Bước đầu nghiên cứu chuyển gen kháng sâu cryIAc vào cây hoa đồng tiền

Tài liệu Bước đầu nghiên cứu chuyển gen kháng sâu cryIAc vào cây hoa đồng tiền: ... Ebook Bước đầu nghiên cứu chuyển gen kháng sâu cryIAc vào cây hoa đồng tiền

doc91 trang | Chia sẻ: huyen82 | Ngày: 09/12/2013 | Lượt xem: 2853 | Lượt tải: 7download
Tóm tắt tài liệu Bước đầu nghiên cứu chuyển gen kháng sâu cryIAc vào cây hoa đồng tiền, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG NGHIỆP HÀ NỘI ------------------ NGUYỄN THỊ HOÀ VÂN BƯỚC ĐẦU NGHIÊN CỨU CHUYỂN GEN KHÁNG SÂU CRYIAC VÀO CÂY HOA ĐỒNG TIỀN LUẬN VĂN THẠC SĨ NÔNG NGHIỆP Chuyên ngành: TRỒNG TRỌT Mã số: 60.62.01 Người hướng dẫn khoa học: GS.TS. NGUYỄN QUANG THẠCH HÀ NỘI - 2009 LỜI CAM ĐOAN Tôi xin cam đoan đây là công trình nghiên cứu của riêng tôi. Các số liệu, kết quả nghiên cứu trong luận văn là trung thực và chưa từng được ai công bố trong bất kì công trình nào khác. Tôi xin cam đoan rằng các thông tin trích dẫn trong luận văn đều đã được chỉ rõ nguồn gốc. Hà Nội, ngày 06 tháng 09 năm 2009 Tác giả luận văn Nguyễn Thị Hòa Vân LỜI CẢM ƠN Để hoàn thành luận văn tốt nghiệp này, tôi đã nhận được rất nhiều sự giúp đỡ. Trước tiên, tôi xin gửi lời cảm ơn chân thành và sâu sắc tới thầy giáo hướng dẫn GS.TS. Nguyễn Quang Thạch. Tôi đã học hỏi được rất nhiều từ những bài giảng đặc biệt hấp dẫn và khoa học trên lớp của thầy. Thầy luôn là người đưa ra định hướng đúng đắn và động viên kịp thời trong từng bước tôi thực hiện đề tài. Tôi xin trân trọng cảm ơn cô giáo PGS.TS. Nguyễn Thị Lý Anh - Viện trưởng Viện Sinh học Nông nghiệp đã tạo mọi điều kiện để tôi hoàn thành các thí nghiệm. Tôi xin bày tỏ niềm ngưỡng mộ và biết ơn tới TS. Nguyễn Thị Phương Thảo, cô giáo dạy môn Công nghệ sinh học đầu tiên, đã cho tôi những lời khuyên và gợi ý bổ ích dẫn tới việc tôi theo đuổi đề tài này. Tôi xin chân thành cảm ơn chị Nguyễn Thị Thanh Phương - người đã trực tiếp hướng dẫn tôi trong quá trình thực tập; em Hoàng Thị Giang - người đầu tiên giúp tôi làm quen với các thao tác trong phòng thí nghiệm, đã hướng dẫn thật tận tình và chu đáo. Tôi xin chân thành cảm ơn các cán bộ làm việc tại Viện Sinh học Nông nghiệp, các bạn cùng thực tập đã giúp đỡ khi tôi làm đề tài tại Viện. Cuối cùng, tôi xin bày tỏ lòng biết ơn chân thành và sâu sắc tới sự động viên, cổ vũ và giúp đỡ của chồng, bố mẹ và gia đình hai bên. Hà Nội, ngày 06 tháng 09 năm 2009 Học viên Nguyễn Thị Hòa Vân MỤC LỤC DANH MỤC CÁC CHỮ VIẾT TẮT VÀ KÍ HIỆU Chữ viết tắt Kí hiệu AS Acetone Syringone BA Benzyl Adenin CHS Chalcone synthase CNSH Công nghệ sinh học DFR Dihydroflavonol-4-reductase ĐC Đối chứng ĐNC Đồng nuôi cấy IAA Indol Axetic Acid LB Luria Bertoni MES 2N – Morpholino ethanesulfonic acid MS Murashige và Skoog, 1962 PCR Polymerase Chain Reaction PPT Phosphinotricin TNC Tiền nuôi cấy TS Tái sinh DANH MỤC CÁC BẢNG STT Tên bảng Trang 2.1. Hệ thống phân loại độc tố vi khuẩn Bt theo cách cũ [30] 24 3.1. Xác định mô thích hợp cho chuyển gen 37 3.2. Xác định thời gian đồng nuôi cấy thích hợp 38 3.3. Xác định thời gian tiền nuôi cấy thích hợp 38 3.4. Xác định kỹ thuật lây nhiễm thích hợp 38 3.5. Xác định kỹ thuật rửa khuẩn thích hợp 39 3.5. Test kháng sâu 41 4.1. Ảnh hưởng của nguồn mẫu đưa vào lây nhiễm đến chuyển gen 50 4.2. Ảnh hưởng của thời gian đồng nuôi cấy đến chuyển gen 53 4.3. Ảnh hưởng của thời gian tiền nuôi cấy đến chuyển gen 55 4.4. Ảnh hưởng của kỹ thuật lây nhiễm đến chuyển gen 57 4.5. Ảnh hưởng của kỹ thuật rửa khuẩn đến tỷ lệ mẫu sống và sạch khuẩn 60 4.6. Ảnh hưởng của các dòng đồng tiền đã chuyển gen đến tỷ lệ chết của sâu khoang 71 DANH MỤC CÁC HÌNH STT Tên hình Trang 2.1. Cấu tạo vi khuẩn Agrobacterium tumefaciens 17 2.2. Cấu trúc Ti- plasmid trong vi khuẩn Agrobacterium tumefaciens 17 2.3. Quá trình chuyển gen của vi khuẩn Agrobacterium tumefaciens 18 2.4. Cấu trúc vector chuyển gen pCAMBIA 20 2.5. Quy trình chuyển gen nhờ vi khuẩn Agrobacterium tumefaciens 20 3.1. Cây hoa đồng tiền giống Gerbera jamesonii Ferrari 33 3.2. Sơ đồ cấu trúc plasmid ITB2c trong vi khuẩn Agrobacterium tumefaciens 33 3.3. Sơ đồ quy trình nghiên cứu 35 4.2. Biểu đồ tỷ lệ mẫu sống sau chọn lọc của các mô 50 4.3. Biểu đồ tỷ lệ mẫu sống sau chọn lọc ở các ngày đồng nuôi cấy 53 4.4. Biểu đồ tỷ lệ mẫu sống sau chọn lọc ở các ngày tiền nuôi cấy 56 4.5. Biểu đồ tỷ lệ mẫu sống sau chọn lọc của các kỹ thuật lây nhiễm 58 4.6. Biểu đồ tỷ lệ mẫu sống và sạch khuẩn của các kỹ thuật rửa khuẩn 60 4.7 . Sơ đồ quy trình chuyển gen vào cây hoa đồng tiền 62 4.8. Các mô được sử dụng làm đối chứng 62 4.9. Sự phát triển của vi khuẩn Agrobacterium tumefaciens trên các loại mô 63 4.10. Sự phát triển của vi khuẩn Agrobacterium tumefaciens ở các ngày đồng nuôi cấy 63 4.11. Sự phát triển của vi khuẩn Agrobacterium tumefaciens ở các kỹ thuật lây nhiễm 63 4.12. Các mẫu sống sót trên môi trường chọn lọc 64 4.13. Nhân và tách các dòng đồng tiền sau chọn lọc 64 4.14. Callus chuyển gen biểu hiện âm tính và dương tính với thuốc thử gus 66 4.15. Phân tích PCR gen cryIAc 67 4.16. Các hộp nuôi sâu có đục lỗ thở phía trên 69 4.17. Các loại sâu đã thu thập trên đồng ruộng 69 4.18. Hình ảnh về sâu khoang ăn lá đồng tiền 69 4.19. Sâu khoang ăn lá các dòng đồng tiền chuyển gen và chết trong vòng 9 ngày 74 1. MỞ ĐẦU 1.1 Đặt vấn đề Vấn đề sâu hại là một khó khăn lớn trong sản xuất hoa cây cảnh nói riêng và cây trồng nói chung. Tổn thất do sâu gây ra rất nghiêm trọng, hàng năm gây thiệt hại 29,7 tỷ USD, khoảng 13,8% mùa màng - cao nhất so với các loài dịch hại khác (H.H. Cramer, 1967). Để phòng trừ sâu hại, ngoài các biện pháp truyền thống như canh tác, hóa học, cơ giới, vật lý ..., sử dụng giống kháng sâu là một biện pháp mới và hiệu quả. Trước đây, muốn tạo ra giống có đặc tính mới này, người ta phải lai tạo trong thời gian dài. Tuy nhiên, công nghệ gen ra đời đã giải quyết được nhược điểm đó. Nhiều giống cây trồng có khả năng kháng sâu như: bông, ngô, lúa, đậu tương... đã có mặt trên thị trường nhờ phương pháp chuyển gen và khẳng định ưu thế vượt trội. Ở Việt Nam nghiên cứu tạo giống cây chuyển gen nói chung và cây kháng sâu nói riêng còn hoàn toàn mới mẻ. Đã có những thành công bước đầu ở một số loại cây lương thực nhưng vẫn chưa được đưa vào sản xuất đại trà. Nghiên cứu tạo đặc tính kháng sâu cho đối tượng hoa cây cảnh là một thị trường mới, còn đang bị bỏ ngỏ. Mặc dù đồng tiền là loại hoa mang lại hiệu quả kinh tế cao trong các loại hoa thông dụng hiện nay nhưng chưa có nhiều nghiên cứu trên đối tượng này. Trên cơ sở đã có nguyên liệu là vectơ chuyển gen, câu hỏi đặt ra là: Liệu có chuyển gen kháng sâu vào cây hoa đồng tiền được không? Để trả lời câu hỏi này, chúng tôi tiến hành nghiên cứu đề tài: “Bước đầu nghiên cứu chuyển gen kháng sâu cryIAc vào cây hoa đồng tiền" . 