Khảo sát đặc tính sinh học phân tử của một số chủng virus viêm gan vịt cường độc phân lập được trên đàn vịt ở một số địa phương và so sánh với chủng virus vacxin DH - EG - 2000

Tài liệu Khảo sát đặc tính sinh học phân tử của một số chủng virus viêm gan vịt cường độc phân lập được trên đàn vịt ở một số địa phương và so sánh với chủng virus vacxin DH - EG - 2000: ... Ebook Khảo sát đặc tính sinh học phân tử của một số chủng virus viêm gan vịt cường độc phân lập được trên đàn vịt ở một số địa phương và so sánh với chủng virus vacxin DH - EG - 2000

pdf84 trang | Chia sẻ: huyen82 | Ngày: 09/12/2013 | Lượt xem: 1888 | Lượt tải: 7download
Tóm tắt tài liệu Khảo sát đặc tính sinh học phân tử của một số chủng virus viêm gan vịt cường độc phân lập được trên đàn vịt ở một số địa phương và so sánh với chủng virus vacxin DH - EG - 2000, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
BỘ GIÁO DỤC VÀ ðÀO TẠO TRƯỜNG ðẠI HỌC NÔNG NGHIỆP HÀ NỘI ---------------------- LÊ VĂN BIÊN KHẢO SÁT ðẶC TÍNH SINH HỌC PHÂN TỬ CỦA MỘT SỐ CHỦNG VIRUS VIÊM GAN VỊT CƯỜNG ðỘC PHÂN LẬP ðƯỢC TRÊN ðÀN VỊT Ở MỘT SỐ ðỊA PHƯƠNG VÀ SO SÁNH VỚI CHỦNG VIRUS VACXIN DH – EG – 2000 LUẬN VĂN THẠC SĨ NÔNG NGHIỆP Chuyên ngành : Thú y Mã số : 60.62.50 Người hướng dẫn khoa học : TS. NGUYỄN BÁ HIÊN HÀ NỘI – 2011 Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… i LỜI CAM ðOAN Tôi xin cam ñoan rằng, số liệu và kết quả nghiên cứu nêu trong luận văn là trung thực, do chính tôi thực hiện và chưa từng ñược công bố hay bảo vệ trong một học vị nào. Tôi xin cam ñoan rằng, mọi sự giúp ñỡ cho việc thực hiện luận văn này ñã ñược cảm ơn và các thông tin trích dẫn trong luận văn ñều ñã ñược ghi rõ nguồn gốc. Hà Nội, ngày 8 tháng 9 năm 2011 Tác giả luận văn Lê Văn Biên Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… ii LỜI CẢM ƠN Sau thời gian học tập và nghiên cứu, ñến nay tôi ñã hoàn thành khóa học. Nhân dịp hoàn thành luận văn thạc sỹ nông nghiệp chuyên ngành Thú y cho phép tôi ñược bày tỏ lòng biết ơn chân thành, sâu sắc tới các Thầy, Cô giáo. Xin ñược gửi lời cảm ơn sâu sắc nhất ñến Thầy TS. Nguyễn Bá Hiên, Bộ môn Vi sinh vật – Truyền nhiễm – Khoa Thú y – Trường ðH Nông Nghiệp Hà Nội, người thầy ñã tận tình hướng dẫn trực tiếp và tạo mọi ñiều kiện thuận lợi cho tôi ñược học tập, thực hành thí nghiệm và giúp ñỡ tôi hoàn thành ñề tài nghiên cứu này. ðồng thời tôi cũng bày tỏ sự biết ơn ñến các Thầy, Cô trong bộ môn Vi sinh vật - Truyền nhiễm - Khoa Thú y – Trường ðH Nông Nghiệp Hà Nội và các anh chị phòng Thí nghiệm trung tâm Khoa Thú y (B213 & B214) ñã nhiệt tình giúp ñỡ và tạo mọi ñiều kiện giúp tôi hoàn thành ñề tài một cách tốt nhất. Cuối cùng tôi muốn bày tỏ lòng biết ơn sâu sắc ñến cơ quan, những người thân trong gia ñình, bạn bè ñã luôn ñộng viên, giúp ñỡ tôi trong suốt thời gian học tập và thực hiện ñề tài nghiên cứu. Xin trân trọng cảm ơn! Hà nội, ngày 8 tháng 09 năm 2011 Học viên Lê Văn Biên Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… iii MỤC LỤC Lời cam ñoan i Lời cảm ơn ii Mục lục iii Các chữ cái viết tắt v Danh mục bảng vi Danh mục hình vii 1. MỞ ðẦU 49 1.1 ðặt vấn ñề 1 1.2 Mục tiêu nghiên cứu của ñề tài 2 2. TỔNG QUAN TÀI LIỆU 3 2.1 Bệnh viêm gan virus ở vịt 3 2.2. Một số ñặc tính của virus viêm gan vịt 12 2.3 Sinh học phân tử