Nghiên cứu bệnh đốm vàng lụi lúa (Rice yellow stunt virus) ở miền bắc Việt Nam

BỘ GIÁO DỤC VÀ ðÀO TẠO TRƯỜNG ðẠI HỌC NƠNG NGHIỆP HÀ NỘI ------------------ LƯU THỊ THẢO NGHIÊN CỨU BỆNH VÀNG LỤI LÚA (Rice yellow stunt virus) Ở MIỀN BẮC VIỆT NAM LUẬN VĂN THẠC SĨ NƠNG NGHIỆP Chuyên ngành : BẢO VỆ THỰC VẬT Mã số : 60.62.10 Người hướng dẫn khoa học: TS. HÀ VIẾT CƯỜNG HÀ NỘI - 2011 Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… i LỜI CAM ðOAN Tơi xin cam đoan! Bản luận văn tốt nghiệp này được hồn thành bằng s

pdf74 trang | Chia sẻ: huyen82 | Lượt xem: 2404 | Lượt tải: 6download
Tóm tắt tài liệu Nghiên cứu bệnh đốm vàng lụi lúa (Rice yellow stunt virus) ở miền bắc Việt Nam, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ự nhận thức chính xác của bản thân. Số liệu và kết quả nghiên cứu trong luận văn này là trung thực, chưa được sử dụng và cơng bố trong bất kỳ cơng trình nghiên cứu nào khác. Mọi sự giúp đỡ cho việc thực hiện luận văn này đã được cám ơn và các thơng tin trích dẫn trong luận văn đều được chỉ rõ nguồn gốc. Tác giả luận văn Lưu Thị Thảo Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… ii LỜI CẢM ƠN Tơi xin trân trọng cám ơn sự hướng dẫn tận tình, với tinh thần trách nhiệm cao của Tiến sĩ Hà Viết Cường, Giáo viên bộ mơn Bệnh cây- Khoa Nơng học, trường ðại học Nơng nghiệp Hà Nội. Trân trọng cám ơn các Giảng viên bộ mơn Bệnh cây, Khoa Nơng học; các cán bộ cơng nhân viên của Trung tâm Bệnh cây nhiệt đới trường ðại học Nơng nghiệp Hà Nội đã tạo điều kiện giúp đỡ về mặt kỹ thuật, dụng cụ, trang thiết bị phục vụ cho quá trình điều tra, tiến hành các thí nghiệm và giúp đỡ tơi hồn thành luận văn này. Trân trọng cám ơn cán bộ Lãnh đạo UBND và Trưởng ban khuyến nơng, Trạm trưởng Trạm Bảo vệ thực vật huyện Ba Vì – Hà Nội, huyện Hiệp Hịa – Bắc Giang đã hỗ trợ theo dõi, phối hợp đánh giá tình hình diễn biến của bệnh vàng lụi trong quá trình thực hiện đề tài. Hà Nội, ngày 20 tháng 3 năm 2011 Tác giả Lưu Thị Thảo Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… iii MỤC LỤC Lời cam đoan i Lời cảm ơn ii Mục lục iii Danh mục chữ viết tắt vi Danh mục bảng biểu vii Danh mục hình viii 1 ðẶT VẤN ðỀ i 1.1 Tính cấp thiết của nghiên cứu 1 1.2 Mục đích – yêu cầu 3 2 TỔNG QUAN TÀI LIỆU 4 2.1 Bệnh vàng lụi trên thế giới và Việt Nam 4 2.2 Triệu chứng gây hại 6 2.3 Phân loại, hình thái và đặc điểm bộ gen virus RYSV 7 2.4 Lan truyền của RYSV 10 2.5 Phương pháp chẩn đốn virus bằng ELISA 11 2.5.1 Nguyên lý của phương pháp huyết thanh học và ứng dụng 11 2.5.2 Chế tạo kháng huyết thanh đa dịngđối với virus thực vật 12 2.5.3 Các yếu tố ảnh hưởng đến nồng độ kháng thể 12 2.5.4 Các kỹ thuật ELISA 13 2.6 Chẩn đốn virus RYSV bằng ELISA 14 3 ðỊA ðIỂM, VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 15 3.1 Nội dung nghiên cứu 15 3.2 ðịa điểm nghiên cứu chính 15 3.3 Vật liệu liệu nghiên cứu chính 15 3.3.1 Vật liệu thu thập mẫu cây và rầy 15 3.3.2 Vật liệu thử nghiệm tạo kháng huyết thanh và chẩn đốn ELISA 15 3.3.3 Hĩa chất, dung dịch đệm, mơi trường 15 Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… iv 3.3.5 Các enzyme và kit thương mại 16 3.3.6 Các thiết bị chủ yếu 17 3.4 Phương pháp nghiên cứu 17 3.4.1.Phương pháp điều tra bệnh đồng ruộng 17 3.4.2 Phương pháp thu thập và xử lý mẫu 17 3.4.3 Phương pháp bảo quản mẫu 18 3.4.4 Phương pháp chiết RNA tổng số từ mơ lá 18 3.4.5 Phản ứng RT – PCR 19 3.4.6 ðiện di agarose 21 3.4.7 Dịng hĩa và giải trình tự 21 3.4.8 Phân tích trình tự 22 3.4.9 Tinh chiết phân tử virus RYSV 22 3.4.10 Tạo kháng huyết thanh virus trên thỏ 23 3.4.11 Phương pháp ELISA 23 4 KẾT QUẢ NGHIÊN CỨU 25 4.1 ðiều tra bệnh vàng lụi năm 2011 25 4.1.1 Triệu chứng bệnh vàng lụi tại các điểm điều tra 25 4.1.2 ðiều tra tình hình bệnh vụ xuân năm 2011 27 4.1.3 ðiều tra bệnh vụ mùa 2011 29 4.1.4 Phát hiện virus RYSV bằng RT-PCR trên các mẫu thu thập ngồi đồng ruộng vụ xuân 2011 30 4.2 Thử nghiệm tạo kháng huyết thanh đặc hiệu virus RYSV 33 4.2.1 Giới thiệu 33 4.2.2 Chuẩn bị nguồn vật liệu 33 4.2.3 Tinh chiết phân tử virus 34 4.2.4 Gây miễn dịch trên thỏ 35 4.2.5 Kiểm tra sự cĩ mặt của kháng thể virus 35 4.2.6 ðánh giá chất lượng của 2 nguồn kháng huyết thanh (huyết tương và dịch trên tủa sau ly tâm máu đơng). 37 4.2.7 Kiểm tra nồng độ virus trong quá trình tinh chiết 40 Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… v 4.2.8 ðánh giá độ hịa lỗng của kháng huyết thanh 42 4.2.9 ðánh giá độ hịa lỗng của mẫu cây bệnh 43 4.2.10 Kiểm tra nồng độ virus ở mẫu lá vàng và lá xanh trên cùng một cây bệnh. 44 4.2.11 ðánh giá về mẫu khơ, mẫu tươi và mẫu nghiền, mẫu khơng nghiền 46 4.2.12 Kiểm tra nồng độ virus ở các bộ phận khác nhau của cây bệnh 47 4.2.13 Kiểm tra virus trong mẫu rầy xanh đuơi đen và một số loại cỏ tại Bắc Giang năm 2011 49 4.2.14.Ứng dụng ELISA kiểm tra virus RYYSV thu tại ở Hà Nội, Bắc Giang năm 2011 51 4.3 Xác định virus RYSV bằng giải trình tự 52 4.3.1 Nhân gen virus bằng RT-PCR 53 4.3.2 Dịng hĩa sản phẩm RT-PCR 54 4.3.3 Kết quả giải trình tự 57 4.3.4 Kết quả tìm kiếm chuỗi tương đồng trên ngân hàng gien 58 5 KẾT LUẬN VÀ ðỀ NGHỊ 60 5.1 Kết luận 60 5.2 ðề nghị 60 TÀI LIỆU THAM KHẢO 62 Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… vi DANH MỤC CHỮ VIẾT TẮT RYSV : Rice yellow stunt virus Báo NNVN : Báo Nơng nghiệp Việt Nam IRRI : Viện nghiên cứu lúa quốc tế Bộ NN&PTNT : Bộ Nơng nghiệp và phát triển nơng thơn TT BVTV : Trung tâm bảo vệ thực vật ðHNNHN : ðại học Nơng nghiệp Hà Nội HTX : Hợp tác xã UBND : Ủy ban nhân dân DAS - ELISA : Double antibody sandwich - ELISA NCBI : National Center for Biotechnology Information PAGE : Polyacrylamide gel electrophoresis PTA-ELISA : Plate Trapped Entigen – ELISA OD Optical density CCSV Cynodon chlorotic streak virus RT-PCR : Reverse Transcriptional – Polymerase Chain Reaction KHT : Kháng huyết thanh CNSH : Cơng nghệ Sinh học Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… vii DANH MỤC BẢNG BIỂU STT Tên bảng Trang 4.1 Bệnh vàng lá lúa vụ xuân năm 2011 tại một số tỉnh phía Bắc 27 4.2 Bệnh vàng lá lúa vụ mùa năm 2011 tại một số tỉnh phía Bắc 29 4.3 RT-PCR phát hiện virus RYSV trên lúa vụ xuân 2011 tại Hà- Nội. 31 4.4 RT-PCR phát hiện virus RYSV trên lúa vụ xuân năm 2011 tại Bắc Giang và Hịa Bình 32 4.5 Tĩm tắt các bước tinh chiết phân tử virus RYSV từ mơ lá lúa bệnh 35 4.6 ELISA kiểm tra sự cĩ mặt kháng thể virus RYSV trong kháng huyết thanh. 36 4.7 ELISA so sánh chất lượng 2 nguồn kháng huyết thanh virus RYYSV (huyết tương và dịch trên tủa sau ly tâm máu đơng) 38 4.8 Kiểm tra ELISA hàm lượng virus RYSV trong các sản phẩm thu được trong quá trình tinh chiết phân tử virus 40 4.9 Xác định độ hịa lỗng của kháng huyết thanh. 42 4.10 Xác định độ hịa lỗng của mẫu cây bệnh 43 4.11 Thử nghiệm ELISA về nồng độ virus trên mẫu lá xanh và lá vàng trên cùng cây bệnh 45 4.12 ðánh giá về mẫu nghiền và mẫu khơng nghiền; mẫu khơ và mẫu tươi 46 4.13 Kiểm tra nồng độ virus ở các bộ phận khác nhau ở cây bệnh 48 4.14 Kết quả kiểm tra RYSV trên mẫu rầy năm 2011 49 4.15 Kiểm tra ELISA một số loại cỏ thu thập được trong quá trình điều tra bệnh vàng lụi 50 4.16 Kết quả kiểm tra RYSV trên mẫu lúa vụ mùa 2011 51 4.17 RT-PCR nhân dịng 3 sản phẩm gen RYSV 54 4.18 Kiểm tra PCR các dịng vi khuẩn biến nạp 56 4.19 Kiểm tra sản phẩm miniprep bằng enzyme cắt giới hạn 57 4.20 Kết quả giải trình tự sản phẩm RT-PCR 57 4.21 Kết quả tìm kiếm trên ngân hang gen bằng phần mềm Blast 59 Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… viii DANH MỤC HÌNH STT Tên hình Trang 2.1. Phân bố dịch bệnh “vàng lụi” tại Việt Nam, 5 2.2. Cấu trúc phân tử của các rhabdovirus (Viralzone, 2009) 8 2.3. Phân tử virus RYSV (hình trái, Shikata và Chen, 1969) và vị trí hình thành của các phân tử virus RYSV trong phần ngoại vi của nhân tế bào lúa (hình phải, Ou, 1985). 