1.2 Mục đích và yêu cầu 1.2.1 Mục đích Chuyển được gen kháng sâu cryIAc vào cây hoa đồng tiền tạo vật liệu hoa đồng tiền chuyển gen. 1.2.2 Yêu cầu 1.2.2.1 Xác định các thông số cho quá trình chuyển gen Xác định mô thích hợp cho chuyển gen Xác định thời gian đồng nuôi cấy thích hợp Xác định thời gian tiền nuôi cấy thích hợp Xác định kỹ thuật nhiễm mẫu thích hợp Xác định kỹ thuật rửa khuẩn thích hợp 1.2.2.2 Xác định sự hiện diện của các gen chuyển vào Qua môi trường chọn lọc Qua gen Gus Qua PCR 1.2.2.3 Đánh giá vật liệu chuyển gen Xác định sâu thuộc bộ cánh vảy thích hợp cho test kháng sâu Test kháng sâu 1.3 Ý nghĩa khoa học và thực tiễn của đề tài Hoa đồng tiền là một trong các loài hoa có giá trị kinh tế đang được trồng phổ biến ở nước ta. Theo tác giả Đặng Văn Đông (2009), trên cùng một diện tích canh tác, trồng hoa đồng tiền cho thu nhập cao gâp 11-12 lần so với trồng lúa. Nhưng trong sản xuất cây đồng tiền nói riêng và cây trồng nói chung thiệt hại do sâu hại gây ra chiếm tới 13.8% mùa màng. Việc sử dụng thuốc trừ sâu hóa học không chỉ gây tăng chi phí sản xuất mà còn gây ô nhiễm sản phẩm, ô nhiễm môi trường, tổn hại sức khỏe của người lao động… Hiện nay, trên thế giới để giải quyết vấn đề này việc sử dụng cây chuyển gen kháng sâu được cho là biện pháp hữu hiệu và diện tích trồng các cây bông, ngô, đậu tương… chuyển gen kháng sâu ngày càng tăng. Vì vậy, nghiên cứu chuyển gen kháng sâu vào cây hoa đồng tiền là hướng đi đúng đắn, rất cần được tiến hành nhằm tiến tới việc tạo được giống hoa đồng tiền kháng sâu phục vụ cho sản xuất. 2. TỔNG QUAN TÀI LIỆU 2.1 Giới thiệu chung về cây hoa đồng tiền Cây hoa đồng tiền có nguồn gốc ở Nam Phi [7, tr. 5-8]. Nó có tên khoa học là Gerbera jamesonic Bolus, thuộc bộ cúc, họ cúc, phân họ Mutisioideae, tông Mutisieae, chi Gerbera [19]. 2.1.1 Giá trị của cây hoa đồng tiền Đồng tiền là loài hoa có màu sắc tươi sáng phong phú, đa dạng với đầy đủ các loại màu, hoa to, cuống cứng nên dùng làm hoa cắt, hoa chậu, hay trồng trang trí trong vườn đều đẹp [15, tr. 72]. Đồng tiền là một loại hoa có sản lượng và giá trị cao, ở điều kiện thích hợp có thể ra hoa quanh năm, tỷ lệ cành cắt và tỷ lệ hoa thương phẩm cao, hình dáng hoa cân đối, hài hòa, giá trị thẩm mỹ cao, tươi lâu; hơn nữa việc trồng và chăm sóc không quá phức tạp, đầu tư một lần có thể thu liên tục trong vòng 4-5 năm. Vì thế đồng tiền là một trong 10 loại hoa được tiêu thụ nhiều nhất trên thế giới, đứng hàng thứ năm trong số các loại hoa cắt (chỉ sau hoa hồng, cẩm chướng, cúc đại đóa và tulip) [15, tr. 71]. Ở Việt Nam, hoa đồng tiền mang lại hiệu quả kinh tế cao trong các loại cây hoa thông dụng hiện nay. Hàng năm hoa đồng tiền cho thu nhập từ 100 - 400 triệu đồng/ha với chi phí sản xuất chỉ chiếm 40% tổng giá trị thu được, cho năng suất gấp 11-12 lần so với trồng lúa [7, tr. 8]. 2.1.2 Tình hình sản xuất cây hoa đồng tiền Hiện nay công tác nghiên cứu và sản xuất hoa ở nước ngoài rất phát triển. Trình độ tạo giống sản xuất của các nước Hà Lan, Nhật Bản, Mỹ, Đức... rất cao như công ty Forist của Hà Lan là công ty dẫn đầu thế giới về tạo giống, nghiên cứu, sản xuất, buôn bán hoa đồng tiền. Tuy nhiên trong sản xuất hoa đồng tiền ở một số nước đang phát triển vẫn có một số biểu hiện sau: tính chuyên nghiệp và quy mô sản xuất chưa cao; tổng diện tích sản xuất lớn, sản lượng ít, chất lượng kém; trang thiết bị trồng trọt lạc hậu, hàm lượng kỹ thuật cao ít; công tác chọn tạo giống mới chậm so với sản xuất; giá thành bao gói cao. [15] Ở Việt Nam, một số tiến bộ KHCN mới đã được áp dụng để phục vụ phát triển sản xuất cây hoa đồng tiền. Về nghiên cứu chọn tạo giống, chúng ta đã nhập nội 15 giống đồng tiền từ Hà Lan, trong đó chọn ra được 2 giống tốt nhất đó là các giống Piton và Sawanna. Về quy trình nhân giống, đã xây dựng quy trình nhân giống đồng tiền bằng in vitro và triển khai sản xuất lớn tại Viện Nghiên cứu Rau Quả, làm tăng hiệu quả kinh tế lên gấp 2-3 lần so với quy trình thông thường. Hiện nay, có 6 tỉnh thành ở đồng bằng sông Hồng đang áp dụng. Về kết quả chuyển giao tiến bộ kỹ thuật, đã xây dựng mô hình theo hệ thống tiến bộ khoa học bao gồm 0,3 ha tại Hưng Yên, 0,2 ha tại Quảng Ninh, và hệ thống trồng trong nhà lưới ở các tỉnh Hà Nội, Hà Nam, Thái Bình, Bắc Ninh, Yên Bái cho năng suất gấp 11-12 lần so với trồng lúa. [8] 2.1.3 Đặc điểm thực vật học Cây hoa đồng tiền có những đặc điểm hình thái sau đây: Thân: Thân ngầm, không phân cành mà chỉ đẻ nhánh. Lá: Lá phát triển từ thân, mọc chếch so với mặt đất một góc 15-45o, hình dáng lá thay đổi theo giống và sự sinh trưởng của cây, từ hình trứng thuôn đến hình thuôn dài. Lá dài từ 15-25 cm, rộng 5-8 cm, có hình lông chim, xẻ thuỳ nông hoặc sâu, mặt lưng lá có lớp lông nhung. Rễ: Rễ đồng tiền thuộc loại dạng rễ chùm, phát triển khoẻ, hình ống, ăn ngang và nổi phía trên mặt luống, rễ thường vươn dài tương ứng với diện tích lá toả ra. Hoa: Đồng tiền do hai loại hoa nhỏ hình lưỡi và hình ống tạo thành, là loại hoa tự đơn hình đầu. Hoa hình lưỡi tương đối lớn mọc ở phía ngoài xếp thành một vòng hoặc vài vòng nhỏ, do sự thay đổi hình thái và màu sắc nên đựơc gọi là mắt hoa hoặc tâm hoa, rất được chú trọng. Trong quá trình hoa nở, hoa hình lưỡi nở trước, hoa hình ống nở theo thứ tự từ ngoài vào trong theo từng vòng một. Quả: Quả đồng tiền thuộc dạng quả bế có bông, không có nội nhũ, hạt nhỏ, 1 gam hạt có khoảng 280-300 hạt. [15] Cây hoa đồng tiền có thể nhân giống bằng nhiều phương pháp như nhân giống bằng hạt, tách cây, nuôi cấy mô. [15, tr. 72-75] Theo Đặng Văn Đông năm 2003 thì hiện nay ở nước ta có khoảng trên 30 giống hoa đồng tiền, trong đó hiện nay trong sản xuất thường trồng các giống đồng tiền do Hà Lan lai tạo, nhưng do các cơ sở của Trung Quốc nhân giống bằng nuôi cấy mô tế bào, chủ yếu là các giống Thanh tú giai nhân (F123), Thảo nguyên nhiệt đới (F125), Kim hoa sơn, Yên Hưng (F160). [15, tr. 75-76] 2.1.4 Một số loài sâu thuộc bộ cánh vảy hại cây hoa đồng tiền 2.1.4.1 Sâu khoang (Spodoptera litura) Sâu khoang (Sâu ăn tạp) là loài sâu đa thực có thể phá hại đến 290 loại cây trồng thuộc 99 họ thực vật bao gồm các loại rau đậu, cây thực phẩm, cây công nghiệp, cây lương thực, cây phân xanh... [2] Đặc điểm hình thái Bướm có chiều dài thân khoảng 20-25mm. Trứng có hình bán cầu 0,4 - 0,5mm, được bao phủ một lớp lông bảo vệ. Sâu tuổi nhỏ có màu xanh lục, càng lớn sâu chuyển dần thành màu nâu đậm. Nếu điều kiện thuận lợi sâu có thể dài từ 35-53 mm. Trên cơ thể có một sọc vàng sáng chạy ở hai bên hông từ đốt thứ nhất đến đốt thứ tám của bụng, mỗi đốt có một chấm đen rõ nhưng hai chấm đen ở đốt thứ nhất to nhất. Sâu càng lớn, hai chấm đen ở đốt thứ nhất càng to dần và gần như giao nhau tạo thành khoang đen trên lưng nên sâu ăn tạp còn được gọi là “sâu khoang”. Nhộng màu đỏ sẫm. [2], [3] Đặc điểm sinh học và sinh thái Vòng đời: 25-48 ngày, trứng: 3-7 ngày, sâu non: 12-27 ngày, nhộng: 8-10 ngày, trưởng thành: 2-4 ngày. Trứng được đẻ thành ổ ở mặt dưới lá và phủ một lớp lông. Một ổ có từ 50 - 200 trứng. Một con cái có thể đẻ từ 500 - 2000 trứng. Sâu non lột xác 5-6 lần, sâu tuổi nhỏ ăn biểu bì của lá, sâu tuổi lớn ăn cả thịt lá chỉ chừa lại gân lá. Chúng làm nhộng trong đất. [3] Nhìn chung, vòng đời của sâu khoang tương đối ngắn trung bình 30,2 ngày, trong đó giai đoạn sâu non chiếm trung bình 21,7 ngày, đây là giai đoạn gây hại quan trọng của sâu khoang. [2] 2.1.4.2. Sâu xám (Agrotis ipsilon) Đặc điểm hình thái Bướm có màu xanh đen, cánh trước màu nâu nhạt hoặc nâu đen, cánh sau trắng có một đường màu đen ở cuối. Sâu non màu xám đen hoặc màu nâu xám dọc theo hai bên thân có một dãy đen mờ. Sâu có 3 đôi chân thật và 5 đôi chân giả. Nhộng màu xám xanh đến nâu đỏ có 2 gai ở phía sau. [3] Đặc điểm sinh học và sinh thái Vòng đời: 37-62 ngày, trứng: 4-11 ngày, sâu non: 22-34 ngày, nhộng: 9-13 ngày, trưởng thành: 2-4 ngày. Trứng được đẻ thành ổ ở trong đất hoặc dưới lá, trên thân, trên cỏ và trên tàn dư trong ruộng gần gốc cây chủ. Bướm có thể đẻ 1.200 trứng. Sâu non có 5-6 tuổi, khi bị đụng chúng cuộn lại giả chết. Ban ngày sâu non ẩn núp ở dưới bề mặt của đất, dưới lá. Ban đêm sâu non lên mặt đất và ăn ngang thân cây sát mặt đất, làm thân cây bị khuyết hoặc bị cắn đứt. Sâu thường xuất hiện vào giai đoạn cây con và gây hại trầm trọng nhất ở những vùng đất nhẹ, đất cát nơi sâu non có thể vùi mình dễ dàng. [3] 2.2 Giới thiệu chung về công nghệ chuyển gen ở thực vật Công nghệ chuyển