộng sự, 2000); (2) BV1 của Squash leaf curl virus (SqLCV) đã kích thích tạo ra các cấu trúc dạng ống bắt nguồn từ luới nội chất, các ống này làm cho virus dễ dàng di chuyển giữa các tế bào (VARMA và Malathi, 2003). Như đã được đề cập ở trên, BC1 tương tác với BV1 thông qua phức hợp BV1:BC1:ssDNA để vận chuyển virus giữa các tế bào (Gafni và Epel, 2002). BC1 có liên quan trong tính gây bệnh.Sự kết hợp của BC1 trong tính gây bệnh đã được chứng minh thông qua thí nghiệm chuyển gen. Thuốc lá và cà chua đã được chuyển gen BC1 của Tomato mottle virus (TMoV) và BDMV, lần lượt những đặc điểm điển hình của virus xâm nhiễm đã được nhận thấy. BV1 (NSP) DNA-B ~2.7kb CR CR=Common Region BC1 (MPB) Hình 2.3: Cấu trúc phân tử DNA-B của Begomovirus(Ha và cộng sự, 2008) 2.3.3.3. Đặc điểm của vùng IR Các đơn vị sao chép ngược nhau trên phân tử DNA-A và DNA-B cách nhau bởi vùng liên gen (itergenic region (IR)), ở hầu hết các trường hợp chúng chia sẻ 1 vùng lặp cao xấp xỉ 200 nucleotide, gọi là vùng chung (common region (CR)). Vùng CR có chứa một điểm bắt đầu tái bản (ori) có tổ chức bao gồm một cấu trúc thòng lọng (Stem-loop), cấu trúc này chứa một trình tự nuleotide bất biến ngắn TAATATTAC, tại vị trí T7-C8 cần cho việc cắt và nối DNA của virus trong quá trình tái bản. IR có một cấu trúc nhận biết đặc hiệu của virus đã được xác định nằm dưới cấu trúc stem-loop, nó chứa một motif được gọi là Interon(Argüello-Astorga và Ruiz-Medrano, 2001), cần thiết cho nhận biết và bám vào sợi DNA của virus để bắt đầu tái bản. Sự tái tổ hợp của virus phụ thuộc vào motif này. Các virus có chung motif ở vùng IR có khả năng tái tổ hợp với nhau. Mỗi một motif sẽ tương ứng với một trình tự đặc trưng trên đầu N (Interon related domain – IRD) của protein REP. 2.3.3.4. Cấu trúc của phân tửDNA-β. Một phân tử vệ tinh DNA dạng vòng đơn (DNA-β) đã được tìm thấy kết hợp với các begomovirus có bộ gen đơn xâm nhiễm trên các cây trồng và cây dại bao gồm bông (cotton), mướp tây (okar), dâm bụt (hibiscus), cây thục quỳ (hollyhock), cây đay cẩm quỳ (malvaceae), cây kim ngân (Caprifoliaceae), cây cà chua (tomato), cây thuốc lá (tobacco), và cây ớt (solanaceae), squash (Cucurbitaceae), cây hoa cúc và ageratum (Asteraceae)(Briddon, 2003)(Zhou et al., 2003). Phân tử DNA-β đã thu hút được sự chú ý kể từ khi (Briddon, 2003)chứng minh rằng triệu chứng điển hình trên cây ageratum (bệnh vàng gân trên cây ageratum) và cây bông (bệnh cuốn lá bông) chỉ có thể hình thành khi Ageratum yellow vein virus (AYVV) và Cotton leaf curl virus (CLCV) cũng được lây nhiễm với một phân tử DNA – β tương ứng. Phân tử DNA-β có bộ gen sợi vòng đơn với kích thước xấp xỉ 1350 nucleotide mang 3 vùng đặc trưng (Briddon, 2003). Vùng bảo thủ của vệ tinh (Satellite conserved region (SCR): Vùng này khoảng 200 nucleotide bao quanh cấu trúc stem-loop có mang một chuỗi trình tự ngắn TAT/ATATTAC đặc trưng của Nanovuruses và Geminiviruses và một vùng bảo thủ cao với trên 100 nucleotide đã được xác định nằm ở phía bên phải của đầu 5’ của stem-loop. Vùng bảo thủ này có rất nhiều GC xấp xỉ khoảng 70% (Briddon, 2003) Vùng giàu A (A rich region): Phân tử DNA-β chứa một vùng giàu A (đặc trưng 160-180 nucleotide có khoảng 60 % A) (Briddon, 2003). Vị trí được xác định nằm giữa nucleotide ±700 và ±1000 (Zhou et al., 2003). Có ý kiến rằng vùng giàu A này đã được thêm vào nhằm tăng thêm kích thước của chúng để trở thành có kích thước xấp xỉ kích thước ½ kích thước của bộ gen virus (Mansoor et al., 2003). Bằng cách này phân tử DNA-β có thể lắp ráp được thông qua cơ chế chọn lọc kích thước nghiêm ngặt trong phân tử virus. Vùng ngược nghĩa mã hóa: Phân tử DNA-β mang một khung đọc mở βC1 trên sợi phía bên phải của genome. Khung đọc mở này mã hóa 1 protein với kích thước đặc trưng (điển hình) 118 amino acids. Thông qua phân tích đột biến (Zhou et al., 2003) đã chứng minh sản phẩm βC1 có chức năng trong biểu hiện triệu chứng. Gần đây protein vệ tinh βC1 (Y10β) của virus Tomato yellow leaf curl China virus chủng Y10 (TYLCCNV-Y10) đã được chứng minh là có khả năng ngăn chặn phản ứng phòng thủ của cây (Cui et al., 2005). SCR=Satellite Conserved Region Hình 2.4: Cấu trúc của phân tử DNA-β ( 2.3.4. Tái sinh của Begomovirus Begomovirus tái sinh theo cơ chế vòng lăn (rolling circular mechanism). Cơ chế vòng lăn có thể được chia làm 2 pha và được thực hiện trong nhân tế bào ký chủ (Picó và cộng sự, 1996)P (1) Pha tổng hợp sợi DNA vòng đơn (bộ gen có mặt trong phân tử virus) thành sợi DNA vòng kép khi bộ gen virus được chuyển vào nhân tế bào. Như vậy sợi kép sẽ gồm một sợi virus và một sợi tương đồng virus. Pha này vẫn chưa được hiểu rõ. (2) Pha tái sinh theo cơ chế vòng lăn: Protein Rep (sau khi được tổng hợp) sẽ cắt sợi virus tại chuỗi bảo toàn TATATTAC. Nhờ vật liệu cũng như enzyme DNA polymearase của tế bào, sợi virus được tổng hợp liên tục trên sợi tương đồng virus. Protein Rep lại tiếp tục cắt sợi virus mới được tổng hợp tại chuỗi TATATTAC (cũng vừa mới được tổng hơp) thành một sợi virus hoàn chỉnh dưới dạng sợi đơn mạch thẳng. Protein Rep sau đó sẽ nối 2 đầu của mạch thẳng để tạo ra bộ gen virus sợi đơn mạch vòng hoàn chỉnh. 