9 2.4. Sơ đồ tổ chức bộ gen của RYSV được xây dựng dựa trên mẫu AB011257 bằng phần mềm NTI (hãng Invitrogen) 10 2.5. Hìn thái 3 lồi rầy xanh truyền RYSV. Từ trái sang phải lần lượt là là N. nigropictus, N. cincticeps và N. virescens. 10 2.6. Các kỹ thuật ELISA khác nhau (Hull, 2000) 14 4.1. Một số triệu chứng điển hình của cây lúa bị bệnh vàng lá do RYSV tại miền Bắc vụ xuân 2011. 27 4.2. ðiều tra bệnh và thu thập rầy xanh đuơi đen tại xã Hịa Sơn – Hiệp Hịa – Bắc Giang vụ xuân 2011 28 4.3. ðiều tra bệnh vàng lá và thu thập rầy xanh đuơi đen tại xã Phú Cường (Ba Vì – Hà Nội) vụ mùa năm 2011. 30 4.4. ðiều tra bệnh vàng lá và thu thập rầy xanh đuơi đen tại xã Hịa Sơn – Hiệp Hịa – Bắc Giang vụ mùa năm 2011. 30 4.5. Kiểm tra RT-PCR phát hiện virus RYSV trên lúa Hà Nội vụ xuân 2011. 31 4.6. Kiểm tra RT-PCR phát hiện virus RYSV trên lúa Bắc Giang vụ xuân 2011. 33 4.7. Thu thập và bảo quản mẫu cây bệnh làm vật liệu tinh chiết virus RYSV 34 Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… ix 4.8. ELISA kiểm tra sự cĩ mặt kháng thể virus RYSV trong kháng huyết thanh. 37 4.9. ELISA so sánh chất lượng 2 nguồn kháng huyết thanh virus RYYSV (huyết tương và dịch trên tủa sau ly tâm máu đơng) 39 4.10 Kiểm tra ELISA đánh giá hàm lượng virus ở các sản phẩm của quá trình tinh chiết. 41 4.11 ELISA đánh giá độ hịa lỗng của kháng huyết thanh 42 4.12. ELISA đánh giá độ hịa lỗng của mẫu cây bệnh 44 4.12. Elisa đánh giá độ hịa lỗng của mẫu cây bệnh và nồng độ virus trong mẫu lá xanh và lá vàng 45 4.13. Kiểm tra ELISA đánh giá mẫu tươi, mẫu khơ; mẫu nghiền, khơng nghiền 47 4.14. Kiểm tra ELISA đánh giá nồng độ virus ở các bộ phận của cây bệnh. 48 4.15. Elisa kiểm tra RYSV trên mẫu lúa vụ mùa 2011 52 4.16. Sơ đồ bộ gen virus RYSV, vị trí các mồi và sản phẩm RT-PCR 53 4.17. RT-PCR dùng 2 tổ hợp mồi để nhân gen L và N của RYSV từ 2 mẫu lúa bệnh 1075 và 2011. M là thang DNA 1 kb (Fermentas) với băng tham khảo 0.5 kb được chỉ bằng mũi tên. 54 4.18. Nuơi cấy các dịng vi khuẩn tái tổ hợp trong mơi trường LB lỏng chứa ampicillin 55 4.19 Kiểm tra PCR các dịng vi khuẩn biến nạp bằng cặp mồi Vector SeqFor và Vector SeqRev. M là thang DNA 100 bp (Fermentas) với băng tham khảo 0.5 kb được chỉ bằng mũi tên. 56 4.20 Kiểm tra sản phẩm miniprep bằng cắt kép với BamHI và ECoRI. M là thang DNA 100 bp ( Fermentas) với 2 băng tham khảo được chỉ bẳng mũi tên 57 4.21 Trình tự sản phẩm RT-PCR và minh họa một phần đồ thị trình tự 58 Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 1 1. ðẶT VẤN ðỀ 1.1 Tính cấp thiết của nghiên cứu Lúa (Oryza sativa L.) là cây lương thực quan trọng nhất ở các nước Châu Á nĩi chung và Việt Nam nĩi riêng. Khoảng 92% lúa gạo được sản xuất từ Châu Á. Việt Nam, trong nhưng năm gần đây là một trong các quốc gia xuất khẩu gạo hàng đầu của thế giới. Hiên nay, Việt Nam chỉ đứng sau Thái Lan về xuất khẩu gạo, với lượng xuất khẩu khoảng 5 triệu tấn, chiếm 1/5 tổng lượng gạo xuất khẩu trên thế giới. Sản xuất lúa hiện đang phải đương đầu với nhiều nguy cơ, đặc biệt là sự tấn cơng của dịch hại, trong đĩ cĩ bệnh virus. Cho tới nay cĩ hơn 15 virus gây bệnh cho lúa đã được xác định, trong đĩ cĩ 12 virus ở Châu Á, 2 virus ở Châu phi, 1 virus ở Châu Âu và 1 virus ở Châu Mỹ (Hibino, 1996). Tại các nước Châu Á, bệnh virus hại lúa xảy ra ở nhiều vùng, từ năm này qua năm khác và gây thiệt hại hàng nghìn ha luá (Bos, 1992) Tại Việt Nam, bệnh vàng lùn do Rice grassy stunt virus (RGSV) và lùn xoắn lá do Rice ragged stunt virus (RRSV) đã gây ra nhiều vụ dịch nghiêm trọng trên lúa tại miền Nam từ năm 2006. Gần đây hơn, bệnh lùn sọc đen so Southern rice black streaked dwarf virus (SRBSDV) đã và đang gây bệnh nghiêm trọng, đặc biệt trên lúa mùa ở miền Bắc và miền Trung từ năm 2009 (Hà Viết Cường et al., 2009, Ngơ Vĩnh Viễn et al., 2009). Tại Việt Nam, bệnh vàng lụi (cịn gọi là bệnh vàng lá) xuất hiện ở Việt Nam từ những năm 60 của thế kỷ trước và được coi là dịch hại nguy hiểm nhất, được xác định do rầy xanh đuơi đen truyền, gây hại thành dịch tại nhiều tỉnh phía Bắc, đặc biệt là các tỉnh miền núi (Ngơ Vĩnh Viễn và Hà Minh Trung, 2006). ðến năm 1980- 1981 bệnh xuất hiện trở lại và gây hại cục bộ trên các cánh đồng Mường Thanh (ðiện Biên) và Phù Yên (Sơn La). Mặc dù vector truyền bệnh được biết là do rầy xanh đuơi đen nhưng virus gây bệnh vẫn chưa được nghiên cứu. Trong năm 2010, tại Bắc Giang, một bệnh trên lúa với triệu chứng vàng lá đã xuất hiện và gây hại trên diện rộng. Các cây lúa bị bệnh sinh trưởng phát triển kém, lùn lụi. Theo thơng báo của Chi cục BVTV Bắc Giang, bệnh đã xuất hiện từ năm Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 2 2004 và diện tích nhiễm bệnh tới ~ 1000 ha năm 2009. Vụ mùa 2010 ở Bắc Giang, bệnh đã xuất hiện ở 24/26 xã của huyện, trong đĩ hai xã bị nặng nhất là Hịa Sơn và Thanh Sơn. Tới ngày 6/8/2010, tổng diện tích bị bệnh của huyện là 108 ha, nhiều ruộng cĩ tỷ lệ bệnh tới ~ 90 %. Ngồi ra, triệu chứng bệnh tương tự cịn thấy xuất hiện ở một số tỉnh như Hà Nam, Hà Nội, Thanh Hĩa, Nghệ An… Lúc đầu bệnh đã được cho là do các nguyên nhân sinh lý như đất đai, phân bĩn hoặc ngẹt rễ gây ra. Tuy nhiên, dựa vào đánh giá triệu chứng, phân tích phân tử (PCR và giải trình tự), hiển vi điện tử, nguyên nhân gây bệnh vàng lá tại Bắc Giang đã được xác định chính xác là do virus Rice yellow stunt virus (RYSV) (Hà Viết Cường et al., 2010). Virus gây bệnh cịn được biết với tên gọi là Rice yellow transitory virus (RYTV) đã từng gây thành dịch nghiêm trọng tại tại nhiều tỉnh phía nam Nam Trung Quốc kể cả ðài Loan trong những năm 60 và 70 (Ou, 1985; Hibino, 1996). Do đặc điểm giống nhau về triệu chứng, vector truyền bệnh nên tên bệnh vàng lá Bắc Giang được đề xuất là bệnh vàng lụi (Hà Viết Cường et al., 2010). Mặc dù tác nhân gây bệnh vàng lụi lúa tại Việt Nam đã được xác định là do RYSV nhưng nhiều vấn đề liên quan đến virus đều phải được nghiên cứu bao gồm: (i) bản thân virus (đặc điểm hình thái, phân tử/di truyền, phân loại, chẩn đốn…), (ii) các đặc trưng sinh học (phạm vi ký chủ, quan hệ vector, tính chất gây bệnh, tính hướng mơ, chức năng gen…), (iii) dịch tễ bệnh (ảnh hưởng tương tác của 3 yếu tố bệnh học là ký chủ - điều kiện ngoại cảnh - virus đến sự phát triển bệnh trên qui mơ quần thể) và (iv) phịng chống (các chiến lược và chiến thuật phịng trừ bệnh). Trong các nội dung nghiên cứu trên thì nghiên cứu chẩn đốn chính xác bệnh là yêu cầu bức thiết vì triệu chứng điển hình của bệnh là bộ lá bị biến vàng, cây lùn nhưng lại cĩ khả năng mất triệu chứng trong một số trường hợp dẫn tới bệnh rất dễ bị nhầm do các nguyên nhân khác. Xuất phát từ thực tế trên, dưới sự hướng dẫn của TS. Hà Viết Cường, chúng tơi tiến hành đề tài: “Nghiên cứu bệnh vàng lụi lúa (Rice yellow stunt virus) ở miền Bắc Việt Nam” Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 3 1.2. Mục đích – yêu cầu Mục đích ðánh giá tình hình bệnh vàng lụi trên lúa năm 2011 tại một số địa điểm miền Bắc và phát triển kỹ thuật chẩn đốn virus vàng lụi (RYSV) Yêu cầu • ðiều tra bệnh vàng lụi, kiểm tra virus bằng RT- PCR và ELISA. • Thử nghiệm tạo kháng huyết thanh đặc hiệu phân tử virus RYSV và đánh giá các điều kiện để tối ưu hĩa phản ứng ELISA. • Dịng hĩa và giải trình tự một phần gen virus RYSV. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 4 2. TỔNG QUAN TÀI LIỆU 2.1. Bệnh vàng lụi trên thế giới và Việt Nam Bệnh vàng lùn lúa (rice yellow stunt disease) được phát hiện đầu tiên ở tỉnh Quảng Tây (Trung Quốc) năm 1957 và được cơng bố chính thức năm 1965 (Fang et al. 1994). Cũng trong năm này, một bệnh trên lúa gọi là bệnh vàng tạm thời (rice transitory yellowing disease) đã gây thành dịch ở ðài Loan (Chiu et al., 1965) và virus gây bệnh được gọi là RTSV (Rice transitory yellowing virus). Tại Việt Nam, bệnh “vàng tạm thời” tại ðài Loan đã được dịch là bệnh “vàng lá di động”. Tên bệnh “vàng tạm thời” và tên virus RTSV đã xuất hiện trên nhiều tài liệu, chủ yếu do các tác giả Nhật Bản và ðài Loan, thậm chí để chỉ cả bệnh “vàng lùn” ở lục địa Trung Quốc (Shikita, 1972; Ou, 1985). Triệu chứng bệnh của 2 loại bệnh này trên cây lúa được mơ tả giống nhau: lá lúa bị vàng, nhiều nhất là lá phía dưới, cây lúa cịi cọc và giảm số nhánh ở các cây bị bệnh và làm giảm năng suất lúa. Bệnh “vàng lùn” hay bệnh “vàng tạm thời” đã từng gây thành dịch tại nhiều tỉnh phía nam trong những năm 60 và 70 như ðài Loan (1960 – 1962, 1973 – 1980), các tỉnh phía nam sơng Dương Tử như Quảng ðơng (1964-1966, 1979), Phúc Kiến (1966, 1969, 1973), Chiết Giang (1970 – 1973) (Ou, 1985; Hibino, 1996). Tại Việt Nam, trong cùng thời gian, một bệnh biến vàng trên lúa gọi là bệnh “vàng lụi” do rầy xanh đuơi đen truyền đã gây thành dịch ở miền Bắc, đặc biệt tại các tỉnh miền núi (Ngơ Vĩnh Viễn và Hà Minh Trung, 2006). Mặc dù mẫu bệnh vàng lụi của Việt Nam khơng được lưu giữ nhưng đối chiếu bệnh “vàng lùn” hay “vàng tạm thời” của Trung Quốc và bệnh “vàng lụi” của Việt Nam thấy cĩ nhiểu điểm giống nhau về (i) triệu chứng, (ii) vector và (iii) đặc biệt là sự xuất hiện các vụ dịch trong cùng thời gian, tại các khu vực gần gũi về mặt địa lý. Rất cĩ thể, bệnh “vàng lụi” tại Việt Nam chính là bệnh “vàng lùn” hay “vàng tạm thời” tại Trung Quốc (Hà Viết Cường et al., 2010) (Hình 2.1). Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 5 Hình 2.1. Phân bố dịch bệnh “vàng lụi” tại Việt Nam, bệnh “vàng lùn” tại phía Nam Trung Quốc và “vàng tạm thời” tại ðài Loan (các hình tam giác đỏ) trong những năm 60, 70 (Hà Viết Cường, Báo cáo hội thảo quốc gia Bệnh cây năm 2011 tổ chức tại ðH Nơng nghiệp Hà Nội) Tại Việt Nam, Viện Bảo vệ thực vật đã cĩ nhiều nghiên cứu về bệnh vàng lụi trong những năm 1980-1981, mẫu bệnh được chụp trên kính hiển vi điện tử tại Viện vệ sinh dịch tễ Hà Nội và đã kết luận bệnh vàng lụi xuất hiện ở các tỉnh miền núi phía Bắc giống như bệnh vàng lá di động gây hại ở ðài Loan (Ngơ Vĩnh Viễn và Hà Minh Trung, 2006). Gần đây, tại Bắc Giang, một bệnh với triệu chứng vàng lá đã xuất hiện và gây hại trên diện rộng. Các cây lúa bị bệnh sinh trưởng phát triển kém, lùn lụi. Theo thơng báo của Chi cục BVTV Bắc Giang, bệnh đã xuất hiện từ năm 2004 nhưng vì là bệnh mới, khơng xác định được nguyên nhân gây bệnh nên khơng thống kê diện tích nhiễm. Các năm tiếp theo, Chi cục đã thống kê mức độ gây hại của bệnh như sau: • Năm 2005:diện tích nhiễm (DTN) 60 ha ở Hiệp Hịa. • Năm 2006: Bệnh phát sinh rộng, chủ yếu ở Hiệp Hịa, DTN 200 ha với tỷ lệ bệnh trung bình 10-20%, diện tích nhiễm nặng 30 ha với tỷ lệ bênh 50-60%. Huyện tổ chức phịng trừ trên diện tích 100 ha, áp dụng các biện pháp như đối với bệnh sinh lý nhưng khơng cĩ kết quả. • Năm 2007: DTN 13 ha ở Hiệp Hịa, Lạng Giang. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 6 • Năm 2008: DTN > 1 ha ở Hiệp Hịa. • Năm 2009: DTN lên tới 914,5 ha, mất trắng > 4,5 ha, xuất hiện ở hầu hết các huyện, riêng Hiệp Hịa 600 ha. Các biện pháp phịng chống bệnh như đối với bệnh sinh lý đã được áp dụng trên diện tích 605 ha nhưng khơng cĩ kết quả. • Vù mùa 2010, bệnh cũng xuất hiện trên diện rộng, đặc biệt tại huyện Hiệp Hịa. Tại Hiệp Hịa, bệnh đã xuất hiện ở 24/26 xã của huyện, trong đĩ hai xã bị nặng nhất là Hịa Sơn và Thanh Sơn. Tới ngày 6/8/2010, tổng diện tích bị bệnh của huyện là 108 ha, nhiều ruộng cĩ tỷ lệ bệnh tới ~ 90 %. Ngồi ra, triệu chứng bệnh tương tự cịn thấy xuất hiện ở một số tỉnh như Hà Nam, Hà Nội, Thanh Hĩa, Nghệ An. Lúc đầu bệnh đã được cho là do các nguyên nhân sinh lý như đất đai, phân bĩn hoặc ngẹt rễ gây ra. Tuy nhiên, dựa vào đánh giá triệu chứng, phân tích phân tử (PCR và giải trình tự), hiển vi điện tử, nguyên nhân gây bệnh vàng lá tại Bắc Giang đã được xác định chính xác là do virus RYSV (Rice yellow stunt virus). Do đặc điểm giống nhau về triệu chứng và vector truyền bệnh nên tên bệnh vàng lá Bắc Giang được đề xuất là bệnh vàng lụi (Hà Viết Cường et al., 2010). 2.2. Triệu chứng gây hại Về triệu chứng, bệnh biến vàng tạm thời ở luá đã được Ou (1985) mơ tả như sau: (i) Triệu chứng điển hình là bộ lá biến vàng, cây lùn, đẻ nhánh giảm. Hai đến ba tuần sau cấy, một cây bệnh điển hình cĩ 1-2 lá phía dưới bị biến vàng, sau chuyển thành vàng sáng hoặc vàng cam tối, cuối cùng các lá vàng này trở nên nhăn héo. Lá biến vàng thường bắt đầu từ đỉnh lá và trên cây thì các lá phía dưới biến vàng trước sau đĩ mới lan lên các lá phía trên. Trên các lá biến vàng, cĩ thể xuất hiện các chấm nhỏ màu nâu đỏ (màu gỉ sắt). (ii) Trên giống mẫn cảm, cây bị lùn, giảm mạnh khả năng đẻ nhánh, trỗ kém hoặc khơng trỗ. Cây nhiễm sớm cĩ thể biểu hiện triệu chứng rõ rệt nhưng cây nhiễm muộn cĩ thể khơng biểu hiện triệu chứng. Trường hợp nặng, cây cĩ thể chết trước khi trỗ. (iii) Bệnh được gọi là “vàng tạm thời” vì cây bệnh, đặc biệt trong điều kiện nhà kính, sau khi biểu hiện triệu chứng vàng lá điển hình, cĩ thể phục hồi, thậm chí khơng biểu hiện triệu chứng. Nhiều khi, các dảnh trơng bình thường hình thành từ một cây bệnh. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 7 2.3. Phân loại, hình thái và đặc điểm bộ gen virus RYSV Phân loại RYSV hay RTYV là thành viên của chi Nucleorhabdovirus, họ Rhabdoviridae, bộ Mononegavirales (Walker et al., 2000). Tổng số lồi virus thuộc họ Rhabdovirus được cơng nhận bởi ICTV cho tới năm 2009 là 51. Các rhabdovirus được phân loại chính thức vào 6 chi và một số chưa phân loại đến chi. “Rhabdo” cĩ nguồn gốc từ từ Hy Lạp “rhabdos” cĩ nghĩa là “hình gậy” ám chỉ phân tử virus cĩ hình nhộng (gậy ngắn). Các rhabdovirus gây hại thực vật chỉ thuộc 2 chi Nucleorhabdovirus và Cytorhabdovirus, cịn lại là các virus động vật. Trong số các rhabdovirus hại động vật, Rabies virus (gây bệnh dại) là nguy hiểm nhất. Trong số các rhabdovirus hại thực vật, RYSV gây bệnh vàng lụi lúa là virus quan trọng nhất (Hà Viết Cường, 2010 b) Hình thái phân tử virus (virion) và tổ chức bộ gen Các rhabdovirus là các virus cĩ bộ gen RNA, sợi đơn, khơng phân mảnh, cực âm, kích thước 11-15 kb, chiếm khoảng 1-2% khối lượng phân tử virus. Bộ gen virus chứa ít nhất 5 khung đọc mở (open reading frame, ORF) khơng liên tục theo chiều từ đầu 3' - 5' (chú ý RNA của virus là cực âm) theo thứ tự sau: 3'- N- P- M-G- L-5'. Các ORF được phiên mã thành mRNA và dich mã độc lập thành các protein cấu trúc sau: • N: protein nucleoprotein. Bên trong tế bào, N đĩng vai trị cân bằng giữa quá trình phiên mã các gen virus và tái sinh bộ gen virus do tác động đến sự nhận biết các dấu hiệu phiên mã. • L: protein lớn (large protein). L là một RdRp. • M : protein tạo protein nền (matrix protein). M cịn được kí hiệu là M1, M đĩng vai trị điều khiển quá trình phiên mã của virus, ức chế phiên mã của kí chủ, ảnh hưởng tới sự gây bệnh. • P : protein được phosphryl hĩa (phosphorylated protein). P cịn được ký hiệu là M2. P là một cofactor của protein L và do đĩ cần thiết cho quá trình tái sinh của virus. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 8 • G : protien được glycosyl hĩa (glycosylated protein).G lắp ráp thành trimer để tạo thành gai vỏ. Cĩ chức năng quan trọng trong xâm nhập tế bào, tương tắc với vector. Ngồi ra, ở đầu 3' và 5' của bộ gen virus cĩ lần lượt 2 chuỗi leader và trailer. Các rhabdovirus nhìn chung cĩ cấu trúc phân tử phức tạp, thuộc nhĩm cĩ vỏ bọc. Phần lớn các rhabdovirus cĩ hình con nhộng nhưng một số cĩ hình viên đạn (hình nhộng nhưng với một đầu phẳng hơn). Các rhabdovirus cĩ kích thước khá lớn, dài 100 – 430 nm và đường kính 40-100nm. Về cấu trúc chi tiết, các phân tử protein N liên kết chắt với phân tử RNA genome theo kiểu đối xứng xoắn để tạo thành phân tử ribonucleoprotein (RNP). Phân tử RNP lại liên kết với protein L và P để tạo thành phức hợp nucleocapsid. Phức hợp này ngập trong một lớp protein nền được cấu tạo bởi protein M. Tồn bộ cấu trúc trên lại được bao bọc bởi một lớp màng kép lypid chứa các gai vỏ nhơ lên bề mặt và được cấu tạo bởi các protein G (glycoprotein). Mỗi một gai vỏ là một trimer gồm 3 phân tử protein G lắp ráp thành (Hình 2.2). Hình 2.2. Cấu trúc phân tử của các rhabdovirus (Viralzone, 2009) ðặc điểm hình thái của RYSV đã được Shikata và Chen cơng bố lần đầu tiên vào năm 1969. Các quan sát dưới kính hiển vi điện tử dung lát cắt siêu mỏng mơ lá lúa cho thấy RYSV cĩ hình đầu đạn đặc, cĩ vỏ bọc, kích thước 94 nm x 180 - 210 nm. Trong tế bào, các phân tử RYSV hình thành nhiều tại phần ngoại vi của nhân tế bào (Shikata & Chen, 1969; Fang et al., 1994; Ou, 1985) (Hình 2.3). Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 9 Hình 2.3. Phân tử virus RYSV (hình trái, Shikata và Chen, 1969) và vị trí hình thành của các phân tử virus RYSV trong phần ngoại vi của nhân tế bào lúa (hình phải, Ou, 1985). Bộ gen đầy đủ của RYSV được cơng bố đầu tiên vào năm 2003 từ nguồn virus phân lập tại Trung Quốc (Huang et al., 2003). Tiếp theo, năm 2010, trình tự tồn bộ bộ gen của một mẫu RTYV từ Nhật Bản cũng được cơng bố (Hiraguri et al., 2010). So sánh trình tự của mẫu RTSV này với mẫu RYSV thấy chúng đồng nhất tới 98,5 % trên tồn bộ gen và trình tự amino acid của 7 protein của virus RYSV và RTYV giống nhau trong phạm vi từ 82,3 đến 99,7% (Hiraguri et al., 2010). Dựa trên kết quả so sánh này, Hiraguri et al. (2009) đã kết luận RTYV và RYSV là thành viên của cùng một lồi và các tác giả đã gửi mẫu RTSV lên Ngân hàng gen với tên RYSV. Theo luật ưu tiên, Ủy ban phân loại và danh pháp virus quốc tế (ICTV) đã phê chuẩn tên virus đại diện cho lồi này là RYSV. RYSV cĩ tổ chức bộ gen giống như của các rhabdovirus khác. Tổ chức bộ gen đầy đủ của mẫu RYSV (mã truy cập AB011257, Huang et al., 2003) cho thấy virus cĩ cĩ bộ gen RNA mạch thẳng, sợi đơn, cực âm, kích thước khoảng 14 kb. Virus cĩ một chuỗi nucleotide khoảng 203 nucleotide gọi là leader ở đầu 3’, một chuỗi 181 nucleotide gọi là trailer ở đầu 5’. Virus mã hĩa 7 protein, theo thứ tự từ trái sang phải là N-P-3-M- G-6-L. Tuy nhiên chỉ cĩ 5 protein cấu trúc cĩ mặt ở phân tử virus là N, P, M, G, L (Fang et al., 1994; Luo và Fang, 1998; Huang et al., 2003). Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 10 Hình 2.4. Sơ đồ tổ chức bộ gen của RYSV được xây dựng dựa trên mẫu AB011257 bằng phần mềm NTI (hãng Invitrogen) 2.4. Lan truyền của RYSV Virus RYSV thuộc nhĩm gây hại ở bĩ mạch phloem như các loại virus khác của chi nucleorhabdovirus (Nault và Ammar, 1989). Các nghiên cứu lan truyền cho thấy RYSV (hay RTYV) được truyền theo kiểu bền vững tái sinh (virus nhân lên trong vector) nhưng khơng truyền qua trứng (Chiu et al., 1965; 1968; Shieh et al., 1970; Chen và Shikata, 1971). Ba lồi rầy xanh đã được ghi nhận truyền RYSV (hay RTYV) là N. nigropictus, N. cincticeps và N. virescens (Hình 2.5), trong đĩ hiệu quả truyền bệnh cao nhất là của N. Nigropictus, tiếp theo là N. cincticeps và thấp nhất là N. virescens ; nhìn chung đối với rầy N. nigropictus, hiệu quả truyền của rầy đực cao hơn rầy cái, cịn đối với 2 loại rầy cịn lại thì khơng cĩ sự khác biệt đáng kể (Inoue, 1978). Hình 2.5. Hìn thái 3 lồi rầy xanh truyền RYSV. Từ trái sang phải lần lượt là là N. nigropictus, N. cincticeps và N. virescens. Chiu et al. (1965), Chiu & Jane (1967) khi nghiên cứu 3 lồi rầy này đã cho biết khoảng 41- 62% cá thể rầy cĩ khả năng truyền virus. Thời gian chích nạp của RYSV -AB011257, kích thước 14042 nucleotides N P 3 M G 6 L Trailer Leader 3’ 5’ Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 11 đa số (>50%) rầy là 1-2 giờ, nếu tăng thời gian chích nạp lên 1 ngày thì 90% rầy cĩ khả năng lan truyền ; thời kỳ ẩn trong vector từ 3-34 ngày nhưng thường 9-16 ngày ; Thời gian chích nạp thay đổi từ 5-10 phút, 5-10 giờ, 24 giờ sẽ làm tăng hiệu quả truyền tương ứng từ 28%, 45%, 88% ; thời kỳ ủ bệnh trong cây từ 2-4 tuần. Hseih (1969) khi nghiên cứu rầy N. Nigropictus đã cho biết khi nhiệt độ 380C, rầy khơng cĩ khả năng lan truyền ; trong khoảng nhiệt độ 20- 360C, nhiệt độ càng cao thì thời gian ẩn càng rút ngắn. Theo Chen (1979), Chen & Chiu (1980) khi cho rầy chích nạp trên lá biến vàng hay trên giống mẫn cảm thì hiệu quả truyền tương ứng là 28,8% và 34,4%, cịn khi cho rầy chích nạp trên lá đã phục hồi hoặc trên giống kháng thì hiệu quả truyền tương ứng chỉ là 3,3% và 9% ; rầy đực và rầy cám cĩ khả năng truyền virus hiệu quả hơn rầy cái ; mỗi rầy mang virus cĩ thể truyền bệnh cho «3 cây lúa/ngày. Khi nhiễm virus rầy cĩ khả nãng truyền bệnh cả đời. Virus cĩ thể làm rầy cám chết sớm trước khi trưởng thành và rầy bị giảm số trứng đẻ hay rút ngắn vịng đời. 2.5. Phương pháp chẩn đốn virus bằng ELISA 2.5.1. Nguyên lý của phương pháp huyết thanh học và ứng dụng Theo Gibbs & Harrison (1980), phương pháp dựa trên hiện tượng kháng nguyên gặp kháng thể đặc hiệu với nĩ thì xảy ra phản ứng kết tủa vẩn hoặc phản ứng ngưng kết. Khi virus (kháng nguyên) được tiêm vào cơ thể máu nĩng (thỏ, chuột..) thì hệ miễn dịch hình thành kháng thể (Ig) đặc hiệu virus. Kháng thể thường hình thành trong máu trong vịng một tuần và chủ yếu là IgM. Hiệu quả kháng huyết thanh tăng dần trong vài ngày, sau đĩ giảm cho đên khi chỉ con rất ít kháng thể. Nếu thỏ được tiêm tiếp với cùng một kháng nguyên đĩ thì kháng thể sẽ được hình thành nhanh, nhiều hơn, trong đĩ chủ yếu là IgG. IgG tồn tại trong máu thỏ lâu hơn IgM. Cả hai kháng thể này đều cĩ đáp ứng miễn dịch, nhưng trong chẩn đốn