của virus viêm gan vịt 14 2.4 Miễn dịch chống virus viêm gan vịt 19 2.5 Các kỹ thuật sinh học phân tử 20 2.6 Tình hình nghiên cứu bệnh viêm gan vịt trên thế giới và việt nam 24 3. NỘI DUNG, VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 28 3.1 Nội dung nghiên cứu 28 3.2 Vật liệu nghiên cứu 28 3.3. Phương pháp nghiên cứu 31 4. KẾT QUẢ VÀ THẢO LUẬN 46 4.1. Kết quả phân lập virus viêm gan vịt cường ñộc 46 4.1.1. Phân lập trên phôi vịt 46 4.1.2 Nghiên cứu biến ñổi bệnh lý của phôi vịt khi phân lập virus. 50 Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… iv 4.2 Kết quả tách chiết rna tổng số 52 4.3 Kết quả phản ứng rt-pcr 53 4.4 Kết quả dòng hóa và tách dòng sản phẩm 56 4.4.1 Kết quả dòng hóa sản phẩm vào tế bào khả biến E.coli 56 4.4.2 Kết quả kiểm tra DNA plasmid tái tổ hợp 58 4.5 Kết quả giải trình tự nucleotide và axit amin của gen kháng nguyên vp1 ở các chủng virus viêm gan vịt phân lập ñược và chủng virus vacxin dh-eg-2000 59 4.6 So sánh sự ñồng nhất nucleotide, sự tương ñồng amino acid của vùng gen vp1 giữa các chủng virus viêm gan vịt cường ñộc nb, dn1, nc và chủng virus vacxin dh-eg-2000. 64 5. KẾT LUẬN VÀ ðỀ NGHỊ 67 5.1 Kết luận 67 5.2 ðề nghị 67 TÀI LIỆU THAM KHẢO 69 Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… v CÁC CHỮ CÁI VIẾT TẮT DHV Duck Hepartitis Virus DNA Acid Deoxyribonucleic RNA Acid Ribonucleic VP Viral Protein PCR Polymerase Chain Reaction RT-PCR Revese Transcription- Polymerase Chain Reaction EDTA Ethylen Dimine Tetra Acetic Acid dNTP Deoxy Nucleotide Triphosphate ddNTP Dideoxy Nucleotide Triphosphate X-gal 5-Bromo- 4-chloro-3-indolyl-beta-D-galactopyranoside Taq Polymerase Thermus aquaticus polymerase LB Luria Bertani-agar UTR Untranslated Region cs Cộng sự tr Trang Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… vi DANH MỤC BẢNG STT Tên hình Trang 3.1 Danh sách các mẫu bệnh phẩm viêm gan vịt sử dụng trong nghiên cứu 29 3.2 Các ñoạn mồi sử dụng trong phản ứng RT-PCR 29 3.3 Thành phần phản ứng RT-PCR 34 3.4 Chu kỳ nhiệt của phản ứng PCR 35 4.1 Kết quả phân lập virus gây bệnh viêm gan vịt trên phôi vịt 48 4.2 Kết quả kiểm tra bệnh tích ñại thể của phôi vịt phân lập virus 50 4.3 Tỷ lệ (%) ñồng nhất về nucleotide (trên ñường chéo) và tương ñồng axit amin (dưới ñường chéo) giữa các chủng virus viêm gan vịt cường ñộc NB, DN1, NC và chủng virus vacxin DH-EG- 2000. 65 Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… vii DANH MỤC HÌNH STT Tên hình Trang 2.1 Tư thế chết ñiển hình của vịt khi bị nhiễm virus viêm gan vịt (a) Gan vịt xuất huyết (b) 7 2.2 Cấu trúc không gian của picornavirus 15 2.3 Sơ ñồ hệ gen và chuỗi polypeptide của virus viêm gan vịt 16 2.4 Mô hình các bước của phản ứng PCR 21 2.5 Mô hình nguyên lý của phản ứng RT-PCR 22 3.1 Sơ ñồ vị trí bám của mồi ñể thu nhận ñoạn DNA (~0,8kb) chứa gen VP1 (714bp) và chiến lược giải mã gen VP1 của virus viêm gan vịt bằng cặp mồi DH3F-DH4R (ảnh minh hoạ) 30 3.2 Sơ ñồ qui trình nghiên cứu, lưu giữ và giải mã vùng gen VP1 của virus viêm gan vịt. 44 4.1 Kiểm tra RNA tổng số tách chiết từ các mẫu 53 4.2 Kết quả ñiện di sản phẩm RT-PCR (~ 800 bp) của mẫu virus cường ñộc viêm gan vịt DN1, DN2 và NB trên thạch agarose 1,2%. 54 4.3 Kết quả ñiện di sản phẩm RT-PCR (~800 bp) của mẫu HY, DH- EG-2000 và NC trên thạch agarose 1%. 