gen là kỹ thuật đưa một hay nhiều gen lạ đã được thiết kế ở dạng ADN tái tổ hợp vào tế bào chủ của cây trồng nói riêng và của các sinh vật nói chung (vi sinh vật, động vật…) làm cho gen lạ có thể tồn tại ở dạng plasmid tái tổ hợp hoặc gắn vào bộ gen tế bào chủ. Trong tế bào chủ, các gen này hoạt động tổng hợp nên các protein đặc trưng dẫn tới việc xuất hiện các đặc tính mới ở cơ thể chuyển gen. [10] 2.2.1 Các phương pháp chuyển gen 2.2.1.1 Các phương pháp chuyển gen trực tiếp Ở nhóm phương pháp này, gen được chuyển trực tiếp vào tế bào thực vật thông qua những thiết bị hoặc thao tác nhất định mà không cần phải nhờ các sinh vật trung gian. Phương pháp chuyển gen nhờ điện xung Kỹ thuật này được sử dụng cho việc chuyển gen vào tế bào trần (protoplast). Ở một điện thế cao trong thời gian ngắn thì có thể tạo nên các lỗ trên màng tế bào trần làm cho ADN bên ngoài có thể xâm nhập vào bộ gen của tế bào. [10] Phương pháp chuyển gen nhờ vi tiêm Phương pháp chuyển gen nhờ vi tiêm là phương pháp sử dụng các vi tiêm nhỏ, kính hiển vi điện tử và các vi thao tác để chuyển gen trực tiếp vào tế bào. Đến nay, các tế bào đã được sử dụng phương pháp này để chuyển gen gồm các tế bào protoplast (Chnorf và cộng sự,1991), các tế bào tiền phôi của hợp tử hay hạt phấn (Neuhaus, 1987), hoặc các tế bào đơn (chưa hình thành vỏ cứng). Phương pháp chuyển gen trực tiếp qua ống phấn Các ADN mục tiêu được đưa qua đường ống phấn để vào bầu nhuỵ cái và tạo nên sự chuyển gen ngay sau khi hạt phấn nảy mầm, ống phấn mọc qua vòi nhị để đưa tinh tử vào thụ tinh với tế bào trứng trong noãn. Hợp tử mang gen ngoại lai sẽ phát triển thành hạt, hạt nảy mầm, phát triển thành cây chuyển gen. [10] Phương pháp chuyển gen nhờ súng bắn gen Đây là phương pháp phổ biến được áp dụng thành công để chuyển gen trực tiếp vào thực vật. Nguyên tắc là phải tạo một luồng khí để đẩy các viên đạn (thường được làm bằng vàng hoặc vonfram) có kích thước nhỏ mang gen mong muốn với tốc độ 1.300m/s. [9] Phương pháp chuyển gen nhờ siêu âm Phương pháp này ứng dụng tác động của sóng siêu âm để đưa các plasmid mang gen được thiết kế có thể xâm nhập vào tế bào chủ nhưng ở dạng tế bào trần. Nó bao gồm các bước như sau: Tạo dung dịch tế bào huyền phù ® Tạo xung điện với hiệu điện thế cao ® Protoplast bị thủng một số chỗ ADN thâm nhập vào ® Nuôi cấy protoplast ® Tái sinh cây ® Chọn lọc cây chuyển gen. Tuy nhiên phương pháp này chỉ đạt tần xuất thành công là 0,01-0,1%, khá phức tạp và đòi hỏi kỹ thuật cao. [9] Phương pháp chuyển gen nhờ siliconcacbit: Đây là một loại vật liệu mới, là chất rắn, trơ, có kích thước nhỏ. Nó bao gồm các bước sau: Trộn huyền phù có chứa vector mang gen với Siliconcacbit ® Tế bào bị đục thủng ® Vector mang gen xâm nhập vào ® Nuôi cấy, chọn lọc, tái sinh thành cây. Tuy nhiên phương pháp này ít áp dụng do tạo nhiều biến dị. [9] 2.2.1.2. Phương pháp chuyển gen gián tiếp Phương pháp chuyển gen nhờ virus Hiện nay người ta sử dụng virus làm vector chuyển gen cho cây trồng, do virut dễ xâm nhập và lây lan trong cơ thể thực vật. Mặt khác trong cấu tạo của virut cũng có mặt axit nucleic làm cơ sở cho việc gắn các gen cần chuyển vào. [9] Phương pháp chuyển gen nhờ vi khuẩn Phương pháp này có những ưu điểm nổi trội: số bản sao của gen biến nạp được chuyển vào tế bào thực vật thấp, do vậy, giảm sự không biểu hiện của gen được chuyển, chuyển gen bền vững, hiệu quả cao; tránh hình thành các cây chuyển mang thể khảm; kỹ thuật đơn giản, dễ thực hiện; không đòi hỏi thiết bị đắt tiền. [9] 2.2.2 Các phương pháp đánh giá cây chuyển gen 2.2.2.1 Đánh giá cây chuyển gen nhờ môi trường chọn lọc Chọn lọc tế bào mang gen chuyển nạp là thiết lập các điều kiện nuôi cấy để các tế bào này được sinh trưởng và phát triển trội hẳn. Môi trường chọn lọc là môi trường có chứa các chất ức chế sinh trưởng hay chất chọn lọc ở nồng độ mà tế bào không mang gen chuyển sẽ chết, còn tế bào mang gen chuyển có khả năng kháng được. Môi trường chọn lọc có thể có kháng sinh, chất diệt cỏ, muối, hoặc kim loại nặng... Để chọn lọc các tế bào mang gen chuyển nạp người ta đưa vào vector chuyển nạp các gen chọn lọc như nptII, hpt, bar, strep/spec, cat ... [14] 2.2.2.2 Đánh giá cây chuyển gen nhờ phương pháp PCR Phương pháp PCR (Polymerase Chain Reaction) là phương pháp in vitro sử dụng các cặp mồi để tổng hợp số lượng lớn các bản sao từ một trình tự ADN đặc biệt dựa trên hoạt động của enzyme polymerase. Phương pháp PCR dựa trên hoạt động của ADN polymerase trong quá trình tổng hợp ADN mới từ mạch khuôn. Tất cả các ADN polymerase đều cần những mồi, là những đoạn ADN ngắn có khả năng bắt cặp bổ sung với một đầu của mạch khuôn. Ðoạn mồi này sau đó sẽ được nối dài ra nhờ hoạt động của ADN polymerase để hình thành một mạch mới hoàn chỉnh. Một phản ứng PCR là một chuỗi nhiều chu kỳ nối tiếp nhau, mỗi chu kỳ gồm ba giai đoạn: - Giai đoạn biến tính: tách chuỗi ADN từ mạch đôi thành dạng mạch đơn - Giai đoạn bắt cặp: gắn cặp mồi đặc trưng theo nguyên tắc bổ sung - Giai đoạn kéo dài chuỗi: tổng hợp chuỗi AND mới giống chuỗi AND gốc. Quy trình đánh giá cây chuyển gen nhờ phương pháp PCR: Mẫu cây chuyển gen ® Chuẩn bị mẫu ® Tách chiết ADN ® PCR ® Điện di ® Đọc kết quả. [10] 2.2.2.3 Đánh giá cây chuyển gen nhờ phương pháp lai Western blot Western blot là phương pháp có độ nhạy cao dựa trên tính đặc hiệu của kháng thể để phát hiện protein đã được điện di trên gel SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) và chuyển lên màng lai. Western blot cho phép xác định sự có mặt, trọng lượng phân tử, định lượng protein có mặt trong các mẫu khác nhau. Western blot còn có tên gọi khác là Western blotting hay phương pháp lai thấm protein. Western blot bao gồm các bước cơ bản sau: - Protein được phân tách bằng điện di trên gel SDS-PAGE. - Các protein được chuyển sang màng lai nitrocellulose, giữ nguyên vị trí như đã phân tách trên gel. - Ủ màng lai đã cố định protein với một kháng thể sơ cấp (kháng thể đặc hiệu, bám vào protein và tạo thành một phức hợp protein-kháng thể đối với protein quan tâm) - Ủ màng lai với một kháng thể thứ cấp có enzyme (alkalin phosphatase hoặc horseradish peroxidase) đi kèm. Kháng thể thứ cấp sẽ bám vào kháng thể sơ cấp giống như kháng thể sơ cấp đã bám vào protein. - Tiếp tục ủ màng lai trong một hỗn hợp phản ứng đặc hiệu với enzyme. - Ðặt một phim nhạy cảm với tia X lên màng lai để phát hiện các điểm sáng phát ra do enzyme. [4] 2.2.2.4 Đánh giá cây chuyển gen nhờ phương pháp lai Southern blot Southern blot là một trong những phương pháp trung tâm của Sinh học phân tử. Nó còn có tên gọi khác là Southern blotting, phương pháp lai Southern hay phương pháp lai DNA. Nguyên tắc của Southern blot là màng lai nitrocellulose có khả năng tiếp nhận DNA đã được biết từ lâu và đã được sử dụng trong các nghiên cứu lai axit nucleic khác nhau vào những thập niên 1950 và 1960. Vào thời kỳ này DNA cố định không được phân đoạn, chỉ đơn giản bao gồm DNA tổng số được gắn trên màng lai nitrocellulose. Sự ra đời của phương pháp điện di trên gel vào đầu thập niên 1970 đã cho phép các đoạn DNA được cắt bởi enzyme hạn chế có thể được phân tách dựa trên cơ sở kích thước của chúng. Từ đó bước phát triển tiếp theo của phương pháp là chuyển các đoạn DNA phân tách từ gel lên màng lai nitrocellulose. Phương pháp này được E. M. Southern mô tả tại Ðại học Edingburgh vào năm 1975. Phương pháp Southern blot đơn giản và hiệu quả. Mặc dù đã được cải tiến nhưng phương pháp đang được sử dụng ở nhiều phòng thí nghiệm sinh học phân tử sai khác không đáng kể so với phương pháp ban đầu. Southern blot bao gồm các bước cơ bản sau: - Cắt DNA bằng enzyme hạn chế thích hợp. - Ðiện di sản phẩm cắt trên gel agarose. - Làm biến tính DNA (thông thường khi nó còn ở trên gel): ví dụ có thể nhúng nó vào trong dung dịch NaOH 0.5M, DNA sợi kép sẽ được tách thành DNA sợi đơn. Chỉ DNA sợi đơn mới có thể chuyển lên màng lai. - Chuyển DNA đã biến tính lên màng lai. Nguyên tắc của phương pháp là dùng mẫu dò đã biết để xác nhận sự hiện diện của DNA tương đồng trong mẫu. DNA mẫu nghiệm có thể là nguyên vẹn. Thêm vào đó, trong nhiều trường hợp, sau khi cắt DNA bằng enzyme hạn chế và điện di trong gel agarose để phân li rồi chuyển qua và cố định trên màng nitrocellulose (hoặc màng nylon, sau này hay dùng hơn do bền và cố định DNA rất tốt và có thể tái sử dụng), thực hiện lai với mẫu dò đã đánh dấu có thể kiểm xuất được những đoạn DNA trên màng có trình tự bổ sung với mẫu dò. Ngày nay các mẫu dò đánh dấu phi phóng xạ đã phổ biến, có thể đặt mua và vận dụng thay thế, khi đó phương pháp autoradiography (tự ký phóng xạ) được thay thế bằng phương pháp fluorography (huỳnh quang ký, hoặc sử dụng thiết bị đọc non-RI fluorescence, như FMBIOÒ II Multi-View, chẳng hạn) hoặc phương pháp đánh dấu biotin phát hiện được nhờ streptavidin (hoặc DIG phát hiện bằng kháng thể đặc hiệu DIG, tương ứng) đánh dấu enzyme akaline phosphatase (AP) để nhận biết kết quả lai với sự hỗ trợ của hợp chất quang hóa (chemiluminescent substrate) như CDP-Star, Lumi-Phos 530, CSDP... [4] 2.2.2.5 Đánh giá cây chuyển gen nhờ phương pháp lai Northern blot Sau khi E. M. Southern mô tả phương pháp Southern blot vào năm 1975, người ta đã dùng một phương pháp tương tự để xác định các đoạn RNA đặc biệt gọi là Northern blot. Phương pháp này còn được gọi là Northern blotting, phương pháp lai Northern hay phương pháp lai RNA. Northern blot bao gồm các bước cơ bản sau: - RNA (RNA tổng số hoặc chỉ mRNA) được phân tách bằng điện di trên gel agarose. - RNA sau khi đã phân tách được chuyển lên màng lai (các phân tử RNA giữ nguyên vị trí như ở trên gel). - RNA cố định trên màng được lai với mẫu dò DNA sợi đơn (hoặc RNA) có đánh dấu phóng xạ hoặc được gắn với một enzyme (alkalin phosphatase hoặc horseradish peroxidase) tạo thành phân tử lai RNA-DNA (hoặc RNA-RNA) sợi kép. - Vị trí của mẫu dò được phát hiện nhờ kỹ thuật phóng xạ tự ghi nếu nó được đánh dấu. [4] 2.2.3 Triển vọng và thách thức của công nghệ chuyển gen 2.2.3.1 Triển vọng Những nghiên cứu hiện nay cho phép tạo ra các giống cây chuyển gen theo nhiều hướng khác nhau: Nâng cao tính chống chịu sâu bệnh - Chống sâu: (sẽ nói ở phần 4. Đặc điểm của gen kháng sâu) - Chống bệnh: Chuyển gen kháng virus gây bệnh: chuyển gen mã hoá protein vỏ của virus, chuyển gen tạo enzym phân giải virus hoặc chuyển gen có trình tự đối bản với ARN của virus. Kết quả: Sử dụng chuyển gen tạo vỏ ngoài của nhiều loại virus và tạo lên các giống: Đu đủ kháng virus gây bệnh đốm vòng, cây thuốc lá kháng virus khảm dưa chuột, cây thuốc lá kháng virus khảm alfar, khoai tây kháng virus X, Y, khoai tây kháng virus xoăn lá, cam quýt kháng bệnh tàn lụi tristeza... [5] Nâng cao tính chống chịu các điều kiện bất thuận của môi trường Chuyển gen tạo giống cây trồng chống chịu với các điều kiện bất thuận như: Gen kháng hạn, gen kháng mặn, gen chống các stress, chống già hoá và chống rụng... Các loại cây lương thực “thế hệ đầu tiên” có khả năng chống lại các stress của môi trường như hạn hán, sự thay đổi nhiệt độ đột ngột, đất nhiễm mặn hay nghèo dinh dưỡng... đã ra đời. Tại Mỹ, năm 1994, với việc chuyển gen thành công làm cho quả chín chậm vào cây cà chua đã tạo ra giống cà chua mới: Flauv Savr. [5] Nâng cao tính chống chịu thuốc trừ cỏ Các nhà nghiên cứu đã chuyển gen EPSPS kháng thuốc diệt cỏ glyphosat, và gen bar kháng thuốc glyphosinate vào tế bào cây trồng. Nhờ phương pháp này, người ta tạo ra nhiều loại cây trồng kháng thuốc diệt cỏ: đậu tương, ngô, bông.... Biến đổi chất lượng thực phẩm Các nhà khoa học trên thế giới đang nghiên cứu “thế hệ thứ hai” của các sản phẩm công nghệ sinh học - những sản phẩm mang lại lợi ích trực tiếp cho người tiêu dùng. Chẳng hạn, cây “lúa vàng” có hàm lượng β-carotein cao, hoặc giống khoai tây công nghệ sinh học có hàm lượng protein cao hơn giống bình thường. Cây trồng cũng có thể tạo ra các loại vaccine thực phẩm đem lại những loại thuốc có chi phí sản xuất và bảo quản thấp; nâng cao khả năng bảo quản và hương vị; giảm thiểu các chất gây dị ứng. Ngoài ra, công nghệ chuyển gen còn cho phép tạo ra các chế phẩm làm sạch đất, các cây tạo ra các hợp chất thứ cấp, biến đổi màu sắc và hình dạng hoa, tạo cây bất dục đực để sản xuất hạt ưu thế lai... Với các hướng tạo giống cây trồng bằng phương pháp chuyển gen như trên, thì triển vọng mà cây chuyển gen mang lại là vô cùng to lớn. 2.2.3.2 Thách thức Những rủi ro có thể của cây chuyển gen: - Đối với môi trường và hệ thống sinh thái + Sự phát triển không kiểm soát được của các cây chuyển gen + Các hiệu ứng độc của các cây chuyển gen lên hệ sinh thái và động vật + Sự truyền gen lạ qua hạt phấn - Những nguy hiểm đối với con người + Sự chuyển các gen kháng sinh vào các vi sinh vật gây bệnh + Các sản phẩm gây dị ứng + Những chất có độc tố không mong muốn sản sinh trong cây chuyển gen 2.3 Phương pháp chuyển gen vào thực vật nhờ vi khuẩn Agrobacterium tumefaciens 2.3.1 Cơ sở của phương pháp Phương pháp này dựa trên cơ chế gây u vết thương của vi khuẩn Agrobacterium tumefaciens. Khi cây bị thương, vi khuẩn đã xâm nhập vào chỗ bị thương và gây u. Tiến hành phân tích thành phần các chất trong khối u thì thấy có nhiều hợp chất lạ. Phân tích hoá sinh các hợp chất lạ thì phát hiện ra đó chính là các phức hợp axit amin arginin - xetoaxit, những hợp chất đó không có ở thực vật, vi khuẩn đã sử dụng những hợp chất đó trong quá trình đồng hoá. Như vậy vi khuẩn đã chuyển vào trong tế bào thực vật tác nhân gây u và những tác nhân đó tổng hợp lên những hợp chất mới. [12] 2.3.2 Đặc điểm của vi khuẩn Agrobacterium tumefaciens Vi khuẩn Agrobacterium tumefaciens thuộc bộ Rhizobiales, họ Rhizobiaceae, chi Agrobacterium, loài Agrobacterium tumefaciens (Smith và Townsend, 1907). Agrobacterium tumefaciens là vi khuẩn đất nhuộm gram (-) gây ra các khối u ở thực vật khi xâm nhiễm qua vết thương. Qua nghiên cứu người ta kết luận rằng tác nhân gây u này chính là Ti-plasmid có trong vi khuẩn Agrobacterium tumefaciens. Ti-plasmid là một plasmid có kích thước lớn 200kb. Trên Ti-plasmid có đoạn T-ADN (Tumor ADN) được giới hạn bằng bờ phải và bờ trái có trình tự nucleotid tương tự nhau. T-ADN là đoạn nucleotid có kích thước 25 kb và mang hai loại gen: loại gen gây ung thư (oncogenic gene), loại này mã hoá cho một enzym liên quan tới tổng hợp các auxin, cytokinin và hình thành khối u; loại thứ hai liên quan tới tổng hợp opine. T-ADN là tên viết tắt của Tumor ADN vì đây là đoạn sẽ được chuyển vào tế bào thực vật gắn vào bộ nhiễm sắc thể và gây ra bệnh u. Trên Ti-plasmid còn có vùng vir gồm 6 nhóm từ virA đến virG, chứa các gen chịu trách nhiệm hoạt động lây nhiễm, chuyển nạp và phân giải opine [28]. Hình 2.1. Cấu tạo vi khuẩn Agrobacterium tumefaciens Hình 2.2. Cấu trúc Ti- plasmid trong vi khuẩn Agrobacterium tumefaciens 2.3.3 Quá trình chuyển gen của vi khuẩn Hình 2.3. Quá trình chuyển gen của vi khuẩn Agrobacterium tumefaciens Quá trình chuyển gen của vi khuẩn Agrobacterium tumefaciens tuân theo sơ đồ hình 2.4, bao gồm các bước: (1)_Agrobacterium nhận dạng và tấn công tế bào chủ (2)_Tổ hợp tín hiệu VirA/VirG của Agrobacterium cảm nhận những tín hiệu thực vật đặc trưng (3)_Sự hoạt hoá của vùng gen vir (4)_ T-ADN được tách ra khỏi Ti-plasmid