virus thực vật thường sử dụng IgG. Hầu hết các virus thực vật đều cĩ hoạt tính gây miễn dịch tốt hơn cho protein thực vật (Gibbs & Harrison). Thực tế hiện nay, chẩn đốn bằng kĩ thuật huyết thanh học được ứng dụng đối với nhiều loại virus và một số bệnh vi khuẩn. Phương pháp này khá đơn giản và chính xác với các kỹ thuật như khuyếch tán miễn dịch, điện di miễn dịch, latex và ELISA (phương._. pháp miễn dich và liên kết men) Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 12 2.5.2. Chế tạo kháng huyết thanh đa dịngđối với virus thực vật Theo Gibbs & Harrison (1980), một mẫu virus ở bất kỳ độ sạch nào cũng đều cĩ thể sử dụng để tạo kháng huyết thanh. Nhưng vì cơ thể động vật sẽ tạo kháng thể của các loại kháng nguyên cĩ trong mẫu virus nên mẫu virus càng sạch thì càng tốt để tạo ra kháng huyết thanh. Tất cả các lồi động vật cĩ xương sống đều cĩ thể tạo kháng thể nhưng đa số kháng huyết thanh virus thực vật đều tạo ra trên thỏ vì dễ thao tác. 2.5.3. Các yếu tố ảnh hưởng đến nồng độ kháng thể Tuyến tiêm Virus cĩ thể được tiêm vào máu thỏ qua tĩnh mạch ở mép tai (ven), vào cơ bắp, thường là vào bắp đùi chân sau thỏ, vào mơ liên kết ở dưới da hoặc hiếm hơn ở bàn chân (tiêm dưới da) hoặc thậm chí được tiêm vào hạch bạch huyết. Kháng thể thường đạt nồng độ tối đa khoảng 2 tuần sau khi tiêm ven, 4 đến 8 tuần sau khi tiêm bắp hoặc dưới da (Gibbs & Harrison, 1980). Số lần tiêm và số lượng virus đem tiêm Cùng một lượng virus nếu được tiêm làm nhiều lần sẽ được nhiều kháng thể hơn tiêm chỉ một lần. Matthew (1957) phát hiện thấy 4 lần tiêm mỗi lần 10µg virus TYMV (Turnip yellow mosaic virus), cách nhau 21 ngày đã tạo ra hiệu giá của kháng huyết thanh khơng tỷ lệ trực tiếp với số lượng virus tiêm vào. Theo Webster (1968), ở các thời điểm khác nhau sau khi tiêm, kháng thể tạo ra sẽ khác nhau khơng chỉ về loại mà cịn tính đặc hiệu. Ơng cho biết: Sau khi tiêm, kháng thể hình thành đầu tiên là IgM cĩ tính đặc hiệu rất thấp. IgM nhanh chĩng biến mất và thay vào đĩ là IgG. Những kháng thể IgG đầu tiên hình thành cĩ tính đặc hiệu rất cao, nếu tiếp tục tiêm, IgG sẽ tăng lên nhanh chĩng nhưng tính đặc hiệu lại giảm đi. Do vậy, kháng huyết thanh lấy sớm sẽ cĩ hiệu giá thấp nhưng rất đặc hiệu và ngược lại. Các chất tiêm cùng kháng nguyên Nếu tiêm ven, dich virus thường hịa trong dịch nước muối sinh lý 0.85% NaCl và chúa lượng tối thiểu các chất gây độc cho thỏ như các muối phosphate, borate và các ion khác. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 13 Nếu tiêm bắp, tiêm dưới da, dịch virus được trộ với các chất cĩ tác dụng tăng cường hoạt tính miễn dịch. Chất phổ biến là Freurds adjuvant. Thời gian giữa các lần tiêm Cách hiệu quả nhất để tạo kháng huyết thanh cao khi tiêm thỏ la tiêm với số lượng virus trung bình (tối đa 1µg virus/ml) ở các khoảng thời gian cách nhau xa và cĩ sử dụng adjuvant. Govier (1958), thấy tiêm PVX 2 lần bằng cách tiêm ven, mỗi lần cách nhau 1 tháng sẽ cĩ hiệu giá kháng thể cao hơn 8 lần so với tiêm bắp 1 lần hoặc tiêm ven nhiều lần, mỗi lần cách nhau 2 tuần. 2.5.4. Các kỹ thuật ELISA Theo Hull (2000), dựa vào quan hệ của kháng thể liên kết enzyme với kháng nguyên, ELISA cĩ thể được chia làm 2 nhĩm (Hình 2.6) là: • Nhĩm trực tiếp (direct ELISA): Kháng thể liên kết enzyme là kháng thể phát hiện kháng nguyên (ví dụ các kỹ thuật I, VIII và IX trong hình 2.6). • Nhĩm gián tiếp (indirect ELISA): Kháng thể liên kết enzyme khơng phải là kháng thể phát hiện kháng nguyên (ví dụ các kỹ thuật II, III, IV, V, VI, VI trong hình 2.6). ELISA cũng gồm rất nhiều kỹ thuật khác nhau. Hai kiểu phổ biến nhất thường áp dụng cho chẩn đốn virus thực vật là: • Kẹp kép kháng thể (double antibody sandwich = DAS). ðây là kỹ thuật được phát triển đầu tiên bởi Clark & Adams (1977). Trong kỹ thuật này, kháng thể IgG đặc hiệu virus được cố định vào bản ELISA cĩ vai trị để bẫy virus. Tiếp theo, kháng thể đặc hiệu virus liên kết với enzyme alkaline phosphatase (AP) sẽ liên kết với virus bị bẫy và enzyme sẽ thủy phân một cơ chất là nitrophenyl phosphate (NPP) vốn khơng màu thành nitrophenol phosphate cĩ màu vàng. Trong hình 2.6, ngoại trừ kỹ thuật II thì tất cả các kỹ thuật cịn lại đều là DAS-ELISA • Bẫy kháng nguyên trước (plate-trapped antigen = PTA). ðây là một dạng đơn giản của ELISA (Mowat & Dawson, 1987). Trong kỹ thuật này, dịch cây chứa virus sẽ được cố định trước vào giếng ELISA. Tiếp theo, kháng thể đặc hiệu virus tinh chiết hoặc phổ biến là kháng huyết thanh thơ được cố định vào bản. ðể phát hiện liên kết này, một kháng thể thứ hai liên kết với AP đặc hiệu với kháng thể của virus sẽ được cho vào giếng. Trong hình 2.6. Kỹ thuật II là PTA-ELISA. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 14 Hình 2.6. Các kỹ thuật ELISA khác nhau (Hull, 2000) 2.6. Chẩn đốn virus RYSV bằng ELISA Các nghiên cứu về ứng dụng ELISA trong chẩn đốn rất ít. Takahashi et al (1988) đã thí nghiệm đánh giá 2 kỹ thuật ELISA dùng kháng thể đặc hiệu RYSV là kỹ thuật DAS-ELISA và kỹ thuật ELISA đơn giản hĩa. Trong kỹ thuật DAS- ELISA, tác giả đã thử nghiệm 1 loạt các đệm chiết mẫu khác nhau bao gồm đệm phosphate, đệm phosphate chứa NaCl và Tween20 (đệm PBS-T), đệm citrate và đệm Tris-Cl. Các tác giả kết luận rằng đệm PBS-T là đệm tốt nhất để chiết mẫu. Trong kỹ thuật ELISA đơn giản hĩa, các tác giả đã ủ đồng thời dịch virus và kháng thể liên kết AP. Các tác giả đã chứng minh rằng bước kết hợp này khơng ảnh hưởng đến độ nhạy và tính đặc hiệu. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 15 3. ðỊA ðIỂM, VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1. Nội dung nghiên cứu 1. ðiều tra bệnh vàng lụi, kiểm tra virus bằng RT- PCR và ELISA. 2. Thử nghiệm tạo kháng huyết thanh đặc hiệu phân tử virus RYSV và đánh giá các điều kiện để tối ưu hĩa phản ứng ELISA. 3. Dịng hĩa và giải trình tự một phần gen virus RYSV. 3.2. ðịa điểm nghiên cứu chính Trung tâm bệnh cây nhiệt đới, Trường đại học Nơng nghiệp Hà Nội. 3.3. Vật liệu liệu nghiên cứu chính 3.3.1. Vật liệu thu thập mẫu cây và rầy • Silicagel tự chỉ thị • Ống falcol hoặc lọ nhựa để xử lý mẫu • Khay, vợt • Ethanol 70% • Tube đựng mẫu • Chậu nhựa trồng cây • Lồng trồng cây chống rầy 3.3.2. Vật liệu thử nghiệm tạo kháng huyết thanh và chẩn đốn ELISA • ðộng vật dùng để sản xuất kháng huyết thanh là thỏ đã trưởng thành, cĩ sức khỏe tốt, trọng lượng ≥ 2kg, được nuơi tại Trung tâm Bệnh cây Nhiệt đới. • Bản ELISA 3.3.3. Hĩa chất, dung dịch đệm, mơi trường • ðệm điện di agarose (1X TAE): 10 mM Tris-acetate, 0.5 mM EDTA (pH 7.8). • ðệm CTAB: 2% CTAB (hexadecyltrimethylammonium bromide), 2% PVP (polyvinylpyrrolidone), 100 mM Tris-HCl pH 8.0 và 25 mM EDTA • ðệm TE, pH8: 10 mM Tris-Cl and 1 mM EDTA • ðệm chiết phân tử virus: 0.1 M citrate natri, pH 6.5 chứa 10 % đường Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 16 sucrose, 0.2 % Na2SO3 và 4 % bột than hoạt tính. • ðệm hịa virus: đệm phosphate 0.01 M, pH 7.2 chứa 0.85 % NaCl. • Dung dịch đường sucrose 12 % • Dung dịch đường sucrose 50 % • ðệm carbonate (pH 9.6) (1L):1.59 g Na2CO3, 2.93 g NaHCO3, 0.02 g NaN3. Hịa các chất trong 900 ml H2O, chỉnh pH = 9.6 với HCl và lên thể tịch 1 L. • ðệm PBS (pH 7.4): 8.0 g NaCl, 0.2 g KH2PO4, 1.15 g Na2HPO4.12H2O, 0.2 g KCl, 0.02 g NaN3. Hịa các chất