55 4.4 Kết quả nuôi cấy vi khuẩn tái tổ hợp trên ñĩa thạch (LB-agar 1,5%) có chứa kháng sinh Kanamycin và X-gal, bao gồm các khuẩn lạc xanh và trắng cần chọn lọc. 56 4.5 Kết quả tách dòng vùng gen VP1 của virus viêm gan vịt ñược ñiện di kiểm tra trên thạch agarose 1,2%, các sản phẩm DNA plasmid ñược kiểm tra bằng cách cắt với enzyme EcoRI. 58 Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… viii 4.6 Giản ñồ giải trình tự (chromatogram) thành phần nucleotide của vùng gen VP1 virus viêm gan vịt của các chủng lần lượt là DN2, DN1, NB, HY, DH-EG-2000 và NC Các nucleotide tiếp nhận thuốc nhuộm huỳnh quang (fluorescent dye), khi ñọc bằng tia laze cho hiển thị Adenine có màu ñỏ (red), Thymine có màu xanh nước biển (blue), Guanine có màu xanh lá cây (green) và Cystosine có màu ñen (black). 60 4.7 Trình tự Nucleotit và axit amin tương ứng của vùng gen VP1 của các chủng virus viêm gan vịt lần lượt là DN2, DN1, NB, HY, DH-EG-2000 và NC. 64 Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 1 1. MỞ ðẦU 1.1 ðặt vấn ñề Việt Nam là một nước ñang phát triển với ngành nông nghiệp luôn giữ vai trò then chốt nhằm cung cấp lương thực - thực phẩm cho người tiêu dùng trong nước và từng bước xuất khẩu. Trong ñó ngành chăn nuôi gia cầm, ñặc biệt ngành chăn nuôi vịt trở thành ngành sản xuất hàng hóa quan trọng góp phần vào chương trình xóa ñói giảm nghèo cho bà con nông dân. Xuất phát từ những ñặc ñiểm riêng biệt về ñịa hình và tập quán canh tác ñiều kiện thuận lợi cho việc chăn thả tự nhiên nên vịt là loài thủy cầm ñược người nông dân ưa chuộng vì chúng dễ nuôi, qui mô ñàn ña dạng phù hợp với tập quán chăn nuôi nhỏ lẻ. Tuy nhiên song song với việc phát triển của ñàn vịt thì dịch bệnh xảy ra ngày càng nhiều và diễn biến rất phức tạp. Một trong những bệnh thường gặp và gây thiệt hại kinh tế cho người chăn nuôi phải kể ñến bệnh viêm gan vịt, bệnh chỉ xẩy ra ở vịt con dưới 6 tuần tuổi nhưng thường thấy ở vịt con từ 1 – 3 tuần tuổi mà nặng nhất lại ở vịt con từ 1 – 7 ngày tuổi với tỷ lệ ốm, chết lên tới 95 - 100%. Tuy vậy những nghiên cứu về bệnh viêm gan vịt do virus ở nước ta chưa nhiều, ñặc biệt là nghiên cứu về hệ gen của các chủng virus thuộc các vùng khác nhau ở nước ta. Các nghiên cứu chỉ ra rằng hệ gen của virus gây bệnh viêm gan vịt chứa axit ribonucleic (RNA), sợi ñơn dương có ñộ dài khoảng 7600 – 7700 Nucleotide. Trong hệ gen của virus viêm gan vịt thì vùng ñược quan tâm nhiều nhất là vùng gen mã hóa cho protein cấu trúc VP1. Vùng gen này ñã ñược chứng minh là gen kháng nguyên thiết yếu, nó vừa quyết ñịnh tính kháng nguyên, vừa quyết ñịnh tính gây bệnh của virus (Mulder và cs 2000). Mặt khác, các nghiên cứu gần ñây về hệ gen và sinh học phân tử phân loại virus ñều cho thấy virus viêm gan vịt thuộc về một nhóm mới trong họ Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 2 Picornaviridae; hơn nữa, ñã có biến ñổi ñể tạo nên những genotype và serotype khác biệt. ðồng thời, các nghiên cứu này cũng xác ñịnh virus viêm gan vịt không còn thuộc chi Enterovirus hoặc ít nhất ñã có những biến chủng, khiến cho virus không còn có những ñặc tính vốn có trước ñây như virus viêm gan vịt cổ ñiển. Tại Việt Nam, rất có thể virus viêm gan vịt cũng bị biến ñổi tạo nên genotype, serotype thuộc nhóm mới như các nghiên