nhờ phức hợp protein VirD1/D2 (5)_Sự tạo thành phức hợp VirD2-ADN (phức hợp-T chưa thành thục), cùng với một vài protein Vir khác, đi vào nguyên sinh chất tế bào chủ (6)_Sự kết hợp của VirE2 với sợi-T tạo thành phức hợp-T thành thục đi xuyên qua nguyên sinh chất tế bào chủ (7)_Phức hợp-T thành thục chủ động đi vào nhân tế bào chủ (8)_T-ADN bị hấp dẫn tới vị trí hợp n._.hất (9)_T-ADN tách khỏi các protein bảo vệ (10)_T-ADN hợp nhất vào bộ gen chủ. [12] 2.3.4 Thiết kế vector chuyển gen từ Ti-plamid của vi khuẩn T-ADN được giới hạn hai đầu bởi vùng biên (T-ADN borders), phần còn lại trong vùng biên sẽ không có chức năng gì trong quá trình chuyển gen. Nhờ vậy, có thể loại bỏ khả năng gây hại của T-ADN bằng cách thay các gen tạo khối u (oncogenes) nằm trong hai đầu vùng biên bằng các gen mong muốn. Khi các oncogene bị loại bỏ, tế bào hoặc mô thực vật chuyển gen sẽ phát triển bình thường và trong hầu hết các trường hợp, cho cây hữu thụ. Quá trình tổng hợp opine sử dụng các nguyên liệu của cây làm ảnh hưởng đến năng suất cuối cùng nên trong quá trình thiết kế cũng loại bỏ các gen tổng hợp opine. Ti-plasmid có kích thước lớn (200-800 kb) nên những đoạn ADN không cần thiết cũng phải được cắt bỏ để chèn vào đoạn ADN mục tiêu. Ngoài ra, Ti-plasmid không tự tái bản trong E.coli nên cần được bổ sung thêm gốc tái bản của E.coli. Cuối cùng, cần bổ sung các gen chỉ thị để chọn lọc cây và vi khuẩn. [12] Như vậy, cấu trúc của một vector chuyển gen bao gồm: Gốc tái bản (ORI) có nguồn gốc từ vi khuẩn. Vùng khởi động (promoter) có nguồn gốc từ thực vật. Vùng kết thúc (terminator). Vùng cắt đặc hiệu của RE (enzyme cắt giới hạn). Vùng gắn gen chuyển vào (MCS). Vùng chứa gen chọn lọc (để tách các tế bào chuyển gen). Vùng chứa các gen báo cáo để biết được các gen chuyển vào có thành công không (GUS, gfp). [5] Hình 2.4. Cấu trúc vector chuyển gen pCAMBIA 2.3.5 Quy trình chuyển gen nhờ vi khuẩn Hình 2.5. Quy trình chuyển gen nhờ vi khuẩn Agrobacterium tumefaciens Bước 1: Thiết kế vector mang gen. Bước 2: Nhân dòng vector nhờ vi khuẩn E.coli. Bước 3: Chuyển vector mang biến nạp từ E.coli sang A.tumefaciens. Bước 4: Nuôi cấy mô Bước 5: Lây nhiễm A.tumefaciens chứa gen biến nạp với tế bào, mô thực vật để tiến hành quá trình chuyển gen sang mô, tế bào đích. Bước 6: Chọn lọc các mô, tế bào được biến nạp thành công. Bước 7: Tái sinh mô, tế bào biến nạp thành cây hoàn chỉnh. Bước 8: Đánh giá sự ổn định di truyền qua các thế hệ. [5] 2.4 Giới thiệu chung về gen kháng sâu 2.4.1 Lịch sử của gen kháng sâu Năm 1901, nhà sinh học người Nhật, Shigetane Ishiwatari đã phát hiện ra vi khuẩn Bacillus thuringiensis (Bt) là nguyên nhân gây chết hàng loạt tằm nhộng. Vi khuẩn được ông đặt tên là Bacillus sotto, nhưng do không đăng ký bản quyền nên sau này tên đã bị thay đổi. Năm 1911, trong khi tìm hiểu vi khuẩn gây chết bướm đêm ăn bột mì vùng Địa Trung Hải, Ernst Berliner lại một lần nữa phát hiện ra Bt. Ông đặt tên vi khuẩn này là Bacillus thuringiensis, lấy từ tên tỉnh Thuringia nước Đức, nơi ông đã tìm thấy loài bướm này. Năm 1938, sản phẩm thương mại Bt đầu tiên tại Pháp được đặt tên là Sporeine. Năm 1956, các nhà nghiên cứu Hannay, Fitz-James và Angus đã phát hiện ra đặc tính trừ côn trùng thuộc bộ cánh vảy chính là do tinh thể trong quá trình phát sinh bào tử Bt gây ra. Những năm 1970, hàng nghìn giống vi khuẩn Bt đã được phát hiện, tuy nhiên mỗi giống chỉ sản xuất protein tinh thể đặc trưng cho giống đó. Những năm 1980, do côn trùng có khả năng kháng lại thuốc trừ sâu tổng hợp xuất hiện, nhu cầu sử dụng Bt đã tăng nhanh chóng. Những năm 1990, chính phủ và các công ty tư nhân đã bắt đầu đầu tư cho việc nghiên cứu Bt. Với tiến bộ của sinh học phân tử, gen Bt mang tinh thể độc đã được chuyển vào trong cây trồng. Năm 1995, cây ngô chuyển gen đầu tiên đã được đăng ký với Cục Bảo vệ môi trường Mỹ. Ngày nay, cây chuyển gen Bt, bao gồm khoai tây, bông, ngô đã được trồng trên toàn thế giới. [29] 2.4.2 Đặc điểm vi khuẩn Bacillus thuringiensis (Bt) Bt là tên viết tắt của Bacillus thuringiensis, một loại vi khuẩn đất điển hình. Đây là vi khuẩn sinh sản bằng bào tử có dạng hình que. Trong quá trình hình thành bào tử, vi khuẩn Bt sản xuất ra tinh thể độc có hình quả trám hoặc hình lập phương. Tinh thể này thực chất là một tập hợp protein, có khả năng gây độc cho một số loại côn trùng. [29] Mỗi dòng Bt khác nhau có những thụ quan khác nhau trên thành ruột côn trùng. Độc tố Bt chỉ phát huy tác dụng khi được gắn với thụ quan thích hợp, giống như ổ khóa và chìa khóa. Chính tính đặc hiệu này làm cho cây Bt chỉ có khả năng chống lại một số loại côn trùng nhất định. Các sinh vật không có thụ quan thích hợp, độc tố Bt không thể phát huy tác dụng, do đó sẽ không bị gây hại. [29] Tính đặc hiệu của độc tố Bt đối với côn trùng đích là một trong những tính trạng khiến Bt trở thành thuốc trừ sâu sinh học lý tưởng. Trên thực tế, các chủng Bt khác nhau sản sinh ra các protein độc đối với một số loài côn trùng nhất định. Độc tố của protein Bt tương tác trực tiếp với thụ thể. Có nghĩa là đối với những côn trùng bị ảnh hưởng bởi protein Bt, trong ruột chúng phải có các vị trí thụ thể đặc trưng để protein có thể kết bám. May mắn là người và đại đa số các côn trùng có ích không có các thụ thể này. [29] 2.4.3 Cơ chế giết côn trùng của tinh thể Bt Một đặc tính độc đáo của vi khuẩn Bt là nó sản xuất ra tinh thể protein trừ sâu trong quá trình hình thành bào tử. Sau khi nuốt phải bào tử có tinh thể protein, nó trở thành chất độc đối với đường ruột sâu hại. Lúc này, enzym tiêu hóa của côn trùng sẽ hoạt hóa độc tính của protein do protein Bt chỉ được hoạt hóa dưới tác động của môi trường kiềm trong ruột côn trùng. Protein gắn với cơ quan thụ cảm đặc hiệu trên thành ruột sâu và làm vỡ tế bào, chọc thủng ruột giữa gây nên sự tổn thương làm chúng ngừng ăn. Côn trùng ngừng ăn trong hai giờ, cơ thể bị tê liệt và chết sau một vài ngày ngày kể từ khi ăn phải tinh thể độc. [29] Quá trình tinh thể Bt tiêu diệt côn trùng: 1. Côn trùng ăn tinh thể và bào tử Bt. 2. Chất độc gắn kết với cơ quan thụ cảm đặc hiệu trong ruột làm côn trùng ngừng ăn. 3. Tinh thể độc phá vỡ thành ruột côn trùng, mở đường cho các bào tử và vi khuẩn đường ruột thông thường xâm nhập vào cơ thể. 4. Các bào tử và vi khuẩn đường ruột sinh sôi nảy nở tiêu diệt côn trùng. Tinh thể độc Bt chỉ có khả năng giết một số loại côn trùng nhất định mà không độc đối với nhiều loài khác. Bt tiêu diệt các loại côn trùng như: sâu đục quả, sâu đục thân, sâu xanh, sâu ăn lá, sâu đo cải bắp, sâu bướm đen trên đồng ruộng; sâu róm thông, sâu đục thân gỗ trong rừng. Khi phun Bt, ruồi và muỗi cũng bị tiêu diệt hoặc ảnh hưởng đến quá trình sinh sản của chúng. [29] 2.4.4 Các chủng Bt chứa gen cry diệt sâu bộ cánh vảy Các gen mã hóa độc tố nằm trên plasmid của vi khuẩn Bt, được gọi chung là cry (crystal) (Held và cộng sự). Theo hệ thống phân loại cũ, các độc tố được chia thành bốn nhóm chính: CryI, cryII, cryIII và cryIV dựa theo hoạt tính trừ sâu của độc tố. Các protein này tiếp đó lại được chia thành các dưới lớp (A, B, C ...) và dưới nhóm (a, b, c ...) theo trình tự ADN của gen độc tố. [10, tr. 527] Bảng 2.1. Hệ thống phân loại độc tố vi khuẩn Bt theo cách cũ [30] Gen Hình dạng tinh thể Kích thước protein (kDa) Côn trùng tác động cry I (nhiều dưới loài: A(a), A(b), A(c), B, C, D, E, F, G) Hình thoi 130-138 Ấu trùng cánh vảy Lepidoptera cry II (dưới loài A, B, C) Hình hộp 69-71 Ấu trùng cánh vảy Lepidoptera và hai cánh Diptera cry III (dưới loài A, B, C) Bằng/không theo quy tắc 73-74 Ấu trùng cánh cứng Coleoptera cry IV (dưới loài A, B, C, D) Hình