2.3.5. Tương tác và tái tổ hơp của Begomovirus Cây trồng ở vùng nhiệt đới và cận nhiệt đới thường bị nhiễm hai hoặc nhiều geminivirus (Harrison và cộng sự, 2002; Ribeiro và cộng sự, 2006; Briddon và cộng sự, 2008)(Harrison và cộng sự, 2002; Briddon, 2003; Ribeiro và cộng sự, 2006). Trong cây virus tương tác với nhau tạo ra phức hợp bệnh (complex disease) (Moriones và Navas-Castillo, 2000; Chakraborty và cộng sự, 2003). Kiểu tương tác đồng nhiễm bệnh của các virus (co-infection virus) tạo ra triệu chứng rõ rệt hơn khi quan sát ở cây bị từng loại virus riêng. Tương tác có thể là sự bổ trợ (complementation) hoặc tái tổ hợp. Tác dụng phối hợp giữa hai Geminivirus tái tổ hợp mới có thể xảy ra, và tạo ra nhiều triệu chứng hơn. Ví dụ như ở Cameroon, tái tổ hợp kép (double recombinant) được tạo thành khi đồng xâm nhiễm các isolate của African cassava mosaic virus, đã tạo ra nhiều triệu chứng hơn so với cây bị nhiễm từng isolate riêng. Một ví dụ khác là sự tái tổ hợp tự nhiên giữa hai begomovirus là TYLCSV và TYLCV (Tây Ban Nha), đã tạo ra virus khỏe hơn hai virus ban đầu (Moriones và Navas-Castillo, 2000). Tái tổ hợp được cho là đóng vai trò quyết định tới sự tiến hóa của virus, đặc biệt là ở quần thể Geminivirus, góp phần tạo nên sự đa dạng di truyền(Sarkar và Kulshreshtha, 1978). Tái tổ hợp của begomovirus có thể xảy ra ở mức độ chủng loài (Markham và cộng sự, 1996; Briddon, 2003) chi, và ngay trong cùng một họ (Jones, 2003) 2.3.6. Triệu chứng bệnh Bệnh xoăn vàng lá xuất hiện triệu chứng trong vòng 2-4 tuần sau khi nhiễm bệnh và phát triển đầy đủ triệu chứng trong vòng 2 tháng. Triệu chứng có thể thay đổi theo điều kiện môi trường, giai đoạn sinh trưởng và điều kiện sinh lý của cây tại thời điểm nhiễm bệnh(Picó và cộng sự, 1996). Do phải dựa hoàn to àn vào vật chất của tế bào thực vật để sinh sản, các virus đã phát triển mạnh trên cây non và tế bào non trong một cây. Ở các cây già cỗi, quá trình này sẽ chậm lại hay hầu như ngừng hẳn. Chính vì vậy, tuổi cây non và phần non của cây là nơi virus sinh sản rất mạnh. Các điều kiện ngoại cảnh như: nhiệt độ quá cao, thấp, độ pH của môi trường, ánh sáng, chế độ dinh dưỡng, chăm sóc. Một chất được nhiều nhà khoa học xác nhận có bản chất protein tan là interferon có thể sản sinh ra ở tế bào ký chủ khi virus xâm nhập. Với nồng độ thấp khoảng một phần triệu gram đã có khả năng ức chế sinh sản của virus. Chính vì những lý do trên bệnh virus không gây được tác hại huỷ diệt ngay mà thường gây thoái hoá. Sự huỷ diệt chỉ xảy ra khi điều kiện môi trường và cây bệnh thuận lợi cho virus sinh sản và lây nhiễm, như trong các trận dịch của bệnh lúa vàng lụi ở nước ta những năm 1960. Triệu chứng sớm nhất là lá cong xuống dưới vào phía bên trong. Về sau, lá không có hình dạng, nhỏ hẹp, biến vàng từ mép và chót lá lan vào giữa gân; lá cuốn cong lên phía trên thành hình thuyền; lá non biến vàng mạnh, giòn và nhỏ hẹp. Cuống lá có thể xoắn vặn. Cây lùn còi cọc, mọc nhiều cành nhánh nhỏ, đốt thân ngắn. Cây nhiễm sớm thường không ra quả do hoa bị rụng (Picó và cộng sự, 1996). Bệnh thường xuất hiện vào các vụ có thời tiết nóng như hè thu và xuân hè. Hình 2.6. Triệu chứng do Begomovirus gây ra trên ớt và cà chua (httpwww.avrdc.org) 2.3.7. Lan truyền của Begomovirus Virus lây lan bằng dịch cây, bằng tiếp xúc cơ giới và chủ yếu là do bọ phấn Bemisia tabaci chích hút từ cây bệnh rồi truyền sang cây khỏe theo kiểu bền vững tuần hoàn. Mật độ bọ phấn càng cao thì tỷ lệ cây bị bệnh xoăn lá càng nhiều. Bọ phấn dùng vòi chọc vào mô mạch dẫn để hút dịch cây từ mạch phloem. Virus được hút qua vòi, tới diều, thấm qua màng ruột vào xoang cơ thể, đạt tới tuyến nước bọt và cuối cùng vào ống nước bọt. Hình 2.7. Bọ phấn Bemisia tabaci 2.3.8. Thiệt hại kinh tế do Begomovirus gây ra Nhiều bệnh nghiêm trọng trên cây trồng đã được xác định là do begomovirus gây ra như bệnh bệnh xoăn vàng lá (ngọn) cà chua, một bệnh được xem là bệnh virus nguy hiểm nhất trên cà chua khắp thế giới (Moriones và Navas-Castillo, 2000)Các bệnh nguy hiểm tương tự là bệnh khảm lá sắn (Legg và Fauquet, 2004), bệnh cuốn lá bông (Briddon, 2003). Trong đó gây thiệt hại lớn nhất là bệnh xoăn vàng lá ngọn cà chua. Bệnh xoăn vàng lá cà chua gây thiệt hại lớn cả về năng suất và chất lượng. Bệnh đã trở thành bệnh virus quan trọng nhất trên cây cà chua khắp Thế Giới, đặc biệt vùng nhiệt đới và cận nhiệt đới (Picó và cộng sự, 1996). 2.3.9. Biện pháp phòng trừ Cho tới nay, người ta chưa phát hiện thấy gen kháng R chống lại begomovirus trên cây cà chua trồng (Lycopersicon esculentum). Tuy nhiên một số gen kháng chống lại begomovirus đã được phát hiện thấy trên một số giống cà chua dại. Như gen Ty1 được phân lập từ cây cà chua dại (Lycopersicon chilense) và là một gen kháng trội không hoàn toàn (Ha và cộng sự, 2008). Những năm gần đây công nghệ gen bước đầu được ứng dụng trong việc sản xuất giống kháng bệnh bằng biện pháp bắn gen, chuyển gen. Chương trình sản xuất giống cà chua kháng bệnh đã được bắt đầu từ cuối năm 1960 và được phát triển mạnh sau đó. Cơ sở của chương trình này là việc lai để chuyển gen kháng bệnh từ các loài cà chua dại sang loài cà chua trồng. Có từ 1-5 gen kháng bao gồm cả gen trội và gen lặn đã được công bố bởi (Picó và cộng sự, 1996). Năm 1998, Vidavski & Czosnek cho biết tính chịu được quyết định chủ yếu bởi gen trội còn tính kháng được quyết định bởi từ 2-3 gen lặn. Cơ chế RNA slencing cũng đã được ứng dụng để tạo ra giống kháng được begomovirus. Ở Việt Nam hiện nay Viện Di truyền Nông nghiệp đang tiến hành đề tài nghiên cứu về vấn đề này. Tuy nhiên, có một vấn đề gặp phải là RNA silencing là một cơ chế của cây chống lại virus thì virus cũng có cơ chế để chống lại sự silencing của cây. Người ta đã chứng minh bằng thực nghiệm rằng AC4 của begomovirrus có thể ức chế đường hướng RNA silencing của cây ký chủ trong tế bào chất. Biện pháp đang đươc áp dụng hiện tại để phòng bệnh do begomovirus gây ra là diệt trừ bọ phấn, biện pháp canh tác và sản xuất giống kháng bệnh.Sử dụng thuốc hoá học để trừ bọ phấn là một biện pháp đã được tiến hành và cho hiệu quả cao. Tuy nhiên việc sử dụng thuốc không chỉ gây ô nhiễm môi trường sống mà còn làm tăng tính kháng thuốc của bọ phấn.Chúng ta cũng có thể sử dụng biện pháp dùng bẫy dính màu vàng để thu hút bọ phấn trắng. Phương pháp RCA (rolling circle amplification ) Là phương pháp dùng để nhân một