cứu nước ngoài ñã xác ñịnh. Tuy có rất nhiều nghiên cứu về dịch tễ học và có rất nhiều chủng virus viêm gan vịt ñược phân lập nhưng chưa có nhiều nghiên cứu sâu sắc về ñặc tính sinh học phân tử gen kháng nguyên VP1 và hệ gen virus viêm gan vịt. Hiện nay bộ môn Vi sinh vật - Truyền nhiễm trường ñại học nông nghiệp – Hà Nội ñang có chủng virus nhược ñộc viêm gan vịt DH – EG – 2000. Chủng virus trên ñã ñược sử dụng ñể bước ñầu sản xuất vacxin bước ñầu vacxin ñã ñược nghiên cứu về hiệu lực bảo hộ và cho kết quả tốt. Vì vậy ñể ñưa vacxin viêm gan vịt chế từ chủng DH – EG – 2000 vào phòng bệnh ở nước ta thì việc xác ñịnh sự tương ñồng của gen kháng nguyên giữa chủng virus vacxin và các chủng virus cường ñộc gây bệnh ở Việt Nam có ý nghĩa thực tiễn rất lớn. Xuất phát từ thực tế trên chúng tôi tiến hành ñề tài: “Khảo sát ñặc tính sinh học phân tử của một số chủng virus viêm gan vịt cường ñộc phân lập ñược trên ñàn vịt ở một số ñịa phương và so sánh với chủng virus vacxin DH – EG – 2000” 1.2 Mục tiêu nghiên cứu của ñề tài - Phân lập ñược một số chủng virus cường ñộc viêm gan vịt trên ñàn vịt tại một số ñịa phương. - Giải trình tự sắp xếp nucleotide của phân ñoạn gen VP1 của chủng virus vacxin DH-EG-2000 và các chủng viêm gan vịt cường ñộc phân lập ñược. - So sánh các ñặc tính sinh học phân tử của một số chủng virus viêm gan vịt cường ñộc với chủng virus vacxin DH – EG – 2000. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 3 2. TỔNG QUAN TÀI LIỆU 2.1 Bệnh viêm gan virus ở vịt Bệnh viêm gan vịt do virus (Duck Virus Hepatitis - DVH) là một bệnh truyền nhiễm cấp tính xảy ra ở vịt con 1- 6 tuần tuổi, mẫn cảm nhất là vịt con dưới 3 tuần tuổi. Bệnh lây lan rất nhanh với tỷ lệ chết cao, có khi lên ñến 95 – 100% toàn ñàn. Bệnh do một loại virus viêm gan vịt nhóm A, thuộc họ Picornaviridae gây ra. Trước ñây, virus viêm gan vịt ñược xếp loại dựa vào mối quan hệ về huyết thanh học, bao gồm 3 type khác nhau là: virus viêm gan vịt type I (DHV-1), type II(DHV-2) và type III(DHV-3). Phổ biến hơn cả là virus viêm gan vịt type I, virus viêm gan vịt type II và type III mới ñược tìm thấy ở Anh và Mỹ, gây tỷ lệ chết không ñáng kể (Woolcock, 2003). Hiện nay, với sự phát triển của sinh học phân tử, các nghiên cứu sâu về gen/hệ gen, cũng như nguồn gốc phả hệ của các chủng virus ñã xác ñịnh virus gây bệnh viêm gan vịt trên thế giới hiện nay gồm có 3 genotype khác nhau là genotype I (DHAV-1), genotype II (DHAV-2), genotype III (DHAV-3). (Stanway và cs, 2005; Tseng và cs, 2007; Ding và Zhang, 2007). Bệnh có biểu hiện ñặc trưng: Vịt chết nhanh với tỷ lệ chết rất cao và chết ở trạng thái ñặc biệt ñầu ngoẹo về một bên, 2 chân duỗi thẳng. Mổ khám thấy gan sưng, xuất huyết lốm ñốm trên gan (Nguyễn ðường, 1990). 2.1.1 Sơ lược về lịch sử phân bố bệnh Bệnh viêm gan do virus ở vịt ñược Levine và Hofstad phát hiện lần ñầu tiên vào mùa xuân năm 1945 tại Mỹ, bệnh xảy ra trên ñàn vịt con một tuần tuổi nhưng chưa phân lập ñược mầm bệnh (Levine, Hofstad, 1945). Năm 1949 Levine và Fabricant theo dõi ñược bệnh này trên ñàn vịt trắng Bắc Kinh ñược nuôi tại ñảo Long (Mỹ) và vào năm 1950 ñã phân lập ñược virus gây bệnh này bằng phương pháp nuôi cấy trên phôi gà (Levine, Fabricant, 1950). Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 4 Năm 1956, bệnh ñược phát hiện ở bang Massachusetts, Ilinois và Michigan, sau ñó bệnh xảy ra trên khắp nước Mỹ. Năm 1965, bệnh viêm gan vịt xảy ra ở Norfolk – Anh trên những ñàn vịt con ñã ñược tiêm phòng vacxin nhược ñộc viêm gan vịt type I. Bằng phương pháp bảo hộ chéo trên ñàn vịt ñã phân lập ñược virus viêm gan vịt type II khác hẳn với virus viêm gan vịt type I. Virus type II chỉ gây bệnh ở Anh. Năm 1968 virus viêm gan vịt type I ñã gây bệnh trên khắp thế giới trong ñó có một số nước Châu Á như Trung Quốc, Hàn Quốc…(Hwang J, 1965). Trên ñảo Long ( Mỹ), bệnh viêm gan vịt ñã xảy ra trên ñàn vịt con ñược dùng vacxin nhược ñộc type I, bệnh xảy ra nhẹ hơn so với bệnh viêm gan vịt của virus type I, tỷ lệ chết của vịt con hiếm khi vượt quá 30%. Haider và Calnek ñã ñặt virus viêm gan vịt type III (Haider, Calneck, 1979). Ở Việt Nam, Trần Minh Châu và cộng sự ñã ghi nhận có bệnh viêm gan vịt do virus vào năm 1978 nhưng chưa phân lập ñược. Từ năm 1979 ñến năm 1983, bệnh xẩy ra ñã ñược ghi nhận làm chết nhiều vịt ở các ñịa phương như ở ðông Anh – Hà Nội ( 1979 – 1980), Gia Lâm – Hà Nội ( 1983) ñã làm chết hàng ngàn vịt (Trần Minh Châu, Lê Thu Hồng, 1985). Năm 2004, Nguyễn Phục Hưng qua ñiều tra 10 huyện thuộc 4 tỉnh và thành phố Hà Nội, Hưng Yên, Bắc Ninh và Hà Tây, thấy bệnh xảy ra ở vịt con dưới 40 ngày tuổi, ñặc biệt bệnh xẩy ra nhiều và có tỷ lệ chết cao ở lứa tuổi 1- 7 ngày tuổi. Hằng năm, bệnh viêm gan vịt vẫn xảy ra thường xuyên. Tùy từng thời ñiểm mà bệnh xuất hiện ở các vùng ñịa lý khác nhau (Nguyễn Phục Hưng, 2004). 2.1.2 Loài mắc bệnh Trong tự nhiên virus viêm gan vịt type I chỉ gây bệnh cho vịt con. Vịt trưởng thành bị nhiễm virus không có triệu trứng lâm sàng, không ảnh hưởng ñến sản lượng trứng. Gà, gà tây và các ñộng vật khác không mắc bệnh. Gia cầm non một vài ngày tuổi hay vài tuần tuổi vẫn có thể bị nhiễm bệnh và con Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 5 vật có biểu hiện triệu trứng, bệnh tích và có kháng thể trung hòa trong máu. Gà con có thể bị nhiễm bệnh, bệnh thể hiện không ñiển hình và có thể truyền virus cho con khác (Nguyễn ðức Lưu, Vũ Như Quán, 2002). Trong phòng thí nghiệm, dùng virus viêm gan vịt type I gây bệnh cho vịt con bằng cách cho uống hoặc tiêm phúc mạc, vịt có bệnh tích như gan sưng, xuất huyết lốm ñốm trên gan, túi mật sưng, lách sưng và có thể phân lập ñược virus từ gan vịt 17 ngày sau khi cho uống. Các loài khác như thỏ, chuột lang, chuột nhắt trắng, chó…ñều không cảm thụ ñược bệnh (Nguyễn Vĩnh Phước và cs, 1997). 2.1.3 ðường xâm nhập và cách lây lan Virus viêm gan vịt lây lan rất nhanh từ con bệnh sang con lành, tỷ lệ nhiễm bệnh rất cao (100%). Virus xâm nhập vào cơ thể qua ñường tiêu hoá, hô hấp hoặc qua vết thương (Levine, Fabricant, 1950). ðường lây nhiễm qua không khí của bệnh viêm gan vịt giống với bệnh dịch tả vịt và bệnh viêm phế quản truyền nhiễm ở gà con. Có sự xâm nhập của virus qua vùng da bị tổn thương, nhưng ít gặp. Những vịt chưa bị nhiễm virus, nếu cho chúng sống cùng ñàn vịt bệnh, chúng sẽ mắc bệnh và chết sau ñó ít ngày. Bệnh viêm gan vịt không lây truyền qua ñường trứng, vịt con nở ra từ trứng của vịt mẹ bị nhiễm bệnh vẫn phát triển tốt (Asplin, 1958). Ở những vịt khỏi bệnh, virus ñược bài xuất ra ngoài theo phân sau 8 tuần. Các loài chim hoang dã mang virus viêm gan vịt từ vùng này sang vùng khác theo phương thức cơ học, ñây chính là nguyên nhân gây ra các vụ dịch mới ở nơi xa (Asplin, 1961). 