thoi 73-134 Ấu trùng hai cánh Diptera cry V-IX Thay đổi 35-129 Thay đổi Vi khuẩn Bt gồm rất nhiều chủng và dưới loài (subsp), mỗi loài sản xuất một độc tố khác nhau có thể diệt các loài côn trùng đặc hiệu. Có nhiều chủng Bt đã được phân lập có khả năng diệt côn trùng bộ cánh vảy. B.t. subsp. kurstaki HD-1 tạo tinh thể hình thoi và hình khối trong mỗi tế bào trong quá trình hình thành bào tử (Luthy và cộng sự, 1982); tinh thể hình thoi được mã hóa bởi ba gen cryIA (Aronson và cộng sự, 1986). Nội độc tố tinh thể B.t. subsp. kurstaki HD-73 chứa protein cryIAc (Adang và cộng sự, 1985). B.t. subsp. dendrolimus HD-7 và HD-37 chứa protein CryIA và CryII; B.t. subsp. sotto chứa protein hòa tan trong kiềm khác so với holotype CryIA(a) 24 amino axit. B.t. subsp. subtoxicus HD-10 chứa CryIA và CryIB; B.t. subsp. tolworthi HD-121 chứa CryIA và CryII; và B.t. subsp. aizawai HD-68 chứa CryIA (Hofte và Whiteley, 1989). Payne năm 1993 phát hiện B.t. PS85AI, và một đột biến của PS85AI có khả năng diệt Plutella xylostella, một loại sâu bộ cánh vảy và tạo protein tan trong kiềm có trọng lượng phân tử 130,000 và 60,000 dalton. Payne năm 1991 khẳng định B.t. PS81F (cũng tạo protein tan trong kiềm) có khối lượng phân tử 130,000 và 60,000 dalton và có khả năng chống lại Spodoptera exigua và T. ni; gen độc tố từ PS81F có rất ít tính tương đồng với gen độc từ B.t. subsp. kurstaki HD-1. Năm 1992 Payne xác định B.t. PS81A2 và PS81RR1 tạo protein tan trong kiềm 133,601 và 133,367; cả hai đều diệt sâu Trichoplusia ni, Spodoptera exigua và Plutella xylostella (bộ cánh vảy). Chúng khác các loại B.t. subsp. kurstaki HD-1 và các B.t. phân lập khác. Bernier và cộng sự đã chứng minh chủng A20 tạo nội độc tố mã hóa ít nhất ba gen: 6.6-, 5.3-, và 4.5- (cryIA(a), cryIA(b), và cryIA(c)). Chestukhina và cộng sự năm 1988 phát hiện B.t. subsp. galleriae tạo hai nội độc tố, cả hai đều diệt côn trùng cánh vảy. [30] Tiền độc tố của độc tố cry chống trực tiếp côn trùng cánh vảy có khối lượng phân tử khoảng 130 kDa. Khi một tinh thể bào tử vỏ được côn trùng đích nuốt vào tiền độc tố được hoạt hóa bên trong ruột của nó bằng cách kết hợp pH kiềm (7,5-9,0) và các proteaza, chuyển hóa tiền độc tố thành độc tố hoạt động với khối lượng phân tử khoảng 68kDa. Ở dạng hoạt động, protein độc tố tự chèn vào màng tế bào biểu mô ruột của côn trùng và tạo kênh ion dẫn đến thiếu hụt nghiêm trọng ATP tế bào. Khoảng 15 phút sau khi kênh ion này hình thành, sự chuyển hóa tế bào dừng lại, côn trùng dừng ăn, mất nước rồi chết. Vì việc chuyển hóa tiền độc tố thành độc tố đòi hỏi cả pH kiềm và sự có mặt của các proteaza đặc hiệu, nên rất ít khả năng các loài không phải đích như người và động vật nuôi sẽ bị ảnh hưởng. [10, tr. 530] 2.5 Tình hình nghiên cứu chuyển gen 2.5.1 Tình hình nghiên cứu chuyển gen trên các đối tượng cây trồng 2.5.2.1 Tình hình chuyển gen trên thế giới Tổng diện tích đất trồng cây công nghệ sinh học (CNSH) tiếp tục tăng mạnh trên toàn cầu trong năm 2008, đạt 125 triệu ha. Năm 2008, lần đầu tiên, tổng diện tích luỹ kế trồng cây CNSH, tính trong khoảng thời gian từ năm 1996 đến 2008, vượt mức 800 triệu hecta. Chỉ từ năm 1996 đến 2008, diện tích trồng cây CNSH đã tăng gấp 74 lần, trở thành công nghệ cây trồng được áp dụng nhanh nhất trong lịch sử gần đây. Số nước trồng cây trồng sinh học đã lên tới con số 25 - một mốc lịch sử, đặc biệt, trong số 25 nước trồng cây trồng công nghệ sinh học, có 15 nước là các nước đang phát triển so với 10 nước là các nước công nghiệp. Kể từ khi được đưa vào canh tác đại trà từ năm 1996 đến năm 2008, tính trạng chịu thuốc diệt cỏ tiếp tục là tính trạng được ứng dụng rộng rãi nhất. Ấn Độ là nước có số lượng người trồng cây CNSH tăng nhanh nhất trong năm vừa qua. Đậu tương CNSH tiếp tục là giống cây chính được trồng trong năm 2008 với diện tích 65,8 triệu ha, chiếm 53% diện tích đất trồng cây CNSH trên toàn cầu, tiếp theo là ngô CNSH (37,3 triệu ha, chiếm 30%), bông CNSH (15,5 triệu ha, chiếm 12%) và cải canola chuyển gen (5,9 triệu ha, chiếm 5% diện tích đất trồng cây CNSH trên toàn cầu). [11] 2.5.2.2 Tình hình chuyển gen ở Việt Nam Việc nghiên cứu công nghệ biến đổi gen ở nước ta đã bắt đầu cách đây 10 năm, nhưng thời gian đầu chỉ tập trung vào đào tạo cán bộ. Từ năm 2001, Viện Công nghệ sinh học bắt đầu triển khai các đề tài cấp nhà nước về tạo cây trồng biến đổi gen không làm thực phẩm, như cây hông (lấy gỗ), cây bông vải, hoa... Từ năm 2002, đã chuyển hướng sang cải tạo những cây có củ, như khoai, sắn. Ngoài ra còn có các công trình như cây bông kháng sâu của Viện nghiên cứu bông; cây đu đủ kháng bệnh đốm vòng của Viện Công nghệ sinh học; cây thuốc lá, lúa, đậu xanh, cải bông, cải xanh và cây cà tím mang gen kháng côn trùng, kháng thuốc diệt cỏ của Viện Sinh học nhiệt đới; công trình chuyển gen tổng hợp carotene (tiền vitamin A) vào cây lúa của Viện lúa ĐBSCL; công trình lúa kháng sâu của Viện Công nghệ sinh học. Các công trình nghiên cứu liên quan đến cây trồng biến đổi gen tại Việt Nam mới chỉ triển khai trong phòng thí nghiệp hoặc thử nghiệm ở nhà kính và vườn ươm chứ chưa ra sản xuất đại trà. Các phương pháp chuyển gen chủ yếu được thực hiện thông qua vi khuẩn Agrobacterium tumefaciens hoặc súng bắn gen. [1] Trong khi đó, theo ghi nhận của các nhà khoa học, các giống cây trồng chuyển gen đã ít nhiều xâm nhập vào thị trường trong nước qua nhập khẩu. Nhưng diện tích bao nhiêu, chủng loại gen thế nào thì vẫn chưa xác định được. 2.5.2 Tình hình nghiên cứu chuyển gen trên cây hoa đồng tiền 2.5.2.1 Tình hình nghiên cứu trên thế giới Nghiên cứu về gen CHS ở cây hoa đồng tiền Chalcone synthase (CHS) là enzyme chủ yếu trong quá trình tổng hợp các sắc tố anthocyanin. Năm 1993, Y. Helariutta và cộng sự nghiên cứu sự đa dạng của các gen giống CHS bằng cách phân tích cấu trúc, các kiểu biểu hiện và đặc tính xúc tác của các enzyme tương ứng với ba gen này giải phóng ra trong quá trình phát triển hoa đồng tiền lai. [23] Năm 1993, P. Elomaa và cộng sự khẳng định phương pháp tái sinh và chuyển gen gián tiếp nhờ vi khuẩn Agrobacterium cho cây hoa đồng tiền lai, một cây hoa trang trí có giá trị thương mại quan trọng đã và đang được phát triển. Công trình của họ mang tên "Chuyển cDNA mang chalcone synthase ức chế sắc tố hoa vào cây hoa đồng tiền gián tiếp thông qua vi khuẩn Agrobacterium". Họ đã tiến hành đồng nuôi cấy các đoạn cuống lá của giống đồng tiền đỏ Terra Regina với vi khuẩn Agrobacterium tumefaciens vectơ có mang một cDNA antisense mã hóa chalcone synthase đồng tiền dưới sự điều khiển của CaMV 35S promoter và nos-nptII marker. Các mẫu chuyển gen được chọn lọc trên môi trường kanamycin và được tái sinh thành cây hoàn chỉnh. cDNA antisense đã ngăn cản sự tổng hợp anthocyanin và làm thay đổi đáng kể sắc tố hoa ở một số mẫu chuyển gen. [19] Năm 1995, P. Elomaa cùng cộng sự cũng đã thành công trong việc chuyển 2 loại cDNA khác nhau gchs1 và gchs2 thuộc cùng một họ gen CHS dưới sự điều khiển của CaMV 35S promoter vào cây hoa đồng tiền. Việc kìm hãm sự biểu hiện gen sử dụng kỹ thuật antisense đã thành công ở nhiều trường hợp. Tuy nhiên trong báo cáo này, họ đưa ra một hình thức ức chế biểu hiện gen khác của các thành phần trên họ chalcone synthase (chs) của các cây hoa đồng tiền chuyển gen. Họ đã chuyển hai loại cDNAs khác nhau của họ chs, đó là gchs1 và gchs2, theo hướng antisense dưới sự điều khiển của CaMV 35S promoter vào cây hoa đồng tiền. Rõ ràng gchs2 không liên quan đến việc tổng hợp anthocyanin và mã hõa một enzyme với đặc tính xúc tác mới. Trong cả hai trương hợp, việc ngăn chặn hiệu quả sự biểu hiện gen