lượng lớn DNA dưới dạng các polymer theo cơ chế vòng lăn (tương tự như quá trình tái sinh của virus) nhờ một đoạn mồi ngẫu nhiên (Random hexamer), và enzyme phi 29 DNA polymerase hoạt động ở nhiệt độ 300C trong vòng 18 giờ để tổng hợp và kéo dài sợi mới có kích thước lên tới 10kb. Các sợi mới được hình thành lại trở thành đoạn khuôn để tổng hợp các sợi tiếp theo. Kỹ thuật xác định trình tự Những phương pháp xác định trình tự axit nucleic đang được sử dụng ngày nay đều dựa trên phương pháp của Frederick Sanger (1977), có cải tiến. Phương pháp này còn được gọi là phương pháp enzyme học hay phương pháp dideoxy. Trong phương pháp này, người ta sử dụng các nhân tố kết thúc đặc hiệu quá trình kéo dài AND khi tổng hợp. Nhân tố kết thúc là các 2,3 dideoxynucleosid triphosphat (ddNTP). Các ddNTP có thể kết hợp vào chuỗi DNA đang tổng hợp qua nhóm 5 triphosphat nhưng lại không thể tiếp tục kết hợp được với phân tử desoxynucleosid triphosphat tiếp theo. Do đó khi trộn lẫn lượng nhỏ dideoxynucleosid triphosphat với 4 loại desoxynucleosid triphosphat rồi tiến hành tổng hợp DNA nhờ DNA polymerase thì sẽ thu được một loạt các đoạn DNA được kết thúc đặc hiệu bởi gốc dideoxy nucleotit. Tiến hành 4 thí nghiệm tách rời, mỗi phản ứng bổ sung 1 loại dideoxy nucleotit khác nhau sẽ thu được các đoạn DNA có kết thúc bằng các dideoxy nucleotit khác nhau và hơn kém nhau 1 nucleotit. Chạy điện di các đoạn này rồi hiện hình chúng, ta có thể xác định trình tự của chuỗi DNA quan tâm. Kỹ thuật agroinoculation Kỹ thuật chuyển cấu trúc xâm nhiễm vào tế bào cây nhờ vi khuẩn A.tumerfaciens được gọi là agroinoculation. Kỹ thuật agroinoculation đòi hỏi phải thiết kế 1 cấu trúc xâm nhiễm bao gồm bộ gen virus (hoặc vệ tinh) được thiết kế chứa 2 nguồn gốc tái sinh (ori) ở 2 đầu và được nối vào 1 vị trí nằm giữa bờ trái và bờ phải của 1 vector nhị nguyên. Cấu trúc xâm nhiễm sẽ được biến nạp vào tế bào vi khuẩn A. tumerfaciens. Khi lây nhiễm, tế bào vi khuẩn sẽ tiếp xúc với tế bào cây ký chủ và các protein chức năng (nằm trên Ti plasmid) sẽ chuyển toàn bộ phần DNA nằm giữa bờ trái và bờ phải của cấu trúc xâm nhiễm vào nhân tế bào cây ký chủ và tổng hợp phần DNA này vào bộ gen tế bào cây ký chủ. Trong tế bào chuyển gen, gen Rep của virus sẽ được biểu hiện thành protein Rep. Protein Rep sẽ cắt bộ gen virus khỏi bộ gen tế bào cây tại vị trí đặc hiệu trên chuỗi ori và nối lại thành bộ gen virus nguyên vẹn. Bộ gen virus nguyên vẹn này sẽ thực hiện chức năng sinh học và gây bệnh. A: Agrobacterium tumefaciens. B: Agrobacterium genome. C: Ti Plasmid  : a: T-DNA , b: Vir genes , c: Replication origin , d: Opines catabolism genes. D: Plant cell. E: Mitochondria. F: Chloroplast. G: Nucleus Có 3 kỹ thuật agroinoculation chính là: (i) thấm chân không (lá cây được nhúng trong dung dịch vi khuẩn, được xử lý chân không để hút khí trong gian bào; vi khuẩn sẽ dễ dàng xâm nhập vào trong mô qua khí khổng khi áp suất trở lại bình thường); (ii) tiêm trực tiếp vi khuẩn vào mô; và (iii) tưới trực tiếp dịch vi khuẩn vào đất 2.7. Kỹ thuật RCA (Rolling Circle Amplification) Gần đây, một phương pháp nhân bản DNA mới dùng kỹ thuật RCA (Rolling Circle Amplification) đã được sử dụng để nhân các bộ gen DNA dạng mạch vòng. Kỹ thuật RCA dùng enzyme DNA polymerase của thực khuẩn thể Φ29, một enzyme có hoạt tính chuyển mạch (strand-displacement) rất cao, và mồi hexamer để nhân các phân tử DNA mạch vòng thành các multimer mạch thẳng (gồm nhiều bộ gen virus liên tiếp) (Hình 2.10) Sản phẩm RCA sẽ được cắt bằng enzyme cắt giới hạn thích hợp và được dòng hóa trong các vector dòng hóa thông thường. Đây là kỹ thuật hiện đang rất thông dụng trong nghiên cứu các virus có bộ gen DNA mạch vòng kể cả các begomovirus và vệ tinh (Inoue-Nagata và cộng sự, 2004; Haible và cộng sự, 2006; Knierim và Maiss, 2007). Hình 2.10. Cơ chế tái bản các phân tử DNA mạch vòng bằng kỹ thuật RCA (Rolling Circle Amplification) dùng hexamer và Φ29 polymerase DNA (Fujii và cộng sự, 2006) Kỹ thuật RCA đã được ứng dụng để thiết kế các cấu trúc xâm nhiễm của begomovirus. Sản phẩm RCA dạng multimers được cắt đơn bằng enzyme cắt giới hạn thích hợp trong điều kiện không triệt để để tạo ra nhiều sản phẩm monomer (1 bộ gen), dimer (2 bộ gen) và multimer (nhiều bộ gen). Chỉ các sản phẩm dimer được tinh chiết khỏi gel agarose và nối vào vector nhị nguyên Bằng cách đơn giản này, các cấu trúc xâm nhiễm của begomovirus có thể được tạo ra khá nhanh chóng (Inoue-Nagata và cộng sự, 2004; Knierim và Maiss, 2007; Ferreira và cộng sự, 2008; Wu và cộng sự, 2008; Wyant và cộng sự, 2011) VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1.Địa điểm, thời gian, đối tượng và vật liệu nghiên cứu 3.1.1. Đối tượng nghiên cứu Bảng 3.1: Các begomovirus gây bệnh xoăn vàng lá ớt được thu ở miền Trung Việt Nam. Ký hiệu Địa điểm, khu vực thu mẫu Đối tượng Triệu chứng VNP624 Túy Loan – Đà Nẵng ớt Begomovirus điển hình VNP626 Túy Loan – Đà Nẵng ớt Khảm vàng VNP628 Túy Loan – Đà Nẵng ớt Begomovirus điển hình VNP635 Điện Bàn – Quảng Nam ớt Begomovirus nhẹ VNP722 Vinh – Nghệ An ớt Cuốn lá ngọn VNP867 Túy Loan – Đà Nẵng ớt Begomovirus nhẹ VNP868 Hòa ...thiếtkế cặp mồi đặc hiệu phát hiện ChYLCV làVNP93A(F1/R1) và VNP93/97B (F1/R1) để phát hiện loài virus mới này. ·         Mồi xuôi VNP93-A-F: CATGCTAGTAATCCAGTGTATGC (996-1018) ·         Mồi ngược VNP93-A-R:  ATCTGCCAACGACGCATATGC (2194-2215) Kích thước sản phẩm: 1,2kb ·         VNP93/97-B-F: GTGATTCATGTTATACGCCTTCG (1363-1385) ·         VNP93/97-B-R: TCAATCGCTCTGCCTTCTCTC (2610-2622) Kích thước sản phẩm 1,2kbCho vào cái bảng nhé Bảng 4.5: Kết quả kiểm tra với mồi VNP93A và VNP93/97B STT ID Khu vực thu mẫu Đối tượng VNP93A (F1/R1) VNP93/97B (F1/R1) 2 VNP313 An Giang ớt - - 3 VNP319 An Giang ớt - - 4 VNP323 