2.1.4 Cơ chế sinh học Virus xâm nhập vào cơ thể qua niêm mạc ñường tiêu hóa, hô hấp hoặc qua vết thương rồi vào máu. Theo máu, virus ñến các cơ quan nội tạng ñặc biệt là gan, ñây là cơ quan thích hợp ñối với virus. Quá trình ñược biểu hiện qua hai giai ñoạn: Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 6 + Giai ñoạn ñầu: Virus gây rối loạn trao ñổi chất ở gan, do quá trình trao ñổi mở ở gan ñặc biệt là quá trình trao ñổi cholesterol bị ñình trệ làm cho lượng glycogen trong gan giảm thấp nhưng lượng lipit lại tăng cao. Vì thế vịt con ở thời ñiểm kỳ cuối của bào thai thiếu năng lượng dẫn ñến sức ñề kháng bị giảm sút. + Giai ñoạn 2: Là giai ñoạn virus trực tiếp phá hoại tế bào gan, tế bào nội mô huyết quản, gây ra xuất huyết ñặc trưng. Virus nhân lên trong tế bào gan, nhất là tế bào thuộc hệ võng mạc nội mô như tế bào Kuffer. Khi kiểm tra thấy tổ chức gan bị phá hoại, cơ thể không ñược giải ñộc làm con vật chết do ngộ ñộc (Bùi Thanh Khiết, 2007). 2.1.5 Triệu chứng lâm sàng và bệnh tích 2.1.5.1 Triệu chứng lâm sàng Thời gian nung bệnh từ 1 ñến 5 ngày, ñôi khi kéo dài 8 – 13 ngày. Thời gian nung bệnh phụ thuộc vào ñộc lực của virus, liều lượng và phương pháp gây bệnh cũng như tình trạng của cơ thể. Triệu chứng ñầu tiên xuất hiện sau 1- 2 giờ mắc bệnh, gây chứng xanh tím niêm mạc, rối loạn vận ñộng, co giật, vịt chỉ ngồi, sau ñó nằm la liệt, nghiêng sườn và nằm ngửa, chân thẳng dọc theo thân, ñầu quặt ngửa lên lưng hoặc ngẹo sang bên sườn và vịt con thường chết ở tư thế này. ðây là một trong những dấu hiệu ñặc trưng của bệnh. Một số trường hợp thấy vịt bị ỉa chảy, phân loãng, triệu chứng này không phải xuất hiện ở tất cả vịt. Bệnh kéo dài 2 – 3 ngày và có thể kéo dài hơn. Khi ñã xuất hiện triệu chứng thì vịt ốm ít khi khỏi và phần lớn là bị chết. Những con ốm không có triệu chứng lâm sàng sau khi khỏi bệnh sẽ hình thành kháng thể trong máu ( Lê Minh Chí và cs, 1999). Bệnh viêm gan vịt truyền nhiễm do virus có tỷ chết biến ñộng từ vài phần trăm ñến 90%. Vịt mắc bệnh do virus viêm gan vịt type I gây ra thường xẩy ra ñột ngột, thời gian nung bệnh ngắn trong vòng 24 h. Vịt chết tập trung Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 7 vào ngày thứ 2 -3 -4 sau khi mắc bệnh, tỷ lệ chết rất cao có khi lên ñến 100% (Lê Minh Chí và cs, 1999). (a) (b) Hình 2.1. Tư thế chết ñiển hình của vịt khi bị nhiễm virus viêm gan vịt (a). Gan vịt xuất huyết (b) 2.1.5.2 Bệnh tích + Bệnh tích ñại thể Bệnh tích tập trung chủ yếu ở gan. Gan thường sưng, nhũn, dễ bị nát khi ấn nhẹ. Một số trường hợp gan bị nhũn có hình thái như gelatin. Bề mặt loang lổ do có nhiều ñiểm xuất huyết, xuất huyết lan rộng không có ranh giới, kích thước và hình dạng to nhỏ khác nhau. Hiện tượng xuất huyết trên bề mặt gan có ở tất cả vịt chết. Khi nhỏ bệnh phẩm vào niêm mạc mũi thì xuất huyết rất rõ ở gan. Khi tiêm bệnh phẩm vào phúc mạc, các cơ quan khác ít bị tổn thương và càng ít hơn qua ñường miệng. Trong gan có thể gặp các ổ hoại tử do bệnh viêm gan bị biến chứng sang bệnh phó thương hàn. Lách có thể sưng, thận tụ máu hoặc lấm tấm xuất huyết (Nguyễn Văn Cảm và cs, 2001). Tiêm chủng DH – EG – 2000 