resident sense đã được xác định. Thêm vào đó, việc chuyển gen tác động khác nhau đến sự biểu hiện của các thành phần khác của họ gen chalcone synthase. Mức độ của việc ngăn chặn phụ thuộc vào chuỗi tương đồng giữa antisense và các gen đích. Trong các trường hợp màu sắc kiểu hoa ở các mẫu chuyển gen anti- gchs1 thay đổi trong quá trình phát triển, sự suy giảm ảnh hưởng của antisense bắt đầu từ thành phần xa nhất của họ gen, xa hơn là ảnh hưởng của chuỗi tương đồng đối với sự ổn định của việc ngăn chặn antisense. [20] Nghiên cứu về gen DFR ở cây hoa đồng tiền Gen có vai trò trong việc hình tạo màu sắc của hoa là gen DFR (dihydroflavonol-4-reductase). Gen này tổng hợp ra enzyme DFR, một enzyme có vai trò trong quá trình tổng hợp sắc tố tạo màu cho hoa. Năm 1993, Y. Helariutta và cộng sự đã nhân dòng cDNA mã hóa gen DFR và mô tả sự biểu hiện của DFR trong cánh hoa đồng tiền giống lai Regina. Hai năm sau, họ tiếp tục phát hiện ra hoa đồng tiền có sự điều khiển ở nhiều mức độ tổ chức khác nhau trên gen DFR trong quá trình nở hoa. Năm 1995, P. Elomaa và cộng sự đã biến đổi RL01 Petunia đột biến với các cDNA A1 từ ngô và gdfr từ đồng tiền, cả hai đều mã hóa DFR hoạt động. Các thí nghiệm đều sử dụng cùng một loại vector Agrobacterium và CaMV 35S promoter. Kết quả thu hai kiểu hình khác nhau rõ rệt. Hoa được chuyển gen A1 nhợt nhạt và màu sắc thay đổi trong khi hoa được chuyển gen gdfr thì có màu rực rỡ và ổn định trong quá trình phát triển. Tiếp theo, rất nhiều công trình nghiên cứu của các tác giả về gen DFR trên cây hoa đồng tiền đã ra đời như Paula Elomaa 1998, Stefan Martens 2002, Anne Uimari 2003... Năm 1998, V. Nagarajiu, G.S.L.Srinivas và G.Lakshmi Sita nghiên cứu quy trình chuyển gen bằng vi khuẩn Agrobacterium cho cây hoa đồng tiền có giá trị thương mại. Nguồn vật liệu là cuống lá, lá, chồi đỉnh. Đồng nuôi cấy chúng với vi khuẩn Agrobacterium dòng LBA4404. Chủng vi khuẩn này mang vector đôi gồm gen nptII và gen uidA. Môi trường tạo callus và tái sinh chồi: MS + BA + 1 mg/l kinetin + 0,5 mg/l NAA. Môi trường chọn lọc mẫu sau chuyển gen có bổ sung thêm 20 mg/l kanamycin thu được kết quả 0,44-17% mẫu sống. Kết quả của chuyển gen nptII và uidA được khẳng định bởi phương pháp PCR và lai Southern Blot. Các chồi chuyển gen được nhân trên môi trường MS + 0,25 mg/l BA, ra rễ trên môi trường MS, và đưa ra giá thể đất thành công. Quy trình này có thể áp dụng để chuyển các gen quan trọng có thể điều khiển được quá trình tổng hợp sắc tố hoa. [27] Nghiên cứu về gen MADS-box ở cây hoa đồng tiền Sự nở hoa của họ cúc phát triển cụm hoa dạng đầu với hàng nghìn hoa riêng biệt. Ở đồng tiền, có ba loại hoa phân biệt trong cụm hoa dạng đầu: hoa phía ngoài mép của cụm hoa đầu, hoa chuyển tiếp ở giữa và hoa ở trung tâm đĩa hoa. Các hoa có nhiều hình thái thay đổi theo giới tính và mức độ đối xứng. Để nghiên cứu cơ sở phân tử về mức độ phức tạp của hoa họ cúc, một số gen MADS-box ở đồng tiền đã được phân lập. Dựa trên phân tích hệ thống phát sinh loài và so sánh các gen MADS-box của Arabidopsis và Antirrhinum, các gen phân lập được nhóm thành các gen ABC MADS-box. Tuy nhiên, phân tích sự biểu hiện phát hiện một số trong những gen này có thể có những chức năng khác. Chuyển gen ở cây hoa đồng tiền sử dụng sense và antisense từ các cDNA được phân lập đã mang lại nhiều thông tin bổ ích. Trước tiên, chúng ta có thể xác định mô hình ABC của sự phát triển hoa chủ yếu ở bộ cúc. Thứ hai, nó chứng minh rằng các vai trò giả thiết của các gen phân lập như các gen chức năng ABC là đúng. Thứ ba, và là quan trọng nhất, chuyển gen đã phát hiện vai trò của các gen MADS-box mà ban đầu chức năng của chúng bị ẩn đi. [22] Năm 2001, P. Elomaa1 và T.H. Teeri đã nghiên cứu hoa đồng tiền chuyển gen. Công trình này khẳng định không chỉ cDNAs của đồng tiền mà gen của các loài thực vật khác cũng đã được chuyển thành công vào cây hoa đồng tiền. Việc sử dụng nhiều gen của đường hướng flavonoid và các gen MADS-box có thể khử sắc tố hoa và thay đổi đặc điểm cấu trúc ở giống Terra Regina. Bên cạnh đó các thông tin quan trọng của kỹ thuật antisense cũng đã đạt được. Phương pháp antisense ở cây đồng tiền có hiệu quả cao và có thể được ứng dụng để tạo đột biến cho nhiều gen, do đó cũng tạo ra các kiểu hình mới. Gần một nửa số gen chuyển đột biến này đã phát hiện có sự biểu hiện của gen mới bị khử. [23] Năm 2008, Miia Marika Ainasoja và cộng sự đã tiến hành so sánh các dòng đồng tiền chuyển gen và các giống truyền thống. Kết luận không có sự khác nhau về cytotoxicity hay trao đổi chất. Như vậy, hiện có nhiều công trình nghiên cứu chuyển gen trên đối tượng hoa đồng tiền trên thế giới nhưng chủ yếu tập trung vào các gen làm thay đổi màu sắc và làm cho hoa đồng tiền trở nên đẹp hơn, có giá trị thương mại cao hơn. Phương pháp chuyển gen sử dụng chủ yếu là gián tiếp nhờ vi khuẩn Agrobacterium tumefaciens. 2.5.2.2 Tình hình nghiên cứu ở Việt Nam Nghiên cứu hệ thống tái sinh cây hoa đồng tiền Trước khi tiến hành chuyển gen, cần nghiên cứu hệ thống tái sinh làm cơ sở để tái sinh cây sau khi chọn lọc. Hiện đã có một số công trình liên quan được công bố bao gồm: Nghiên cứu quy trình nhân nhanh cây hoa đồng tiền (Nguyễn Quang Thạch, Nguyễn Thị Lý Anh, Hoàng Thị Nga, Nguyễn Thị Phương Hoa, 2002); Nghiên cứu nhân nhanh in vitro giống hoa đồng tiền Nam Phi (Gerbera Jamesoll) (Trịnh Quốc Bình, 2005); Nghiên cứu hoàn thiện hệ thống tái sinh cây hoa đồng tiền và lily phục vụ tạo giống hoa mới bằng kỹ thuật chuyển gen (Nguyễn Quang Thạch, Nguyễn Thị Lý Anh, 2005); Nghiên cứu nhân giống vô tính cây hoa đồng Tiền (Gerbera jamesonii) từ lát mỏng tế bào phát hoa (Đặng Lâm Trúc, 2005); Nghiên cứu sản xuất cây hoa đồng tiền (Gerbera jamesonii Bolus) bằng kỹ thuật nhân giống in vitro (Trần Tế, Đoàn Nhân Ái,Trương Thị Bích Phượng, 2008). Nghiên cứu về chuyển gen ở cây hoa đồng tiền Theo "Kết quả bước đầu chuyển gen vào cây hoa Đồng tiền Gerbera jamesonii “Ferrari” nhờ vi khuẩn Agrobacterium tumefaciens" (Nguyễn Quang Thạch và cộng sự, 2006), một số các thông số trong quy trình chuyển gen cho cây đồng tiền Ferrari nhờ vi khuẩn Agrobacterium tumefacien đã được xác định. Chất kháng sinh cefotaxime bổ sung vào môi trường nuôi cấy để diệt vi khuẩn Agrobacterium tumefaciens được xác đinh ở nồng độ 500 mg/lít. Nồng độ PPT dùng cho chọn lọc là 2,5 mg/lít cho callus và 3,0 ppm trở lên được dùng làm nồng độ cho chọn lọc các cây đồng tiền đó được chuyển gen kháng PPT trong điều kiện nuôi cấy in vitro. Môi trường đồng nuôi cấy vi khuẩn và callus đồng tiền là: MS, 30g/l sucrose, 10g/l gluco, 2mg/l BA, 0,3mg/l kinetin, 0,1mg/l IAA, 1g/l cassamino acid, 20mg/l AS, 7,0 gram agar/lít, pH = 5,4. Sau chọn lọc 3 lần, đã có sự biểu hiện của gen gus trong callus đồng tiền Ferrari. Trên môi trường có bổ sung PPT ở nồng độ 3,0 mg/lít, đã tái sinh được 2 cây đồng tiền sau chọn lọc. Kết quả điện di sau khi nhân đoạn gen nos cho phép khẳng định đã thu được hai cây đồng tiền chuyển gen. [13] Phạm Thị Dung (2008), trong Báo cáo tốt nghiệp về "Nghiên cứu chuyển gen cho hoa đồng tiền nhờ vi khuẩn đất Agrobacterium tumefaciens" đã khẳng định: Thời gian đồng nuôi cấy thích hợp nhất cho chủng khuẩn Agrobacterium tumerfaciens AA16 mang gen gfp là 2 ngày trong điều kiện 280C, bóng tối; nguồn mẫu thích hợp đưa vào đồng nuôi cấy là đoạn thân mang mắt ngủ; phương pháp cắt mẫu trên giấy thấm vô trùng sau đó lây nhiễm trong dịch vi khuẩn đạt hiệu quả chuyển gen tốt nhất; tiền nuôi cấy 5 ngày là khoảng thời gian thích hợp nhất trước khi tiến hành lây nhiễm với vi khuẩn; phương thức lây nhiễm với dịch vi khuẩn pha loãng sau đó đồng nuôi cấy trên môi trường đồng nuôi cấy; kiểm tra biểu hiện của gen gfp trong mẫu ở giai đoạn callus và cây tái sinh có xuất hiện gen trong callus, lá, rễ.