trong 900 ml H2O, chỉnh pH = 4.4 và lên thể tịch 1 L. • ðệm PBS-T: đệm PBS + 0.5 ml Tween 20 /L • ðệm hịa kháng huyết thanh và kháng thể liên kết AP: PBS-T + 2% PVP + 0.2% albumin • ðệm cơ chất (pH 9.6) (cho 1 L): 97 ml diethanolamine, 600 ml H2O, 0.02 g NaN3 • Beta-mercaptoethanol (βME) • ðệm chiết Chloroform:isoamyl alcohol (24:1) • Dung dịch 10 M LiCl • Mơi trường LB lỏng (1 L): 10 g Bacto®-tryptone, 5 g Bacto®-yeast extract và 5 g NaCl. Hấp khử trùng 121 oC 20 phút. • Mơi trường LB agar chứa kháng sinh ampicillin: Thành phần giống mơi trường LB lỏng nhưng chứa 15 g agar/L và cĩ bổ sung ampiciline (100 mg/L). Kháng sinh cho vào mơi trường đang ấm khoảng 55 oC trước khi rĩt ra đĩa petri. • Chất nền NPP: nitrovinyl phosphate, dạng viên nen 5 mg/viên (Sigma) 3.3.5. Các enzyme và kit thương mại • RevertAid Premium First Strand cDNA Synthesis Kit (hãng Fermentas): kít tổng hợp sợi cDNA • ReverseDreamTaq (Fermentas): DNA polymerase chịu nhiệt • Expand Long Template PCR System (Roche): hỗn hợp enzyme chịu nhiệt tổng hợp sợi DNA dài Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 17 • AccuPrep Plasmid Extraction Kit (Bioneer): kít tinh chiết plasmid • AccuPrep Gel Purification Kit (Bioneer): kit thơi gel • Tripure (Roche): kít tinh chiết RNA tổng số • InsTAclone PCR Cloning Kit (Fermentas) dùng vector pTZ57R/T • BamHI và ECoRI (Fermentas): enzyme cắt giới hạn 3.3.6. Các thiết bị chủ yếu • Máy PCR • Máy đọc ELISA • Máy li tâm và siêu li tâm • Thiết bị điện di • Buồng cấy 3.4. Phương pháp nghiên cứu 3.4.1.Phương pháp điều tra bệnh đồng ruộng ðiều tra bệnh vàng lụi tại một số tỉnh thuộc miền Bắc Việt Nam (đặc biệt vụ mùa) Chỉ tiêu đánh giá: Cường độ bệnh: • Tần suất bắt gặp (số điểm cĩ bệnh/ số điểm quan sát) • Tỷ lệ bệnh (Số cây cĩ triệu chứng /số cây quan sát). • Triệu chứng biểu hiện 3.4.2. Phương pháp thu thập và xử lý mẫu Mẫu cây: 1. Lúa 2. Cỏ hịa thảo (xung quanh bờ ruộng lúa hoặc ngơ bị bệnh nặng) ðối với mỗi loại triệu chứng: thu thập 3- 5 mẫu. Các mẫu phải được số liệu hĩa • Hình ảnh • ðịa điểm • Thời gian thu thập • Giai đoạn sinh trưởng • Giống (đối với lúa và ngơ), lồi đối với cỏ. • Mơ tả chi tiết triệu chứng Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 18 • Các nghi vấn (thuốc trừ cỏ, tuyến trùng…) nếu cĩ Xử lý: Mẫu phải được xử lý khơ bằng silicagel ngay lập tức sau khi thu thập 3.4.3. Phương pháp bảo quản mẫu Cĩ hai phương pháp bảo quản mẫu: bảo quản khơ và bảo quản tươi • Bảo quản khơ: Mẫu thu về được để trong túi chứa hạt Silicagel. Thay hạt Silicagel đến khi mẫu khơ • Bảo quản tươi: Mẫu thu về ngày hơm trước để nguyên trong túi giữ lạnh ở tủ -20 OC hay bảo quản trong túi nilon và giữ ẩm ở Trung tâm Bệnh cây nhiệt đới. 3.4.4. Phương pháp chiết RNA tổng số từ mơ lá Quy trình chiết tách RNA tổng số hoặc bằng kít Tripure theo hướng dẫn của nhà sản xuất hoặc bằng phương pháp CTAB/LiCl của Chang et al. (1993). Qui trình chiết theo phương pháp CTAB/LiCl như sau: • Trước khi chiết: ủ đệm CTAB + βME (10 µl/ ml đệm) ở 60 oC trong 30 phút bằng bể nhiệt. • Lấy 0,2 g mơ lá bệnh, nghiền trong 1ml đệm CTAB bằng chày cối sứ. Cho dịch nghiền vào tube 1,5ml, ủ 60 oC 30 phút (để ở nhiệt độ phịng 10 phút cũng cho kết quả tốt đối với một số loại mơ dễ như cà chua) • Li tâm 13000g 5 phút để loại bỏ tàn dư, thu dịch trên tủa. • Cho Chloroform/Isoamyl (24:1) vào tube với thể tích tương đương, trộn đều. • Li tâm 13000g 5 phút. Hút dịch trên tủa chuyển sang tube mới. • Chiết lại lần 2 bằng Chloroform/Isoamyl • Bổ sung vào tube dịch trên tủa vừa thu được một lượng LiCl 10M (= 1 /4 thể tích dịch trên tủa). ðể lạnh 15 phút. • Li tâm 13000g 10-15 phút, thu cặn RNA. • Rửa cặn 2 lần bằng Ethanol 70%. • ðể khơ tự nhiên trong khơng khí tối thiểu là 30 phút. • Hồ tan cặn RNA trong 50 µl nước cất vơ trùng (hoặc nước DEPC) và bảo quản -80 oC. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 19 3.4.5. Phản ứng RT – PCR Hai cặp mồi đặc hiệu gen N và L của RYSV (Rice yellow stunt virus) đã được thiết kế từ bộ gen đầy đủ của RYSV sẵn cĩ trên Ngân hàng gen (mã số truy cập AB011257). Cặp mồi thứ nhất đặc hiệu gen N (RY-N-F1 và RY-N-R1) tạo sản phẩm cĩ kích thước 444 bp cịn cặp mồi thứ 2 đặc hiệu gen L (RY-L-F2/RY-L-R2) tạo sản phẩm 422 bp. Trình tự các mồi này là: RY-N-F1 GCCAGTGCAGATGCCTTATTAGTC RY-N-R1 GGTCTCTGCCTCTGTCATTCGTTC RY-L-F2 AGGTACCAAGACGGCTCAACTATG RY-L-R2 AAGGTGGGGAAGGTCGGAATC Phản ứng RT-PCR được thực hiện theo 2 cách • RT-PCR 1 bước: Kết hợp cả bước tổng hợp cDNA và PCR, dùng kít • RT-PCR 2 bước: đầu tiên, RNA của virus được chuyển thành cDNA. Tiếp theo, cDNA được dùng làm khuơn để chạy PCR RT-PCR 1 bước: Phản ứng RT-PCR được thực hiện với 2 enzyme Reverse Aid và Dreamtaq của hãng Fermentas. Phản ứng được thực hiện trong tube Effpendorf 0.5 ml chứa các thành phần sau: Tên Lượng (µl) H2O 15.6 ðệm DreamTaq (x10) 2.0 dNTPs 0.3 Mồi xuơi dịng 0.3 Mồi ngược dịng 0.3 ReverseAid 0.2 Dream Taq 0.3 RNA 1 Tổng thể tích 20 Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 20 Phản ứng RT – PCR 1 bước được thực hiện theo các điều kiện sau: - Tổng hợp sợi cDNA trong 30 giây ở 45 OC - Khởi đầu biến tính 4 phút ở 94 OC - Tiến hành 35 chu kỳ phản ứng ở 94 OC trong 35 giây; 54 OC trong 35 giây; 72 OC trong 1 phút - Cuối cùng là bước kết thúc ở 72 OC trong 5 phút. RT-PCR 2 bước Bước 1 (tổng hợp cDNA) được thực hiện với kit RevertAid Premium First Strand cDNA Synthesis Kit (hãng Fermentas) và bằng mồi RY-L-R2. Phản ứng được thực hiện theo hươnga dẫn của nhà sản xuất với nhiệt độ tổng hợp là 50 oC và thời gian 60 phút. Bước 2 (phản ứng PCR) được thực hiện với khuơn cDNA ở bước 1 với kit Expand Long Template PCR System (hãng Roche) dùng 3 tổ hợp mồi: (i) RY-N-F1/RY- L-R2, (ii) RY-N-F1/RY-N-R1, và (iii) RY-L-F2/RY-L-R2. Phản ứng PCR được thực hiện với enzyme Dreamtaq hoặc hoặc dùng kit Expand Long Template PCR System. Phản ứng được thực hiện trong tube Effpendorf 0.5 ml chứa các thành phần sau: Tên Lượng (µl) H2O 21.3 ðệm phản ứng (x10) 2.5 dNTPs 0.3 Mồi xuơi dịng 0.3 Mồi ngược dịng 0.3 Dream Taq hoặc Enzyme mix (kit Expand) 0.3 cDNA 1 Tổng thể tích 25 Phản ứng PCR ở bước 2 được thực hiện theo các điều kiện sau: - Khởi đầu biến tính 4 phút ở 94 OC - Tiến hành 35 chu kỳ phản ứng ở 94 OC trong 35 giây; 54 OC trong 35 giây; 72 OC trong 1 (hoặc 10) phút tùy tổ hợp mồi. - Cuối cùng là bước kết thúc ở 72 OC trong 5 phút. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 21 3.4.6. ðiện di agarose - Chuẩn bị gel 1%: Cân 1g agarose hịa tan trong 100 ml đệm TAE, đem đun trong lị vi sĩng để agarose tan hồn tồn, sau đĩ bổ sung thêm 1µl dung dịch Ethidium bromide. - Chuẩn bị khay đựng gel và chọn lược với lượng giếng thích hợp số mẫu cần chạy điện di. Tiếp theo đổ gel khi nhiệt độ khoảng 50 OC. Khi gel đơng đem đặt vào bể điện di, đổ ngập bản gel bằng đệm TAE. - Cài mẫu: Lấy 10 µl sản phẩm PCR + 2µl Loading Dye cho vào các giếng của bản gel. - ðiện di với hiệu điện thế 100V trong khoảng 30 phút. - Kiểm tra kết quả PCR dưới ánh sáng cực tím 3.4.7. Dịng hĩa và giải trình tự • Sản phẩm RT-PCR được tinh chiết từ gel agarose dùng kít tinh chiết AccuPrep Gel Purification Kit (Bioneer) theo hướng dẫn của nhà sản xuất. Hàm lượng DNA được ước lượng nồng độ bằng điện di agarose. • Sản phẩm PCR tinh chiết được nối vào vector pTZ57R/T của kít dịng hĩa InsTAclone PCR Cloning Kit theo hướng dẫn của nhà sản xuất và được biến nạp vào tế bào vi khuẩn Escherichia coli dịng XL1-Blue bằng phương pháp sốc nhiệt. • Plasmid được tinh chiết dùng kít tinh chiết plasmid AccuPrep Plasmid Extraction Kit (Bioneer) theo hướng dẫn của nhà sản xuất. • Các dịng vi khuẩn tái tổng hợp được kiểm tra sự cĩ mặt của vector tái tổ hợp đúng bằng 2 cách: • Kiểm tra PCR (dùng mồi Vector SeqFor và Vector SeqRev được thiết kế sẵn tương ứng với trình tự của vector) • Cắt kép bằng 2 enzyme cắt giới hạn là BamHI và EcoR1. Tổng phản ứng cắt là 10 µl chứa 2 µl plasmid và 0.5 µl mỗi loại enzyme cắt giới hạn. Hỗn hợp được ủ 37 oC trong 1 giờ và được phân tích bằng điện di agarose 1% • Plasmid tái tổ hợp được giải trình tự dùng kít BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) trên máy PCR. Sản phẩm giải trình tự được tinh chiết, làm khơ và gửi đọc tại Viện Cơng nghệ sinh học tại Hà Nội. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 22 • Trình tự nucleotide được biên tập và lắp ráp dùng phần mềm Seqman (DNASTAR, LaserGene). 3.4.8. Phân tích trình tự Danh tính trình tự các mẫu được xác định khi so sánh với các chuỗi GenBank bằng phần mềm tìm kiếm BLAST tại NCBI (the National Center for Biotechnology Information ( Các phân tích trình tự và phả hệ được thực hiện với phần mềm NTI, BioEdit và MEGA 3.4.9. Tinh chiết phân tử virus RYSV Qui trình chiết phân tử RYSV từ lúa được thực hiện theo qui trình chiết virus Cynodon chlorotic streak virus (CCSV) trên cỏ Bermuda (Lockhart et al.,1985). Các bước cụ thể như sau: • Nghiền mẫu bệnh: Khoảng 100 g mơ lá lúa nhiễm RYSV (đã được kiểm tra RT-PCR) được nghiền với 400 mL đệm citrate (sodium citrate) 0.1 M, pH 6.5 chứa 10 % đường sucrose, 0.2 % Na2SO3 và 4 % bột than hoạt tính. Mơ lá được nghiền trong đệm lạnh bằng máy nghiền sinh tố. Lọc dịch nghiền bằng vải lọc. • Acid hĩa dịch nghiền: Sau khi lọc dịch nghiền qua vải lọc, dịch được acid hĩa tới pH 0.5 bằng nhỏ từ giọt acid acetic đậm đặc (acid acetic băng). Dịch được giữ ở 4 OC trong 2 – 4 giờ. • Làm trong: Dịch được làm trong bằng ly tâm ở 17400 g trong 20 phút bằng máy ly tâm Beckman Algera 64G. Lấy dịch trong và loại bỏ cặn. • Sa lắng virus: Sa lắng virus trong dịch trong ở trên bằng siêu ly tâm ở 91500 g trong 30 phút (máy siêu ly tâm Beckman Optima L-90K). Hịa cặn virus trong đệm phosphate 0.01 M, pH 7.2 chứa 10 % đường sucrose và 0.85 % NaCl. • Tách virus bằng ly tâm gradient tỷ trọng. Dịch virus ở trên được tách bằng ly tâm trên nệm gradient tỷ trọng đường sucrore (12-50%). Nệm tỷ trọng được chuẩn bị với đệm phosphate 0.01 M, pH 7.2 chứa 0.85 % NaCl. Nệm tỷ trọng được ly tâm ở 107000 g trong 45 phút. • Thu thập vùng chứa virus bằng xi ranh y tế. • Kết tủa lại virus bằng ly tâm vùng chứa virus ở 139000 g trong 30 phút. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 23 Hịa cặn virus tinh chiết trong 1 mL đệm phosphate 0.01 M, pH 7.2 chứa 0.85 % NaCl. ðây là dịch virus đã tinh chiết. Kiểm tra dịch virus tinh chiết bằng RT-PCR và bảo quản ở - 20 O C. 3.4.10. Tạo kháng huyết thanh virus trên thỏ • Tiêm hỗn hợp gồm 0.5 mL dịch virus + 0.5 ml chất tăng cường miễn dịch (complet adjuvant) vào bắp đùi sau của thỏ. Tiêm 4 lần, mỗi lần cách nhau 1 tuần. • Huyết thanh thỏ được thu thập sau lần tiêm thứ 2 từ động mạch tai của thỏ (khoảng 0.5 mL). Máu thỏ được ly tâm 13000g 5 phút và lấy dịch kháng huyết thanh trên tủ. Sự cĩ mặt của kháng thể được đánh giá bằng phương pháp PTA- ELISA. • Khi kháng thể virus hình thành đủ nhiều thì giết thỏ và thu thập tồn bộ kháng huyết thanh. Khi thử, thấy hiệu giá kháng huyết thanh cao, tiến hành giết thỏ để thu tồn bộ máu. • Máu thu từ thỏ, được làm đơng trong vịng 24 giờ ở nhiệt độ 4oC. Sau đĩ dùng lấy phần huyết tương ở trên để riêng. Phần máu thỏ đơng được ly tâm 10000g/ 15 phút để lấy dịch kháng huyết thanh sau li tâm. Phần này cũng được để riêng. • Huyết tương và kháng huyết thanh sau ly tâm được bổ sung NaN3 0,2% và bảo quản ở tủ lạnh sâu (-20oC) 3.4.11. Phương pháp ELISA Phương pháp ELISA được sử dụng dùng để đánh giá chất lượng kháng huyết thanh là phương pháp bẫy kháng nguyên trước (PTA-ELISA = Plate Trapped Antigen – ELISA ) (Mowat & Dawson, 1987. Các bước của một kỹ thuật PTA-ELISA chuẩn như sau: Bước 1: Cố định dịch cây cần kiểm tra - Nghiền 0,1 g mẫu lá cây cần kiểm tra trong đêm carbonate với tỉ lệ lá/dung dịch đệm từ 1/5 – 1/30 (khối lượng/thể tích). - Ly tâm 13000 vịng/phút, thu lấy dịch trên tủa. - Nhỏ dịch mẫu vào bản ELISA: 100 µl /giếng. ðể bản ELISA vào hộp ẩm và ủ qua đêm trong tủ lạnh. - Rửa bản ELISA: Tiến hành 3 lần bằng đệm PBS-T rồi rửa lại 3 lần bằng nước Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 24 cất. Mỗi lần rửa cách nhau 1 phút. Bước 2: Cố định kháng thể thỏ đặc hiệu virus - Nghiền mẫu lá cây khoẻ trong dung dịch đệm kháng huyết thanh (PBS-T +2% Ovalbumin). Li tâm 10000g trong 15 phút và thu dịch trên tủa. - Cho kháng huyết thanh vào dịch cây khoẻ theo tỷ lệ 1/100 – 1/1000, trộn đều và ủ ở 37oC trong 45 phút để hấp thụ chéo các kháng thể khơng đặc hiệu cĩ trong kháng huyết thanh (kháng thể khơng đặc hiệu là kháng thể phản ứng với protein của cây). - Nhỏ vào mỗi giếng 100 µl dịch cây khoẻ chứa kháng huyết thanh ở trên. Sau đĩ để bản ELISA trong hộp ẩm và để trong điều kiện nhiệt độ 37oC trong thời gian 2 – 4 giờ. - Rửa bản ELISA (như ở bước 1) Bước 3: Cố định kháng thể chuột liên kết AP (Alkaline phosphatase) đặc hiệu kháng thể thỏ. - Pha kháng thể chuột liên kết AP đặc hiệu kháng thể thỏ trong đệm kháng huyết thanh theo tỉ lệ 1/5000. - Nhỏ vào mỗi giếng 100 µl dịch kháng thể chuột ở trên. - ðể bản ELISA trong hộp ẩm và ủ ở 37oC trong 2-4 giờ. - Rửa bản ELISA (như ở bước 1) Bước 4: Cố định chất nền (nitrophenyl photphat) - Pha chất nền trong đệm cơ chất với lượng 1 mg/mL - Nhỏ 100 µl dịch chất nền vào mỗi giếng - ðể bản ELISA ở nhiệt độ phịng, trong tối, trong 30-60 phút - ðánh giá kết quả bằng mắt và đo mật độ quang OD (optical density) bằng máy đọc ELISA ở bước sĩng 405 nm. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 25 4. KẾT QUẢ NGHIÊN CỨU 4.1. ðiều tra bệnh vàng lụi năm 2011 4.1.1. Triệu chứng bệnh vàng lụi tại các điểm điều tra Bệnh virus hại lúa gây bệnh vàng lụi (cịn gọi là bệnh vàng lá) xuất hiện ở Việt Nam từ những năm 60 của thế kỷ trước ở nước ta. Gần đây bệnh đã xuất hiện tại một số tỉnh miền Bắc như Bắc Giang, Hà Nội, Hà Nam. Hiện nay, nhiều cơ quan liên quan đến Bảo vệ Thực vật, bao gồm ðại học Nơng nghiệp Hà Nội, Viện Bảo vệ thực vật, các Chi cục Bảo vệ Thực vật tại một số tỉnh miền Bắc vẫn đang điều tra, đánh giá, phát hiện sự cĩ mặt của bệnh. ðể đĩng gĩp vào việc kiểm sốt bệnh, chúng tơi tiến hành điều tra nguồn bệnh trên lúa vụ xuân và vụ mùa năm 2011 tại một số tỉnh miền Bắc. Việc phát hiện triệu chứng bệnh dựa theo triệu chứng đặc trưng của bệnh. Kết quả điều tra cho thấy: Tại một số tỉnh miền Bắc, triệu chứng “vàng lụi” trên lúa khá phổ biến. Bệnh cĩ thể xuất hiện ở cả ở vụ lúa xuân và vụ lúa mùa, biểu hiện từ khi lúa đẻ nhánh đến khi thu hoạch, đặc biệt xuất hiện nhiều ở giai đoạn đẻ nhánh, đứng cái, trỗ bơng. Kết quả điều tra cho thấy: Các khu đồng bị bệnh