cho phôi gà 10 ngày tuổi thấy hiện tượng xuất huyết trên da. Hiện tượng xuất huyết gan và phù phôi xuất hiện gần như ñồng thời trên tất cả các phôi. Ở những phôi có biểu hiện xuất huyết trên da Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 8 thường xuất hiện kèm theo hiện tượng phù phôi, bệnh tích xuất huyết gan có lúc xuất hiện cùng với xuất huyết trên da và phù. Một số phôi khi mổ khám không thấy bệnh tích nào khác ngoài hiện tượng gan xuất huyết (Nguyễn Bá Hiên, Trần Thị Lan Hương, 2004). + Bệnh tích vi thể Biến ñổi vi thể của bệnh thường xuất hiện ở gan và ñại não. Gan có những ñám tế bào bị hoại tử, ống mật, viêm tăng sinh quanh mạch và viêm tăng sinh mô thần kinh ñệm, lúc ñầu là những bạch cầu có hạt sau ñó là tế bào lympho và các tương bào. Ở vịt con không chết có sự tái sinh của các tế bào nhu mô gan. Sự tổn thương của tế bào gan ở vịt con mắc bệnh viêm gan virus giống những tổn thương như ở viêm gan của người (Bùi Thị Cúc, 2002). Quan sát biến ñổi vi thể ở phôi gà 10 ngày tuổi chết do nhiễm virus viêm gan vịt type I chủng DH – EG -2000 thấy tế bào hạt của nhiều cơ quan tăng sinh, gan có các ñiểm hoại tử, tăng sinh ống mật, phù dưới da không quan sát thấy các thể bao hàm trong tế bào. Khi tiến hành làm tiêu bản vi thể thấy tế bào gan bị biến ñổi, bè gan và các tế bào gan sắp xếp lộn xộn, các vi huyết quản xuyên tâm giãn rộng chứa hồng cầu và tế bào viêm. Có hiện tượng xuất huyết lan tràn trong nhu mô gan. Tế bào lympho tăng sinh mạnh, có thể tập trung thành từng ñám lớn hoặc rải rác xen kẽ với những tế bào gan. Một số tế bào gan mất ñi phần nguyên sinh chất, chỉ còn lại nhân, một số tế bào bị thoái hóa mỡ và thoái hóa không bào (Nguyễn Bá Hiên, Trần Thị Lan Hương, 2004) . Tiêm virus viêm gan vịt type I vào xoang niệu mô phôi vịt 10 – 14 ngày tuổi. Sau khi tiêm 24 -72 h phôi chết có biểu hiện xuất huyết dưới da, gan xuất huyết và có nhiều ñiểm hoại tử. Trong trường hợp vịt bị bệnh ở thể cấp tính , sau khi nhiễm virus 24 h thấy tế bào gan thoái hóa, hoại tử, trong tế bào có các tiểu phần virus. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 9 2.1.6 Chẩn ñoán bệnh viêm gan vịt do virus 2.1.6.1 Chẩn ñoán lâm sàng và bệnh tích - Bệnh xảy ra trên ñàn vịt con, xuất hiện ñột ngột, tỷ lệ nhiễm cao.Vịt ủ rũ cao ñộ, rối loạn vận ñộng, chết ở tư thế ñặc trưng, hai chân duỗi thẳng, ñầu ngoẹo sang một bên. - Mổ khám thấy gan bị sưng, xuất huyết, tim nhợt nhạt như tim luộc (Nguyễn Vĩnh Phước và cs,1978). 2.1.6.2 Chẩn ñoán virus học Bệnh phẩm dùng chẩn ñoán là gan của vịt mắc bệnh pha với nước sinh lí, xử lí kháng sinh ñem ly tâm lấy nước trong rồi tiến hành tiêm cho phôi vịt 10- 13 ngày tuổi, phôi gà 8-10 ngày tuổi. Mổ phôi thấy có các bệnh tích ñặc trưng như phôi còi cọc, phù phôi, xuất huyết trên da, gan sưng, xuất huyết. Khi tiêm cho vịt con 1-7 ngày tuổi với liều 0,5ml/ con dưới da. Sau một thời gian ngắn vịt sẽ chết với bệnh tích ñặc trưng của bệnh viêm gan vịt. 2.1.6.3 Chẩn ñoán phân biệt - Bệnh dịch tả vịt (Duck plague): Bệnh dịch tả vịt thường xảy ra ở mọi lứa tuổi với các triệu chứng ñiển hình như: sưng ñầu, ñau mắt, liệt chân, liệt cánh, tiêu chảy phân trắng, tốc ñộ vịt chết chậm hơn. Mổ khám thấy hiện tượng viêm loét xuất huyết ñường ruột. Virus dịch tả rất mẫn cảm với chloroform. - Bệnh