An Giang ớt - - 8 VNP624 Đà Nẵng ớt - - 9 VNP626 Đà Nẵng ớt - - 10 VNP628 Đà Nẵng ớt - - 11 VNP635 Quảng Nam ớt + + 12 VNP641 Bình Định ớt - - 13 VNP646 Bình Định ớt - - 14 VNP650 Bình Định ớt + + 15 VNP673 An Giang ớt + + 16 VNP675 Đồng Tháp ớt + + 17 VNP683 Đồng Tháp ớt - - 18 VNP687 Đồng Tháp ớt - - 19 VNP698 Đồng Tháp ớt + + 20 VNP701 An Giang ớt - - 21 VNP704 An Giang ớt - - 22 VNP717 Cần Thơ ớt - - 23 VNP718 Cần Thơ ớt - - 24 VNP722 Nghệ An ớt - - 27 VNP842 Lâm Đồng ớt + - 29 VNP855 Gia Lai ớt - - 37 VNP907 Đà Nẵng ớt - - Hình 4.5: Kết quả điện di chạy PCR với mồi VNP93A VNP635 à VNP650 à VNP673 à VNP675 à VNP698 à VNP842 à M (ladder 1kb) Hình 4.6: kết quả điện di chạy PCR với mồi VNP93/97B M à VNP635 à VNP650 à VNP673 à VNP675 à VNP698 à VNP842 (ladder 1kb) Từ kết quả trên cho thấy các mẫuthu được tại Lâm Đông, An Giang, Đồng Tháp, Quảng Nam, Bình Định dương tính với 2 cặp mồi phát hiện ChYLCV, chứng tỏ loài virus gây hại trên ớt tại những địa phương trên là giống với loài virus gây hại trên ớt tại Đà Nẵng. Tuy nhiên có mẫu VNP842 chỉ bắt cặp với mồi VNP93A mà không bắt cặp với mồi VNP93B, điều này đặt ra câu hỏi về vài trò của 2 phân tử DNA-A và DNA-B của virus này trong quá trình biểu hiện triệu chứng. Cả 6 mẫu này sẽ được chúng tôi nhân dòng và giải trình tự để đưa ra kết luận chính xác. Begomovirs trên cà chua tại miền Trung và miền Nam Việt Nam Kết quả chuẩn đoán begomovirus trên cà chua bằng phản ứng PCR Mục đích:Chúng tôi tiến hành kiểm tra các mẫu cà chua thu thập được tại miền Trung và miền Nambằng phản ứng PCR sử dụng cặp mồi chung phát hiện begomovirus là BegoA-F1 và BegoA-R1. Kết quả được trình bày ở bảng 4.6. Bảng 4.6: Các mẫu cà chua thu được ở miền Trung STT Ký hiệu Địa điểm, khu vực thu mẫu Kết quả kiểm tra Lần 1 Lần 2 1 VNP436 Diễn Châu – Nghệ An + + 2 VNP441 Diễn Châu – Nghệ An - - 3 VNP725 Vinh – Nghệ An + + (mờ) 4 VNP727 Diễn Châu – Nghệ An + (mờ) + 5 VNP893 Diễn Châu – Nghệ An - + 6 VNP894 Diễn Châu – Nghệ An - - 7 VNP895 Diễn Châu – Nghệ An - - 8 VNP896 Diễn Châu – Nghệ An - - 9 VNP897 Diễn Châu – Nghệ An + + 10 VNP898 Diễn Châu – Nghệ An - - 11 VNP899 Diễn Châu – Nghệ An + + 12 VNO900 Diễn Châu – Nghệ An + + 13 VNP901 Diễn Châu – Nghệ An - - 14 VNP902 Diễn Châu – Nghệ An - - 15 VNP903 Diễn Châu – Nghệ An - - 16 VNP904 Diễn Châu – Nghệ An - - 17 VNP905 Diễn Châu – Nghệ An + + 18 VNP906 Diễn Châu – Nghệ An - - Hình 4.7: Kết quả chạy điện di sản phẩm PCR với mồi BegoA các mẫu cà chua miền Trung Mà VNP425àVNP725à VNP727à VNP441à VNP896à VNP899àVNP900à VNP906à VNP893à VNP905 (ladder 1kb) Bảng 4.7: Các mẫu cà chua thu ở miền Nam STT Ký hiệu Địa điểm, khu vực thu mẫu Kết quả kiểm tra Lần 1 Lần 2 1 VNP310 Long Xuyên – An Giang + + 2 VNP326 Long Xuyên – An Giang - - 3 VNP820 Đan Dương – Lâm Đồng - - 4 VNP821 Đan Dương – Lâm Đồng - - 5 VNP822 Đan Dương – Lâm Đồng + + 6 VNP823 Đan Dương – Lâm Đồng - - 7 VNP843 Buôn ma thuật – Đăk Lăk + + 8 VNP844 Buôn ma thuật – Đăk Lăk + + 9 VNP845 Buôn ma thuật – Đăk Lăk - - 10 VNP846 Buôn ma thuật – Đăk Lăk - - 11 VNP847 Buôn ma thuật – Đăk Lăk - - 12 VNP848 Buôn ma thuật – Đăk Lăk - - 13 VNP857 Playku – Gia Lai - - 14 VNP862 Playku – Gia Lai + + 15 VNP863 Playku – Gia Lai - - 16 VNP864 Playku – Gia Lai - - 17 VNP865 Playku – Gia Lai - - 18 VNP866 Playku – Gia Lai - - Hình 4.8: Kết quả chạy điện di sản phẩm PCR với mồi BegoA các mẫu cà chua miền Nam M1à VNP901à VNP902à VNP903à VNP822à VNP823àVNP843àVNP844à VNP845à VNP846à VNP847àVNP848à VNP857à VNP863à VNP864à VNP865à VNP866à VNP821à VNP310à VNP326à VNP862à VNP820à VNP895àVNP895à VNP896à M2 (ladder 1kb) Phải có ảnh triệu chứng 4.3.1.2. Kết quả kiểm tra các mẫu cà chua sử dụng các mồi đặc hiệu với một số loại begomovirus được phát hiện tại VN tính đến năm 2013 Mục đích và phương pháp: Chúng tôi tiến hành kiểm tra các mẫu trên sử dụng các mồi đặc hiệu của một số begomovirus được phát hiện tại VN bao gồm ToLCHnV (F1/R1); TB101(F1/R1); VB65 (F1/R1); TY (F4/R4); To (F4/R4); To100 (F1/R1); TYKa-A (F1/R1)nhằm xác định những virus này có thuộc một trong những virus đã được phát hiện tại Việt Nam hay không. Kết quả kiểm tra được trình bày ở bảng 4.8. Bảng 4.8: Kết quả kiểm tra các mẫu cà chua với các cặp mồi đặc hiệu STT ID Khu vực thu mẫu Đối tượng TYKa-A (F1/R1) ToLCHnV (F1/R2) TB101 (F1/R1) VB65 (F1/R1) TY (F4/R4) To (F4/R4) To100 (F1/R1) 1 VNP310 An Giang Cà chua - - - - - - + 2 VNP326 An Giang Cà chua - - - - - - - 3 VNP436 Nghệ An Cà chua - - - - - - - 4 VNP441 Nghệ An Cà chua - - - - - - - 5 VNP725 Nghệ An Cà chua - - - - - - - 6 VNP827 Nghệ An Cà chua - - - - - - - 7 VNP843 Đăk Lăk Cà chua + (rõ) - - - - - + 8 VNP857 Gia Lai Cà chua - - - - - - - 9 VNP862 Gia Lai Cà chua + (mờ) - - - - - - 10 VNP893 Nghệ An Cà chua - - - - - - - 11 VNP897 Nghệ An Cà chua - - - - - - - 12 VNP899 Nghệ An Cà chua - - - - - - - 13 VNP900 Nghệ An Cà chua - - - - - - - 14 VNP905 Nghệ An Cà chua - - - - - - - Kết quả kiểm tra các mẫKiểm tra với mồi VNP93A (F1/R1) và VNP93B (F1/R1) Sau đó chúng tôi cũng tiến hành kiểm tra các mẫu này với cặp mồi mới được thiết kế Bảng 4.9: Kết quả PCA các mẫu cà chua với mồi VNP93A và VNP93/97BCho vào 1 bảng thôi, k cần nhiều bảng thế này đâu STT ID Khu vực thu mẫu Đối tượng VNP93A (F1/R1) VNP93/97B (F1/R1) 1 VNP310 An Giang Cà chua - - 2 VNP326 An Giang Cà chua - - 3 VNP436 Nghệ An Cà chua - - 4 VNP441 Nghệ An Cà chua - - 5 VNP725 Nghệ An Cà chua + - 6 VNP827 Nghệ An Cà chua - - 7 VNP843 Đăk Lăk Cà chua - - 8 VNP857 Gia Lai Cà chua - - 9 VNP862 Gia Lai Cà chua + - 10 VNP893 Nghệ An Cà chua - - 11 VNP897 Nghệ An Cà chua + - 12 VNP899 Nghệ An Cà chua - - 13 VNP900 Nghệ An Cà chua - - 14 VNP905 Nghệ An Cà chua - - Từ kết quả trên cho thấy một số mẫu cà chua bắt cặp với mồi VNP93A mà không bắt