thường nằm ở khu vực ven chân núi, chân đồi. Những ruộng bị nặng thường ở trị trí trũng, đất sình lầy của cánh đồng. ðất và nước ruộng lúa bị bệnh khơng cĩ biểu hiện sặc chua. Khi bệnh mới phát sinh, đầu mút lá bánh tẻ biến màu vàng nhạt, lan dần xuống phía dưới. Ban đầu chỉ phiến lá biến vàng, các gân chính, gân phụ vẫn cịn xanh, khi bệnh nặng tồn bộ lá biến màu vàng – vàng cam, gân chính chuyển màu vàng sau cùng. Hầu hết các lá vàng đều từ đầu mút lá xuống nhưng cĩ một số lá chỉ vàng một nửa phiến lá cịn nửa kia vẫn xanh. Lá bị bệnh thường là các lá bánh tẻ bị trước, lá già bị sau; khi bệnh nặng lá non cũng bị biến màu vàng. Ban đầu chỉ một số lá, dảnh/khĩm bị biến vàng, bệnh nặng thì cả khĩm biến Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 26 màu vàng, nhiều dảnh chết. Những ruộng mới bị bệnh, các dảnh lúa bệnh thường rải rác khắp ruộng, khi bệnh phát triển rõ hơn thì ven bờ ruộng cĩ tỷ lệ vàng lá nhiều hơn, sau đĩ bệnh nặng thì lan khắp ruộng. Bộ rễ cây bệnh nặng kém phát triển, ít rễ con hơn cây khỏe. Trong nhiều trường hợp, cây lúa cĩ chiều cao bình thường, đẻ nhánh trung bình, gân chính màu xanh, phiến lá biến vàng, lá biến vàng thường bắt đầu từ đỉnh lá và trên cây thì các lá phía dưới biến vàng trước sau đĩ mới lan lên các lá phía trên. Cây lúa vẫn trỗ bơng song cho năng suất khơng cao. Triệu chứng cĩ thể rất nặng nếu nhiễm bệnh trong giai đoạn cịn non. Cây thường bị rất lùn, các lá bệnh thường ngắn, chiều cao cây chỉ đạt 60-70% so với trung bình, phiến lá vàng, đơi khi cây bị nặng cĩ nhánh bị chết khơ, khả năng phục hồi và cho năng suất rất thấp. Cây lúa bị bệnh cĩ thể khơng cĩ bơng hoặc rất ít bơng nhưng hạt bị lép. Cĩ thể tĩm tắt các triệu chứng bệnh dưới một số triệu chứng điển hình sau (Hình 4.1): • Vàng lá dạng khảm sọc. Cả lá biến vàng, thường từ ngọn lá trước sau lan xuống phần phía dưới, nhưng gân vẫn cịn xanh. Cây cĩ thể lùn hoặc khơng bị lùn. ðây là triệu chứng khá điển hình và cĩ giá trị chẩn đốn. • Vàng lá da cam. Lá cĩ màu vàng sáng, khơng thê phân biệt được với các dạng vàng sinh lý. • ðỏ lá. Trên cây bệnh, bộ lá bị biến vàng nhưng màu vàng rất đậm, đặc biệt là các lá ngồi cùng. • Vàng lùn. Cây lùn mạnh, bộ lá biến vàng và khơng cĩ khả năng phục hồi. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 27 Hình 4.1. Một số triệu chứng điển hình của cây lúa bị bệnh vàng lá do RYSV tại miền Bắc vụ xuân 2011. Từ trái sang phải: biến vàng dạng khảm sọc, vàng lá da cam và vàng lùn 4.1.2. ðiều tra tình hình bệnh vụ xuân năm 2011 ðể xác định được mức độ nhiễm bệnh vàng lụi ở vụ xuân năm 2011, chúng tơi tiến hành điều tra bệnh vàng lụi ở một số tỉnh phía Bắc: Bắc Giang, Nam ðịnh, Gia Lâm – Hà Nội, Hà Tây, Hịa Bình. Kết quả điều tra được thể hiện dưới bảng: Bảng 4.1. Bệnh vàng lá lúa vụ xuân năm 2011 tại một số tỉnh phía Bắc ðịa điểm Giai đoạn sinh trưởng Ngày điều tra Mức độ phổ biến TLB (%) ðẻ nhánh 17/03/2011 - 0 ðứng cái – Làm địng 07/04/2011 - 0 ðại học Nơng nghiệp Hà Nội Trỗ 17/05/2011 - 0 ðẻ nhánh 19/03/2011 - 0 ðứng cái – Làm địng 08/04/2011 - 0 Gia Lâm – Hà Nội Trỗ 16/05/2011 - 0 ðẻ nhánh 12/03/2011 + 2.6 ðứng cái – Làm địng 05/04/2011 + 3.8 Hiệp Hịa – Bắc Giang Trỗ 15/05/2011 + 3 ðẻ nhánh 22/03/2011 - 0 ðứng cái – Làm địng 19/04/2011 - 0 Nghĩa Hưng – Nam ðịnh Trỗ 22/05/2011 - 0 Thành phố Hịa Bình ðứng cái – Làm địng 15/04/2011 - 0 Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 28 Ghi chú: - : Khơng gặp + : Ít gặp, tỷ lệ bệnh < 4% ++: Trung bình, tỷ lệ bệnh 5% -÷ <10% +++: Gặp nhiều, tỷ lệ bệnh ≥ 10% Hình 4.2. ðiều tra bệnh và thu thập rầy xanh đuơi đen tại xã Hịa Sơn – Hiệp Hịa – Bắc Giang vụ xuân 2011 Nhận xét: Trong quá trình điều tra diễn biến của bệnh thì chúng tơi nhận thấy rằng bệnh hầu như khơng xuất hiện ở các tỉnh . Tỉnh Bắc giang là tỉnh cĩ xuất hiện bệnh tuy nhiên với tỉ lệ bệnh thấp (5%). Bắc Giang là nơi thuận lợi cho sự sinh trưởng và phát triển của rầy xanh đuơi đen – mơi giới truyền bệnh virus vàng lụi (RYSV) với giai đoạn nhiễm nặng là giai đoạn đẻ nhánh cho đến khi trỗ, bệnh phát sinh chủ yếu trên giống khang dân do ở khu vực này nơng dân cấy phần lớn là giống này. Tuy nhiên tỷ lệ bị bệnh năm nay giảm rất nhiều so với những năm trước vì do điều kiên thời tiết khơng thuận lợi cho quá trình phát triển của rầy. Chúng tơi cũng đã tiến hành điều tra bệnh vàng lụi tại một số điểm thuộc Gia Lâm (Hà Nội), đặc biệt tại các ruộng thí nghiệm thuộc ðại học NN Hà Nội, tuy nhiên khơng phát hiện thấy bệnh. Tĩm lại, tỉ lệ bệnh là thấp trong vụ xuân năm 2011. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 29 4.1.3. ðiều tra bệnh vụ mùa 2011 Chúng tơi tiếp tục tiến hành quá trình điều tra ở vụ mùa năm 2011 ở một số tỉnh phía Bắc. Kết quả được thể hiện ở bảng 4.2: Bảng 4.2. Bệnh vàng lá lúa vụ mùa năm 2011 tại một số tỉnh phía Bắc ðịa điểm Giai đoạn sinh trưởng Ngày điều tra Mức độ phổ biến TLB (%) ðẻ nhánh 25/07/2011 - 0 ðại học Nơng nghiệp Hà Nội ðứng cái 10/08/2011 - 0 ðẻ nhánh 19/07/2011 - 0 Gia Lâm – Hà Nội ðứng cái – Làm địng 09/08/2011 - 0 ðẻ nhánh 22/07/2011 + 3.5 Hiệp Hịa – Bắc Giang ðứng cái – Làm địng 08/08/2011 + 4.5 ðẻ nhánh 27/07/2011 - 0 Nghĩa Hưng – Nam ðịnh ðứng cái 12/08/2011 - 0 Ba Vì – Hà Tây ðẻ nhánh 05/08/2011 ++ 8.2 Ghi chú: - : Khơng gặp + : Ít gặp, tỷ lệ bệnh < 4% ++: Trung bình, tỷ lệ bệnh 5% -÷ <10% +++: Gặp nhiều, tỷ lệ bệnh ≥ 10% Qua bảng số liệu cho thấy mức độ nhiễm bệnh nặng nhất diễn ra ở Ba Vì – Hà Tây với tỉ lệ lên tới 10%, tiếp đến là ở Bắc giang cĩ xuất hiện bệnh (<5%). Tuy nhiên so với vụ xuân thì bệnh đã giảm đáng kể do bà con nơng dân đã phun trừ rầy xanh đuơi đen khi ở giai đoan mạ và thực hiện biện pháp thay đổi giống lúa trồng nên tỉ lệ bệnh giảm rõ rệt. Tại Nam định, chưa cĩ sự xuất hiện của rầy xanh đuơi đen cũng như bệnh vàng lụi trong giai đoạn đầu vụ mùa năm 2011 và ở Gia Lâm – Hà Nội, cĩ xuất hiện những triệu chứng vàng lá nhưng khơng điển hiển cho bệnh vàng lụi. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 30 Hình 4.3. ðiều tra bệnh vàng lá và thu thập rầy xanh đuơi đen tại xã Phú Cường (Ba Vì – Hà Nội) vụ mùa năm 2011. Cán bộ địa phương giúp đỡ thu mẫu gồm chị Thu (phịng Kinh tế huyện Ba Vì), chị ? phĩ CN HTX Phú Cường) và anh Vinh (trạm BVTV huyện Ba Vì). Ảnh ngồi cùng là cây lúa bị bệnh vàng lá với triệu chứng vàng lùn và vàng lá dạng khảm sọc. Hình 4.4. ðiều tra bệnh vàng lá và thu thập rầy xanh đuơi đen tại xã Hịa Sơn – Hiệp Hịa – Bắc Giang vụ mùa năm 2011. 4.1.4. Phát hiện virus RYSV bằng RT-PCR trên các mẫu thu thập ngồi đồng ruộng vụ xuân 2011 Vì là bệnh mới nên việc chẩn đốn bằng quan sát triệu chứng thường khơng chính xác khi mẫu thử khơng biểu hiện triệu chứng đặc trưng, hoặc khi cây bệnh ở giai đoạn mới nhiễm. ðặc biệt triệu chứng vàng lá do RYSV gây ra cĩ thể rất rễ với các hiện tượng vàng lá sinh lý khác. Chính vì vậy, việc chẩn đốn bệnh do RYSV gây ra thường rất khĩ, dễ nhầm lẫn. Trường ðại học Nơng nghiệp Hà Nội - Luận văn thạc sĩ khoa học nơng nghiệp …………………………… 31 Do tại thời điểm điều tra vụ xuân, kháng huyết thanh đặc hiệu virus RYSV vẫn chưa cĩ nên chúng tơi đã kiểm tra sự cĩ mặt của virus bằng RT-PCR với cặp mồi đặc hiệu gen L của virus RYSV là RY-L._.

Các file đính kèm theo tài liệu này:

  • pdfCH2435.pdf
Tài liệu liên quan