[5] Một số công trình nghiên cứu chuyển gen khác cũng được tiến hành trên đối tượng cây hoa đồng tiền là: Nghiên cứu xác định một số yếu tố trong quy trình chuyển gen cho cây lily và cây đồng tiền thông qua vi khuẩn Agrobacterium tumefaciens (Nguyễn Quang Thạch và cộng sự, 2006); Nghiên cứu hệ thống tái sinh và bước đầu chuyển gen trên cây đồng tiền nhờ vi khuẩn Agrobacterium tumefaciens (Trần Ngọc Tuân, 2006). 3. ĐỐI TƯỢNG, ĐỊA ĐIỂM, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1 Đối tượng, địa điểm nghiên cứu 3.1.1 Đối tượng Cây hoa đồng tiền nuôi cấy mô giống Gerbera jamesonii "Ferrari". Hình 3.2. Sơ đồ cấu trúc plasmid ITB2c trong vi khuẩn Agrobacterium tumefaciens - Vi khuẩn Agrobacterium tumefaciens chủng EHA 105 mang plamid ITB2c (do Viện Sinh học nhiệt đới ITB Institute of Tropical Biology cung cấp) mang 3 gen: + Gen gus: gen chỉ thị màu sắc (gen chọn lọc) + Gen cryIAc: gen kháng sâu (gen mục tiêu) + Gen bar: gen kháng thuốc trừ cỏ (vừa là gen mục tiêu, vừa là gen chọn lọc) - Các bộ phận của cây hoa đồng tiền in vitro: callus, đoạn thân mang mắt ngủ, lá. - Cặp mồi Promoter 35S CACTACAAATGCCATCATTGCGATA CTTATATAGAGGAAGGGTCTTGCGA - Thuốc kháng sinh cefotaxime - Thuốc trừ cỏ phosphinothricin (PPT) 3.1.3 Địa điểm - Phòng Công nghệ sinh học thực vật - Viện Sinh học Nông Nghiệp Tầng 3 giảng đường B - Trường Đại học Nông nghiệp Hà Nội. 3.1.4 Thời gian Từ 05/ 2008 đến 06/2009. 3.2 Nội dung nghiên cứu Hình 3.3. Sơ đồ quy trình nghiên cứu 3.2.1 Nhóm thí nghiệm xác định các thông số cho quá trình chuyển gen Trong vòng 1 tuần trước khi tiến hành chuyển gen, các thí nghiệm đều phải chuẩn bị các phần sau: - Chuẩn bị mẫu cấy (tiền nuôi cấy): cắt mô của cây hoa đồng tiền in vitro thành các đoạn nhỏ rồi đặt trên môi trường tái sinh. Các chồi còn lại được đặt trên môi trường nhân để tiếp tục tạo mẫu cho các thí nghiệm sau. - Chuẩn bị dụng cụ: Giấy sạch để cắt mẫu, đĩa petri để đựng môi trường đồng nuôi cấy và giấy thấm vô trùng, ống li tâm để li tâm vi khuẩn, bình không để đựng mẫu khi lây nhiễm, giấy thấm vô trùng, ống đong 10 ml để đong As bổ sung vào môi trường pha loãng vi khuẩn và đồng nuôi cấy sau khi hấp. Tất cả các dụng cụ chuyển gen đều được hấp vô trùng trước khi sử dụng. - Chuẩn bị môi trường: môi trường LB lỏng, môi trường pha loãng vi khuẩn, môi trường đồng nuôi cấy. - Chuẩn bị vi khuẩn: Lấy 50 ml dung dịch LB lỏng cho vào bình trụ. Dùng panh lấy 2 gợt vi khuẩn từ đĩa petri chứa vi khuẩn Agrobacterium tumefaciens (để trong tủ lạnh) nhúng vào dung dịch LB. Đậy nắp bạc rồi đặt vào máy lắc trong vòng 12-24 giờ tùy thuộc vào nhiệt độ. Các thao tác chuyển gen được tiến hành theo trình tự sau: Lấy dung dịch đựng vi khuẩn đã lắc từ ngày hôm trước cho vào 2 ống li tâm Đặt 2 ống li tâm ở vị trí đối xứng nhau vào máy li tâm, cài đặt chế độ để máy chạy với tốc độ 5000 vòng/phút trong 10 phút Mang 2 ống li tâm trở lại box cấy để gạn bỏ nước, khối màu hồng vàng ở đáy ống là sinh khối vi khuẩn Đổ 100 ml dung dịch pha loãng vi khuẩn vào bình trụ, đổ đầy 2 ống li tâm bằng dung dịch này Lắc tan vi khuẩn ở đáy ống vào trong dung dịch pha loãng vi khuẩn bằng máy Vontech Đổ dung dịch vi khuẩn đã lắc trở lại bình trụ và lắc đều, thu được dung dịch vi khuẩn pha loãng Gắp các mẫu đã được tiền nuôi cấy ra bình trụ Tiến hành lây nhiễm mẫu với vi khuẩn bằng cách ngâm với dung dịch vi khuẩn, cắt mẫu trong dung dịch hoặc nhỏ giọt dung dịch khuẩn lên mẫu Gắp giấy thấm vô trùng trong lọ ra đặt trên đĩa petri Gạn nước ra và gắp mẫu để trên giấy thấm vô trùng Gắp mẫu vào đĩa petri chứa môi trường đồng nuôi cấy Dán parafin, ghi nhãn, cho vào hộp giấy, để chỗ tối một vài ngày Mẫu đối chứng được cấy ngay vào môi trường đồng nuôi cấy không lây nhiễm với vi khuẩn 3.2.1.1 Thí nghiệm 1 Xác định mô thích hợp cho chuyển gen Sử dụng 3 phần khác nhau của cây hoa đồng tiền in vitro để chuyển gen: callus, đoạn thân mang mắt ngủ và lá. Mục đích là tìm ra loại mô có khả năng nhận gen mục tiêu từ vi khuẩn có hiệu quả cao nhất. Các thí nghiệm sau sẽ sử dụng kết quả của thí nghiệm này để tiến hành chuyển gen. Công thức đối chứng gồm cả 3 loại mô trên nhưng không được lây nhiễm với vi khuẩn. Bảng 3.1. Xác định mô thích hợp cho chuyển gen Công thức Mô 1 Đối chứng 2 Callus 3 Đoạn thân mang mắt ngủ 4 Lá 3.2.1.2 Thí nghiệm 2 Xác định thời gian đồng nuôi cấy thích hợp Tiến hành nuôi cấy đồng thời vi khuẩn và mẫu cấy trong cùng một môi trường trong các khoảng thời gian khác nhau: 2 ngày, 3 ngày, 4 ngày, 5 ngày để tìm ra khoảng thời gian thích hợp nhất cho gen biến nạp từ vi khuẩn vào mẫu cấy. Công thức đối chứng là mẫu cấy được cấy vào môi trường đồng nuôi cấy nhưng không có vi khuẩn. Bảng 3.2. Xác định thời gian đồng nuôi cấy thích hợp Công thức Thời gian đồng nuôi cấy (ngày) 1 Đối chứng 2 2 3 3 4 4 5 5 3.2.1.3. Thí nghiệm 3 Xác định thời gian tiền nuôi cấy thích hợp Trước khi lây nhiễm với vi khuẩn, mẫu được cắt từ các bộ phận của cây và nuôi cấy khởi động trong môi trường tái sinh. Thời gian tiền nuôi cấy này có ảnh hưởng đến việc làm lành vết thương và tạo callus của mẫu. Tiến hành tiền nuôi cấy trong thời gian: 1 ngày, 3 ngày, 5 ngày, 7 ngày và 9 ngày. Đối chứng là mẫu được nuôi khởi động ở các ngày trên nhưng không lây nhiễm với vi khuẩn. Mỗi công thức cách nhau 1 ngày nhằm tìm ra thời gian thích hợp nhất. Bảng 3.3. Xác định thời gian tiền nuôi cấy thích hợp Công thức Thời gian tiền nuôi cấy (ngày) 1 Đối chứng 2 1 3 3 4 5 5 7 6 9 3.2.1.4 Thí nghiệm 4 Xác định kỹ thuật lây nhiễm thích hợp Bảng 3.4. Xác định kỹ thuật lây nhiễm thích hợp Công thức Kỹ thuật lây nhiễm 1 Đối chứng 2 Ngâm mẫu vào dung dịch vi khuẩn (5-10 phút) 3 Nhỏ dịch vi khuẩn vào mẫu cấy 4 Cắt mẫu trực tiếp trong dung dịch vi khuẩn 3.2.1.5 Thí nghiệm 5 Xác định kỹ thuật rửa khuẩn thích hợp Bảng 3.5. Xác định kỹ thuật rửa khuẩn thích hợp Công thức Kỹ thuật rửa khuẩn 1 Đối chứng 2 Tráng 3 Lắc 60 giây 4 Lắc 30 giây 5 Lắc 5-10 giây 3.2.2 Nhóm thí nghiệm xác định sự hiện diện của các gen chuyển vào 3.2.2.1 Thí nghiệm 6 Xác định sự hiện diện của gen qua môi trường chọn lọc Tất cả các mẫu sạch khuẩn được cấy chuyển 2 tuần một lần sang môi trường chọn lọc có bổ sung thuốc trừ cỏ PPT 2,5 ml/l. Nếu mẫu sống thì lặp lại thao tác cấy chuyển trên môi trường chọn lọc trong 2 tháng. Loại bỏ các mẫu chết. Mẫu sống thì khẳng định có sự hiện diện của gen bar kháng thuốc trừ cỏ. 3.2.2.2 Thí nghiệm 7 Xác định sự hiện diện của gen chỉ thị gus Các mẫu sống thu được sau khi chọn lọc được chuyển sang môi trường tái sinh tạo chồi. Sau 4 tuần, cắt lá và sử dụng phương pháp Jefferson (1987) để xác định sự biểu hiện tạm thời của gen gus. Tiến hành với 30 mẫu, chia thành 3 lần lặp lại. Nếu kết quả soi trên kính hiển vi thấy xuất hiện màu xanh chàm trên bề mặt mẫu thì khẳng định có sự hiện diện của gen chỉ thị gus. 3.2.2.3 Thí nghiệm 8 Xác định sự hiện diện của gen qua PCR Lấy lá của các cây đồng tiền đã chuyển gen, tách chiết ADN, chạy PCR sử dụng cặp mồi đặc hiệu Promoter 35S. Nếu kết quả dương tính thì khẳng định có sự hiện diện của gen CryIAc kháng sâu. 3.2.3 Nhóm thí nghiệm đánh giá sản phẩm chuyển gen 3.2.3.1 Thí nghiệm 9 Xác định sâu bộ cánh vảy hại cây hoa đồng tiền Quy trình tiến hành như sau: - Tìm hiểu đặc điểm, hình thái các sâu thuộc bộ cánh vảy Lepidoptera. - Thu bắt các sâu thuộc bộ cánh vảy trên đồng ruộng. - Cho mỗi sâu vào trong một hộp có đục lỗ ._.

Các file đính kèm theo tài liệu này:

  • docLuận văn up.doc
Tài liệu liên quan