cặp với mồi VNP93B. Số còn lại thì không bắt 2 cặp mồi này. Nhân dòng và giải trình tự các mẫu virus trên ớt 4.2.3.1.Chuẩn bị vector pCAMBIA2300 Vector nhị nguyên được sử dụng để làm cấu trúc xâm nhiễm là vector pCAMBIA2300 được tạo ra bởi viện CAMBIA.pCAMBIA-2300 là vector cho chuyển gen thực vật và được sử dụng tốt trong thí nghiệm agroinoculation. Hình 4.9.Sơ đồ vector pCAMBIA2300 Vector pCAMBIA2300 dạng khô được bảo quản ở tủ -80 oCđược hòa loãng với nước và biến nạp vào E.coli chủng XL1-Blue sử dụng phương pháp sốc nhiệt và được cấy trải trên môi trường LB với tetracyline và kanamycine để chọc lọc các dòng mang cấu trúc xâm nhiễm. Sau khi ủ 18h ở 37oC thì có 200 khuẩn lạc đơn mọc trên môi trường LB với đặc điểm đặc trưng của E.coli ( màu trắng sữa, có viền bao quanh, bề mặt trơn). Một số khuẩn lạc đơn được chuyển qua nuôi lắc trong ống nghiệm, mỗi ống nghiệm có 5ml môi trường LB lỏng chứa tetracyline và kanamycine, nuôi lắc 200 rpm. Sau đó plasmid sẽ được tinh chiết bằng Purelink quick plasmid miniprep kit (Invitrogen), một lượng nhỏ sản phẩm minipreps sẽ được kiểm tra bằng PCR sử dụng cặp mồi đặc hiệu của vector pCAMBIA2300 là mồi pCAMseqF1 và pCAMseqR. Phản ứng PCR được thực hiện với điều kiện sau: khởi đầu biến tính ở 940C trong 4 phút; tiếp theo là 35 chu trình PCR (biến tính ở 940C trong 40 giây, gắn mồi ở 500C trong 35 giây và tổng hợp sợi ở 720C trong 1 phút 30 giây). Phản ứng được kết thúc với 5 phút ở 720C. Hình 4.10. Điện di sản phẩm PCR kiểm tra plasmid sử dụng cặp mồi pCAMseqF1/R Vector pCAMBIA2300 sau khi được tinh chiết và kiểm tra sẽ được mở vòng bằng enzyme Bam HI sau đó desphosphoryl hóa bằng alkaline phosphase và được tinh sạch bằng Purelink PCR purification kit (Invitrogen). Hình 4.11: Điện di sản phẩm khi mở vòngpCAMBIA 2300 bằng BamHI Phản ứng RCA nhân lên toàn bộ bộ gen của virus Chúng tôi tiến hành phản ứng RCA được thực hiện với 6 mẫu VNP635, VNP650, VNP673, VNP675, VNP698, VNP842 để nhân toàn bộ bộ gen của begomovirus dạng multimer sau đó xử lý sản phẩm để thu sản phẩm 3kb. Sau khi đã tối ưu hóa việc xử lý các sản phẩm RCA, chúng tôi tiến hành cắt hoàn toàn 6 mẫu trên với cả 3 loại enzyme là BamHI, PstI và E.coRI (kết quả thu được bảng 4.10, hình 4.12,hình 4.13 và hình 4.14):Thí nghiệm tối ưu hóa đâu, cho vào đây chứ Bảng 4.10: kích thước sản phẩm thu được sau khi cắt STT ID Địa điểm thu mẫu Kết quả cắt bằng các RE Bam HI E.co RI PstI 1 VNP 635 Đại An, Điện Bàn, Quảng Nam 2,7 2,7 2,7 ; 2,3 ; 0,7 2 VNP 650 Cát Lâm, Phù Cát, Bình Định 2,2 ; 0,7 2,7 2,7 3 VNP 673 Hòa An, Châu Thành, An Giang 2,7 2,3 ; 0,5 2,7 4 VNP 675 Hòa An, cao Lãnh, Đồng Tháp 2,7 2,3 ; 0,5 2,7 5 VNP 698 Ấp Tần Thuận, TT thanh Bình, Thanh Bình, Đồng Tháp 2,7 2,3 ; 0,5 2,7 6 VNP 842 Thạch Mỹ, Lâm Đồng 2,7 2,3 ; 0,7 2,3 ; 0,5 Hình 4.12: Cắt hoàn toàn sản phẩm RCA bằng EcoRI VNP842à VNP635à VNP650à VNP673à VNP675à VNP698à M (ladder 1kb) Hình 4.13: Cắt hoàn toàn sản phẩm RCA bằng BamHI Mà VNP635à VNP650à VNP673à VNP675à VNP698à VNP842 (ladder 1kb) Hình 4.14: Cắt hoàn toàn sản phẩm RCA bằng PstI Mà VNP635à VNP650à VNP673à VNP675à VNP698à VNP842 (ladder 1kb) Từ kết quả cắt hoàn toàn 6 mẫu bởi 3 loại enzyme chúng tôi chọn sử dụng enzyme BamHI để cắt hoàn toànLý do chọn Biến nạp cấu trúc xâm nhiễm vào E.coli chủng XL1-Blue khả biến Cắt lại 6 mẫu trên bằng BamHI thu băng ~3kb, sau đó thì băng 3kb được cắt ra khỏi bản gel agarose và tinh chiết bằng Accuprep gel purification kit (Bioneer) sau đó được nối vào vector pCAMBIA 2300 đã được mở vòng bằng enzyme T4 ligase (Fermentas).Sản phẩm nối sau đó sẽ được biến nạp vào E.coli XL1-Blue khả biến. Bảng 4.9: số clone thu được sau lần biến nạp đầu tiên Mẫu Số clone thu được trong lần biến nạp đầu tiên VNP635 3 VNP650 2 VNP673 3 VNP675 1 VNP698 4 VNP842 5 Sau khi đã thu được các clone thì chúng tôi tiến hành kiểm tra liệu đã có genome của virus được nối vào trong vector hay chưa.Có 2 phương pháp để kiểm tra đó là: Phản ứng PCR với cặp mồi BegoAFor1 và BegoARev1 hoặc là phản ứng cắt kiểm tra sản phẩm nối sử dụng enzyme cắt BamHI. Tất cả khuẩn lạc đơn sẽ được nuôi lắc 200 rpm trong 5ml LB lỏng cộng với kanamycine và tetracycline.Sau đó tinh chiết plasmid bằng phương pháp minipreps (Sambrook và cs.).Sau khi thu được plasmid chúng tôi tiến hành kiểm tra cả 14 clones bằng cách cắt bằng enzyme Bam HI để chắc chắn rằng có sản phẩm nối trong vector pCAMBIA2300. Bảng4.10 : Kiểm tra vector tái tổ hợp (miniprep) bằng BamHI Mẫu biến nạp Dòng (clone) Sản phẩm cắt bằng BamHi Kết luận sản phẩm nối VPN635 635-1 4.5 Do nối cả dimer vào vector 635-2 4.5 Do nối cả dimer vào vector 635-3 5.0 Do nối cả dimer vào vector VNP698 689-1 2.7 Do nối cả dimer vào vector 689-2 5.0 Do nối cả dimer vào vector 689-3 2.7 Đúng 689-4 - Do quá trình tinh chiết VNP650 650-1 - Tự nối 650-2 - Nhiễm tạp/tinh chiết? VNP673 673-1 - Tự nối 673-2 - Nhiễm tạp 673-3 - Nhiễm tạp/tinh chiết VNP675 675-1 - Do quá trình tinh chiết VNP842 842-1 2.7 Đúng 842-2 2.7 Đúng 842-3 2.7 Đúng 842-4 - Tự nối 842-5 - Tự nối Hình 4.14: Hình ảnh điện di sản phẩm cắt bằng BamHI của một số clone thu được sau khi biến nạp và XL1-Blue Mà VNP635(1)à VNP635(2)à VNP635(3)à VNP698(1)à VNP698(2)à VNP698(4) Hình 4.15: Điện di sản phẩm cắt một số clone thu được bằng BamHI MàVNP650(1)à VNP650(2)à VNP673(1)à VNP673(2)à VNP673(3)à VNP675(1)à VNP698(3)à VNP842(1)à VNP842(2)à VNP842(3)à VNP842(4)à VNP842(5) Từ kết quả trên chúng tôi quyết định chọn 2 clone VNP698(3) và VNP842(1) để giải trình tự nhằm định danh chính xác loài begomovirus trên 2 mẫu VNP689 và VNP842. Bảng 4.11: Bảng các clone và mồi sequencing STT Mã sequencing ID Clone Mồi 1 13D1ZAB039 VNP698 VNP-698-3 (A) pCAMBIASeqF 2 13D1ZAB040 VNP698 VNP-698-3 (A) pCAMBIASeqR 3 13D1ZAB041 VNP698 VNP-698-3 (A) VNP93-A-F 4 13D1ZAB042 VNP698 VNP-698-3 (A) VNP93-A-R 5 13D1ZAB043 VNP842 VNP-842-1 (A) pCAMBIASeqF 6 13D1ZAB044 VNP842 VNP-842-1 (A) pCAMBIASeqR 7 13D1ZAB045 VNP842 VNP-842-1 (A) VNP93-A-F 8 13D1ZAB046 VNP842 VNP-842-1 (A) VNP93-A-R TÀI LIỆU THAM KHẢO TÀI LIỆU TIẾNG VIỆT Hà Viết Cường (2010), Bệnh cây. NXB Đại học Nông nghiệp. Hà Viết Cường (2010), Công nghệ sinh học trong bệnh cây. Hà Viết Cường (2010), Virus. NXB Đại học Nông nghiệp. Vũ Triệu Mân (2003), Chẩn đoán nhanh bệnh hại thực vật, NXB Nông Nghiệp. Vũ Triệu Mân – Lê Lương Tề chủ biên (2001). Giáo trình Bệnh cây Nông Nghiệp. NXB Nông Nghiệp. Lê Lương Tề, Vũ Triệu Mân (1999), Bệnh vi khuẩn và virus hại cây trồng. NXB Giáo dục, Hà Nội. Nguyễn Thị Hà Uyên (2012). Xác định và đánh giá khả năng gây bệnh của một số begomovirus trên cây cà chua bằng phương pháp lây nhiễm nhân tạo dùng vi khuẩn Agrobacterium tumerfaciens. Trần Ngọc Tiệp (2010). Xác định và đặc trưng phân tử của một số virus thuộc chi Begomovirus (họ Geminiviridae). Báo cáo thực tập tốp nghiệp, chuyên ngành CNSH. Nguyễn Đức Anh (2012) .Nghiên cứu Mungbean yellow mosaic virus (MYMV) trên đậu xanh và begomovirus trên ớt tại miền Trung Việt Nam. TÀI LIỆU TIẾNG ANH 10. G. Argüello-Astorga and R. Ruiz-Medrano (2001). An iteron-related domain is associated to Motif 1 in the replication proteins of geminiviruses: identification of potential interacting amino acid-base pairs by a comparative approach. Archives of Virology 146(8): 1465. 11. R. Briddon, J. Brown, E. Moriones, J. Stanley, M. Zerbini, X. Zhou and C. Fauquet (2008). Recommendations for the classification and nomenclature of the DNA-β satellites of begomoviruses. Archives of virology 153(4): 763. 12. R. W. Briddon (2003). Cotton leaf curl disease, a multicomponent begomovirus complex. Molecular Plant Pathology 4(6): 427. 13. S. Chakraborty, P. Pandey, M. Banerjee, G. Kalloo and C. Fauquet (2003). Tomato leaf curl Gujarat virus, a new begomovirus species causing a severe leaf curl disease of tomato in Varanasi, India. Phytopathology 93(12): 1485. 14. C. Fauquet, R. Briddon, J. Brown, E. Moriones, J. Stanley, M. Zerbini and X. Zhou (2008). Geminivirus strain demarcation and nomenclature. Archives of virology 153(4): 783. 15. C. Fauquet and J. Stanley (2005). Revising the way we conceive and name viruses below the species level: a review of geminivirus taxonomy calls for new standardized isolate descriptors. Archives of virology 150(10): 2151. 16. P. T. Ferreira, T. O. Lemos, T. Nagata and A. K. Inoue-Nagata (2008). One-step cloning approach for construction of agroinfectious begomovirus clones. J Virol Methods 147(2): 351. 17. R. Fujii, M. Kitaoka and K. Hayashi (2006). Error-prone rolling circle amplification: the simplest random mutagenesis protocol. Nature protocols 1(5): 2493. 18. Y. Gafni and B. L. Epel (2002). The role of host and viral proteins in intra-and inter-cellular trafficking of geminiviruses. Physiological and Molecular Plant Pathology 60(5): 231. 19. M. Ghanim, S. Morin and H. Czosnek (2001). Rate of Tomato yellow leaf curl virus translocation in the circulative transmission pathway of its vector, the whitefly Bemisia tabaci. Phytopathology 91(2): 188. 20. (2001). Molecular characterization of begomoviruses associated with leafcurl diseases of tomato in Bangladesh, Laos, Malaysia, Myanmar, and Vietnam. Plant Disease 85(12): 1286. 21. C. Ha, S. Coombs, P. Revill, R. Harding, M. Vu and J. Dale (2008). Molecular characterization of begomoviruses and DNA satellites from Vietnam: additional evidence that the New World geminiviruses were present in the Old World prior to continental separation. Journal of General Virology 89(1): 312. 22. C. V. Ha (2007). Detection and identification of potyviruses and geminiviruses in Vietnam. 23. D. Haible, S. Kober and H. Jeske (2006). Rolling circle amplification revolutionizes diagnosis and genomics of geminiviruses. J Virol Methods 135(1): 9. 24. B. Harrison, M. Swanson and D. Fargette (2002). Begomovirus coat protein: serology, variation and functions. Physiological and molecular plant pathology 60(5): 257. 25. T. Hartz, G. Miyao, J. Mickler, M. Le Strange, S. Stoddard, J. Nunez and B. Aegerter (1997). Processing tomato production in California, UCANR Publications. 26. A. K. Inoue-Nagata, L. C. Albuquerque, W. B. Rocha and T. Nagata (2004). A simple method for cloning the complete begomovirus genome using the bacteriophage phi29 DNA polymerase. J Virol Methods 116(2): 209. 27. D. R. Jones (2003). Plant viruses transmitted by whiteflies. European Journal of Plant Pathology 109(3): 195. 28. D. Knierim and E. Maiss (2007). Application of Phi29 DNA polymerase in identification and full-length clone inoculation of tomato yellow leaf curl Thailand virus and tobacco leaf curl Thailand virus. Arch Virol 152(5): 941. 29. P. Markham, I. Bedford, S. Liu, D. Frolich, R. Rosell and J. Brown (1996). transmission of geminiviruses by biotypes of Bemisia tabaci (Gennadius). Bemisia: 1995, taxonomy, biology, damage, control and management. 30. E. Moriones, S. García-Andrés and J. Navas-Castillo (2007). Recombination in the TYLCV complex: a mechanism to increase genetic diversity. Implications for plant resistance development. Tomato Yellow Leaf Curl Virus Disease, Springer: 119. 31. E. Moriones and J. Navas-Castillo (2000). Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Research 71(1): 123. 32. M. Padidam, S. Sawyer and C. M. Fauquet (1999). Possible emergence of new geminiviruses by frequent recombination. Virology 265(2): 218. 33. B. Picó, M. J. Díez and F. Nuez (1996). Viral diseases causing the greatest economic losses to the tomato crop. II. The Tomato yellow leaf curl virus—a review. Scientia Horticulturae 67(3): 151. 34. S. Ribeiro, A. Inoue‐Nagata, J. Daniels and A. DeÁvila (2006). Potato deforming mosaic disease is caused by an isolate of Tomato yellow vein streak virus. Plant Pathology 55(4): 569. 35. E. Rybicki (1994). A phylogenetic and evolutionary justification for three genera of Geminiviridae. Archives of Virology 139(1-2): 49. 36. K. Sarkar and K. Kulshreshtha (1978). Crotalaria striata DC. a new natural host of bean common mosaic virus. Current Science 47(7). 37. R. Tice, E. Agurell, D. Anderson, B. Burlinson, A. Hartmann, H. Kobayashi, Y. Miyamae, E. Rojas, J. Ryu and Y. Sasaki (2000). Single cell gel/comet assay: guidelines for in vitro and in vivo genetic toxicology testing. Environmental and molecular mutagenesis 35(3): 206. 38. A. VARMA and V. Malathi (2003). Emerging geminivirus problems: a serious threat to crop production. Annals of Applied Biology 142(2): 145. 39. C. Y. Wu, Y. C. Lai, N. S. Lin, Y. H. Hsu, H. T. Tsai, J. Y. Liao and C. C. Hu (2008). A simplified method of constructing infectious clones of begomovirus employing limited restriction enzyme digestion of products of rolling circle amplification. J Virol Methods 147(2): 355. 40. P. S. Wyant, D. Gotthardt, B. Schafer, B. Krenz and H. Jeske (2011). The genomes of four novel begomoviruses and a new Sida micrantha mosaic virus strain from Bolivian weeds. Arch Virol 156(2): 347. 41. H. Zhang, G. Hu and X. Zhou (2010). Molecular characterization of Tomato leaf curl Hainan virus, a new begomovirus, and evidence for recombination. Journal of Phytopathology 158(11‐12): 829. CÁC TRANG WEB PHỤ LỤC Phụ lục 1: Các môi trường Môi trường LB-agar: Trypton (10 g/L), yest extract (5 g/L), NaCl (5 g/L) và agar (15 g/L). Các thành phần được hòa trong nước cất và môi trường được hấp khử trùng ở 121 0C trong 30 phút. Để môi trường nguội khoảng 55 0C rồi rót vào đĩa petri đương kính 9 cm. Các kháng sinh cần thiết được bổ sung trước khi rót môi trường ra đĩa petri. Môi trường LB lỏng: được chuẩn bị như đối với môi trường LB-agar nhưng thiếu agar. Phụ lục 2:Các dung dịch gốc và đệm EDTA (ethylenediaminetetraacetic acid) 0,5 M, pH = 8. EDTA được hòa trong nước cất và pH được chỉnh với NaOH tinh thể ( khoảng 2g / 100 mL). Dung dịch được hấp khử trùng ở 1210C trong vòng 30 phút. Chú ý: EDTA sẽ không tan cho tới khi PH ≈ 8. Tris - HCl 1M, pH = 8. Hòa Tris base (Tris kiềm) trong nước cất và chỉnh pH bằng HCl đặc (khoảng 4,2 mL /100 mL). Dung dịch được hấp khử trùng ở 1210C trong vòng 30 phút. SDS (sodium dodecyl sulfate) 20 %. Hòa SDS trong nước cất. NaOH 1 M. Hòa NaOH trong nước cất. TE, pH = 8. Tris-Cl 10 mM và EDTA 1 mM. Dung dịch đệm được chuẩn bị từ dung dịch EDTA 0,5 M (pH = 8) và Tris-Cl 10 mM (pH = 8) được hấp khử trùng ở 121 0C trong vòng 30 phút và bảo quản trong tủ lạnh thường TAE (X1): 10 mM Tris-acetate chứa 0.5 mM EDTA (pH = 7.8). Đệm đậm đặc (5X) được chuẩn bị từ Tris base (24,2 g/L), acid acetic băng (5.71 mL/L) và EDTA 0.5 M pH = 8 (10 mL / L). Đệm được hấp khử trùng ở 121 0C trong vòng 30 phút và bảo quản trong tủ lạnh thường. Đệm được sử dụng để chạy điện di gel agarose. Phụ lục 3:Trình tự toàn bộ bộ gen của VNP93, VNP698, VNP842 >VNP93-A-cg ACCGGATGGCCGCGATTTTTTTTTAACGTGGTCCCCGCACGCATGCCCGTCCAATCACAGCCATTCCTCAAAGCTTATTTATGCAGTGGTCCCCCTATATAACTTAGTCTCCAAGTACCCACATCAAAACATGTGGGATCCTTTACTAAACGAGTTTCCTGAAACCGTGCATGGTTTTAGGTGTATGTTAGCTATTAAGTATTTGCAACAAGTAGAAAATACATACTCTCCCGATACATTAGGCTACGACCTAATACGTGATCTCATCTTGGTGATTCGTGCTAGGGATTATGGCGAAGCGTCCCGCAGATATAGTCATTTCCACACCCGCCTCGAAGGTTCGTCGCCGTCTGAACTTCGACAGCCCATATCTCAGCCGTGTTGCTGCCCCCACTGTCCTCGTCACAAACAAAAAGAGGTCATGGGCCAATCGGCCCATGTACAGAAAGCCCAGGATATACAGGATGTACAAAAGCCCTGATGTTCCTCGGGGGTGTGAAGGCCCATGTAAGGTCCAGTCCTATGAACAACGGCATGATGTAGCCCATGTAGGTAAGGTA ATATGTGTCTCTGATGTCACTCGAGGTAATGGGCTGACACATCGTGTTGGTAAGAGGTTCTGTATCAAGTCTGTCTATGTACTGGGCAAAATCTGGATGGATGAGAATATTAAGACGAAGAACCATACCAATACTGTCATGTTCTTTTTAGTTCGTGATAGGAGACCATTTGGCACGCCACAGGATTTTGGTCAAGTGTTCAACATGTATGATAATGAGCCCAGTACTGCCACTGTGAAGAACGACAACAGAGATCGATTCCAAGTTCTTCGTCGTTTTCAGGCAACTGTGACAGGTGGTCAATATGCAAGCAAGGAACAAGCCATAGTTAGGAAATTTATGAAGGTCAACAATCATGTGACCTACAACCATCAAGAAGCTGCGAAGTATGACAATCACACGGAGAATGCTCTTTTATTGTATATGGCATGTACTCATGCTAGTAATCCAGTGTATGCGACCTTGAAGATCAGAATCTATTTCTATGATTCAGTTCAAAATTAATAAATATTAAATTTTATTATATCCGAAAGATGAGCATCAATTGTGCCCTCAAGTACATTGTACAATACATGTCGAATTGCCCGAATTACATTGTTGATACTAATCACTCCTAAATGGTCTAAATACTTTATACATTGGTATTTAAATACTCGTAAGAAACGCGAGGTCTGAGGACGTAAACGAGTCCAGATTTGGCAGATTAGGTAGCATTGGTGTAGTCCCAACACTCTCCTCAGGTTGTAGTTGAACTGGATCTGTACTGTGATGATGTCGTGGTTCATCATGAATGGTCTCTCGCGGTGGTGGGTTATTTTGAAATATAGGGGATTGTTGACCATCCAGATATATACGCCATTCTCTGCCTGAGCTGCAGTGATGCGTTCCCCTGTGCGTGAATCCATGGTTGTGGCAACCTAGAGCGACGAAATACGAACAACCACAAGGGAGATCAACTCTTCTCCTTCTATTGGTCTTCTTGGCGATTCGGTGTTGCACCTTGATAGGTACCTGAGTAGAGTGGGCCTTGGAGGGTGATGAAGATTGCATTCTTCACAGCCCAATTTTTAAGTGCGGTGTTCTTTTCTTCCTGCAAGAACTCTTTATAACTGGAATGTGG TCCTGGATTGCAGAGGAAGATAGTGGGAATTCCCCCTTTAATTTGAACTGGTCGCCCGTACTTGGTGTTGCTTTGCCAGTCTCTTTGGGCCCCCATAAACTCTTTAAAGTGCTTTAAGTAATGCGGATCGACGTCATCAATGACGTTATACCAAGCAGCATTACTGTACACTTTTGGACTTAAGTCTAAATGACCACATAAGTAGTTATGTGGTCCCAATGATCTGGCCCACATTGTCTTCCCCGTACGACTACCGCCCTCTACCACTATGCTTATCGGTCTTATTGGCCGCGCAGCGGCAGCACTCACATTCGCAGAAACCCACTCTTCAAGTTCTTCTGGAACTTGATCGAAAGAAGAAGACAAAAAAGGACAAACAAAAACCTCTAAAGGAGGTGTAAAAATCCTATCTAAATTACTACTTAAATTATGAAACTGTAAAACAAAATCTTTGGGAGCCTTCTCCTTTAATATATTGAGGGCCGCTGCTTTGGACCCTGAATTGATTGCCTCGGCATATGCGTCGTTGGCAGATCGGCAACCTCCTCTAGCTGATCTTC CATCGATCTGGAAAACTCCATGATCAAGCACGTCTCCGTCTTTTTCCATGTATGCTTTAACATCTGAAGAGCTCTTAGCTCCCTGAATGTTCGGATGGAAATGTGCTGACCTGCTTGGAGAGTTGAGATCGAAGAATCGGTTGTTTTGGCACTTGAATTTGCCTTCGAACTGGATGAGGACATGCAGGTGAGGAGACCCATCTTCGTGTAGCTCCCTGCAAATACGTATGAATAATTTATTAGTCGGGGTTGATAAGCCTGAGATTTGGGAAAGTGCCTCTTCTTTAGTAAGGGAGCAGTGTGGATAAGTGAGGAAATAATTCTTGGCATTTATTAAAAATTTTCTGGGCGGAGGCATATTGACTGGTCAATCAGGTCCTCTCAAACTTGGCTATGCAATCGGGGAATGGGTCCTTACTTATAGTTGAGGACCTAAATGGCATTATTGTAATTTCTTAAAGAAATTCAAATTCCAAAAGCGGCCATCCGTATAATATT >VNP93-B-cg ACCGGATGGCCGCGATTTTTTTTTAACGTGGTCCCCGCACGCGTTTGTGACATTTTCCTCATTTTGAACAATCGCATCCATTGAATCTGAACACGTGTTACGATCTTAAGGCAGGAATGTTTCCATGTCTGTTTCTATATATTTGTCCTATGTATTTCCTCACTCATTTGTAACTAAAAATGAGAGTTCCAATCCGGAGGATTTCAGGCTTCAATTCTGACCGTCGTCCTTTCAATGGCTCAATCCACCGTTGGAACTACCCATATTCCAGCTATTTTGGGAGGAGGATTGGCAACCGTGTATACGGCATGCCATTCGGAAACCAACAAGGTCAACGACGTGAGTGTAAGCAAACTCAACGTCTTACCAAGACTGTTGAGCAAGTTGCATCTAGGAGGAAGTGTATGAAGACGGTTGAGGAAATTCATGATGGTACTGACTACTTGCTGTGCAGTAACACGTCTAAGGTGTCGTACATTAGCTACCCGCCTCTATCCGGCACTGAATATGGTAGCAGAGCGGAATCCTATATCAAAGTCTTGGGAGTCACTGTATCTGGGTCTGCGGTGCTGAAGCAGACAGGCATGCGTGAAGCAGATGGGTCTCAAGGAATTCATGGGATATTTACCACAGTAATCGTTCGTGACAAGAGACCATGTCAGTTCTCTGCCGTGGATCCTATTATCCCACTTGCGGAGCTGTTTGGACAAGAGAAGAGAGCATGCTCCTCATTACGTGTTAGAGAGTCTTATAAGAATCGATTTAGTGTTGTCTACCAGAAGAAACATGTAGTAAATAGTGCTCTGTCAACACATGTATTTAGGTATAATTTCAACGTTAAATTCTCTAGGTTTCCTTTCTGGGTATCTTTCAAAGACACCTGTAACGCAGATCCTACGGGGCGATATTCCAATGTCTCTAAGAACGCATTGATTGTGTATTACGTGTGGCTATGTGATTCAAATGTAACAGCCGAAGTGCACGTACAATATGATTTGAACTACATTGGATAAATAAAATTATATTTTTTTTACATTTGAGGATACATTACTCCCCTCCATACATAGTTCAACAGTTTTTTTAATAATATTAATTACATCTTCATTCACTTTGTTGCTACCTGCAATAACCTCTGACGCCGAAGGGCCTGGATCTAGAGTTGCATCTTGTAGCTGATGCAAATGTCTATATGGGTGCTCTTCCATTTCATTGTTCCCCACGGTGCTGGCCGAAGCCCAAGTAAGCCCTTGTGGAATGGCATTTGTAGTGTATCTGGAAGACTGTGACCTCATTTGTGTTAGGGCTTGCACTGGTTTTCGTGATACAGTTGATTGAGGCACATGCCAGAAATCGATGTGATTCATGTTATACGCCTTCGATAGTATTTCAATCTTAGGGGACTTAAATGTTATTTCCGAGGACTGTTTTGCAGAGGACATTTTTAACTTTCCTTGCATCCTGCAGAAGTGAACACCATTGATCACGTTAGTGTCGTCCACCCGGTACAGCACCCTCCATGGGTTTGGGTCTTTGGGGGAGAAGTATGAGGATGAGTAGTAGTGTATATTGCAGTTGCACCCTATGGGTATTGTGAACTCAGCCTGCTTGGAGTCCCCTTCGAGCAACCTTGTGTCGTGCATCTCTATGACCACATGGCCAGTTGCATTTCCAGGAACTTGGTTCCTGTATTGGAGGATTACGTGGTCAATCCTGAGACACTTTCCTAAAAGCATCGATAATTTTTGGTCGACAGTTGATGGAAACAACAGAGTTACCTCTGTCTTTTCATTTGACAGCTGAAACTCAGTCCTAGCCGACGTCGTATAGGCAATATTGTTATTGCTGGATTCCATTATTGAGTAAGCCATTAAAATAATAGTAATTCATCTTTTATAGACTTTTCAGAGTCTGTCAGGATAGTGGAATGTGACTATTTGGGTCGTTGCCTTTAAATTCCACTATCTCAAAGCACCAGTGAGCGAAGTCCACGTATGTACTTGTACTGACAAGAGATAAGGTATATACTTGGATGTGGTTCAGCCACGTCGCATAGTCGAAAATGGAAGACATCTGTCTTCCACTAAATATTTTTGATATGTTTCGAAGTGTATTAATTTAATTAACAAGTAAATTAAACGTTAGAAATAAATATATGTACTTCAGTACCACAAGTTAGGCGCTAATCTGGACAAGATATTTGGCTCACCGAAAGAATTATTGGTTAAGCCTTATGAGTTGTCGTGTAATCGACAACCTAAACTAATATTTAACTGATCCAACAATCTAATTATGAGAAAACACACACACTTGAACATACTAATCTTGAGAAAATCAGGCCGCGCAGCGGCTATGTCCCCAAATTATTAAGTAATCCAGAAGTGCGAACCCCAATTTATTATATTCAAATCGAAAAGGACTTATATGTAATCTGTATCAGTTGAAGGTATTTAGTAGCTGTAGCTAATATTATTAAAGTTAACAACATTAATGCAATATAATTATTGCATATTTGAAGAAAATAGGGTGAATTAAAGTTTTAGAGAGAGAAAGTCTAGAGAGAAGGCAGAGCGATTGACCAGTCAATTAGGTCCTCTCAAACTTGGCTATGCAATCGGGGAATGGGTCCTTACTTATAGTTGAGGACCTAAATGGCATTATTGTAATTTCTTAAAGAAATTCAAATTCCAAAAGCGGCCATCCGTATAATATT >VNP698-A-cg ACCGGATGGCCGCGATTTTTTTTCAAGTGGTCCCCGCACGCATGCCTGTCCAATCCTGGCCACTCCTCAAAGCTTAATTATTTATGTGGTCCCCTATATAACTTAGTCTCCAAGTACCCACATCAAAACATGTGGGATCCTTTACTAAACGAGTTTCCTGAAACCGTACATGGTTTTAGGTGTATGTTAGCTATTAAGTATTTGCAAGTAGTAGAAAATACATACTCTCCCGATACACTAGGCTACGATCTAATACGTGATCTTATCCTGGTGATTCGTGCTAGGGATTATGGCGAAGCGTCCCGCAGATATAGTCATTTCCACTCCCGCCTCGAAGGTTCGTCGCCGTCTGAACTTCGACAGCCCATATCTCAGCCGTGCTGCTGCCCCCACTGTCCTCGTCACAAACAAAAAGAGGTCGTGGGCCAATCGGCCCATGTACAGAAAGCCCAGGATATACAGGATGTACAAAAGCCCTGATGTTCCGCGGGGCTGTGAAGGCCCATGTAAGGTCCAGTCCTATGAACAACGTCATGACGTAGCCCATGTAGGTAAGGTAA TTTGTGTTTCAGATGTCACCCGAGGTAATGGGCTCACACATCGTGTTGGTAAGAGGTTCTGTATCAAGTCCGTGTATGTGTTGGGCAAAATCTGGATGGATGAGAATATCAAGACAAAGAACCATACTAATACGGTCATGTTCTTCTTAGTTCGTGATAGGAGACCATTTGGCACGCCACAGGATTTTGGGCAGGTGTTCAACATGTATGATAATGAGCCTAGTACTGCCACTGTGAAGAACGACAATAGAGATCGATTCCAAGTCCTTCGTCGTTTTCAGGCAACTGTGACAGGTGGTCAATATGCAAGCAAGGAGCAAGCCATAGTTAGGAAATTCATGAAGGTGAACAACCATGTGACCTACAACCATCAAGAAGCTGCGAAGTATGACAACCACACGGAGAATGCCCTTTTATTGTATATGGCATGTACGCATGCCAGTAATCCAGTGTATGCGACCTTGAAGATCAGAATCTATTTCTATGATTCGGTTCAAAATTAATAAATATTGAATTTTATTATATCCGAAAGATGAGCATCTATTGTGCCCTCAAGTACATTGTACAATACATGTCTAATTGCTCTAATAACATTGTTGATGCTAATAACTCCTAAACGGTCTAAATACTTTATACATTGGTATCTAAATACTCTTAAGAAACGCAAGGTCTGAGGACGTAAACGAGTCCAGATTTGGCAGATTAGATGTCCCAACGCTTTCCTCAGGTTGTAGTTGAACCGGATCTGCACTGTGATTATGTCGTGGTTCATCATGAATGGTCTCTCGCGGTGGTGGGTTATGTTGAAATAGAGGGGATTGTTGACCGTCCAGATATACACGCCATTCTCTGCCTGAGCTGCAGTGATGCGTTCCCCTGTGCGTGAATCCATGGTTGTGGCAACCTAGAGCGACGAAGTACGAACAACCACAAGGGAGATCAATTCTTCTCCTTCTATTGGTCTTCTTGGCGATTCGGTGTTGCACCTTGATTGGTACCTGAGTAGAGTGGGCCTTGGAGGGTGACGAAGATTGCATTCTTTAAAGCCCAATGTTTTAGTGCGGTGTTCTTTTCCTCTTCCAAGAACTCTTTATAGCTGGAATGTGGTCCTGGATTGCAGAGGAAGATAGTTGGAATCCCGCCTTTAATTTGGACCGGTTTCCCGTACTTGGTGTTGCTTTGCCAGTCTCTTTGGGCCCCCATGAACTCTTTAAAGTGCTTTAGATAATGCGGATCGACGTCATCAATGACGTTATACCAAGCAGCATTATTGAACACTTTAGGACTTAAGTCTAAATGCCCACATAAGTAGTTATGTGGGCCCAACGACCTGGCCCACATTGTCTTC CCTGTACGACTATCGCCCTCTAACACAATGCTTATCGGTCTTAATGGCCGCGCAGCGGCACTAACAACGTTTCCGGCAACCCATTCATCAAGTTCCTCGGGAACTTGGTCAAAAGAAGAAGACGAAAAAGGACAAACAAAAACCTCTAAAGGAGGTGCAAAAATCCTATCTAAATTACTATGTAAATTATGAAACTGTAAAACAAAATCTTTGGGGGCCTTCTCCTTTAATATATTGAGGGCCTCTGCTTTGGACCCTGAATTGATTGCCTCGGCATATGCGTCGTTGGCAGATCGGCAACCTCCTCTAGCTGATCTGCCATCGATCTGGAAAACTCCATGATCAAGCACGTCTCCGTCTTTCTCCATGTATGCTTTAACATCTGAAGAGCTCTTAGCTCCCTGAATGTTTGGATGGAAATGTGCTGACCTGGTTGGGGATCTGAGGTCGAAGAACCTTTGATTTTTGCATTGGAATTTACCTTGGAATTGGATGAGGACATGCAAGTGAGGAGTCCCATCTTCGTGCAATTCCCTGCAAATCCTGATAAACAGTTTATT TGTTGGTGTTTCTATGGCTTGAATTTGGGAAAGGGCCTCTTCTTTTGTGAGAGAGCAGTGTGGGTATGTGAGGAAATAGTTTTTAGCATTTATTCTGAATTTGTTTGGAGGAGCCATTGACCGGTCAATCGGTGTCTCTCAACTTGGGCTATGTAATTGGTGTCTG

Các file đính kèm theo tài liệu này:

  • docxkhoa_luan_nghien_cuu_begomovirus_tren_ot_va_ca_chua_o_khu_vu.docx
Tài liệu liên quan