phó thương hàn vịt (Duck Salmonellosis): Vịt con thường có biểu hiện gầy, ñi ngoài phân trắng, gan có ñiểm hoại tử. Vịt ñẻ bị viêm buồng trứng, trứng non teo, dị hình, vịt giảm ñẻ, vỏ trứng mỏng dễ vỡ. Quan sát bệnh tích thấy chưa tiêu hết lòng ñỏ trứng ở vịt con, gan, lách, thận sưng, xung huyết, bệnh có thể chứa khỏi bằng kháng sinh (Nguyễn Vĩnh Phước, 1978). Vi khuẩn salmonella có thể nuôi cấy phân lập ñược trong phòng thí nghiệm trên các môi trường thạch thông thường: môi trường thạch máu, thạch thường. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 10 - Chứng nhiễm ñộc aflatoxin (Aflatoxicosis): không có hiện tượng lây lan trong ñàn, vịt chết nhanh ở mọi lứa tuổi. Bệnh tích chủ yếu là: xoang bụng và xoang bao tim tích nước, gan sưng có màu nhợt nhạt, thận và lách xuất huyết. Kiểm tra tổ chức học thấy tổ chức nhu mô gan và thận bị phá huỷ nghiêm trọng. 2.1.6.4 Phương pháp huyết thanh học - Phản ứng trung hòa ñược sử dụng ñể ñịnh type viêm gan vịt type I, (Woolcock, 1998): dùng vịt con 1 - 7 ngày tuổi, mỗi con tiêm 1 - 2ml huyết thanh miễn dịch hoặc kháng thể ñặc hiệu chế từ lòng ñỏ vào dưới da. Sau 24 giờ tiến hành tiêm virus cường ñộc với liều 103LD50. Kết quả 80 - 100 % vịt ñối chứng chết, 80 - 100% vịt thí nghiệm sống sót. - Dùng phản ứng bảo hộ chéo ñể phân biệt virus viêm gan vịt type I, type II, type III: tiêm huyết thanh miễn dịch viêm gan vịt type I, type II, typIII cho vịt 2 - 4 ngày tuổi. Sau 3 ngày tiến hành công cường ñộc bằng virus phân lập ñược (Gough và cs, 1985). 2.1.7. Phòng chống bệnh +Phòng bệnh bằng vệ sinh thú y: Trước hết phải áp dụng biện pháp vệ sinh thú y với các cơ sở chăn nuôi vịt. Cách ly nghiêm ngặt ñối với vịt con, nhất là trong 4 - 5 tuần ñầu. Tiêu ñộc chuồng trại, dụng cụ chăn nuôi trước khi thả vịt bằng foocmon 1%, Crecyl 3%, nước vôi 20%, thức ăn và nước uống phải ñảm bảo tốt, tiêu diệt chuột, thường xuyên tẩy ký sinh trùng cho vịt... Những nơi ñang an toàn dịch thì tốt nhất nên tự túc con giống. Tủ ấp nở thường xuyên phải sát trùng trước và sau ấp nở (Nguyễn ðức Lưu, Vũ Như Quán, 2002). + Vacxin phòng bệnh Biện pháp quan trọng nhất ñể khống chế dịch bệnh là dùng vacxin tạo miễn dịch cho ñàn vịt (Davis D, Hannant D , 1987). Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 11 Vacxin phòng bệnh viêm gan vịt có 2 loại: vacxin nhược ñộc và vacxin vô hoạt. - Vacxin nhược ñộc: Virus cường ñộc dưới tác ñộng của các yếu tố sinh học: tiêm truyền nhiều lần qua ñộng vật ít cảm thụ, qua phôi, thì ñộc lực của virus giảm ñi. Virus vẫn có khả năng nhân lên trong cơ thể vật chủ nhưng không gây bệnh nên ñược dùng ñể làm vacxin. Nhiều nghiên cứu ñã cho thấy các chủng virus viêm gan vịt cường ñộc sau khi ñã cấy truyền qua phôi gà không còn khả năng gây bệnh cho vịt con nhưng virus vẫn nhân lên trong tế bào các mô, so với chủng virus viêm gan vịt cường ñộc thì mức ñộ nhân lên của virus này là thấp hơn (Hwang, 1965). Bằng phương pháp giảm ñộc trên phôi ñã tạo ra nhiều chủng virus viêm gan vịt nhược ñộc. Hiện nay vacxin viêm gan vịt nhược ñộc type I - loại dùng chủ yếu ở Châu Âu là loại ñã ñược giảm ñộc sau 53 - 55 lần truyền ñời qua phôi gà 8 -10 ngày tuổi, ở Mỹ là loại giảm ñộc sau 84 - 89 lần cấy truyền. Vacxin ñược bảo quản ở nhiệt ñộ -700C trong vài năm. - Vacxin vô hoạt: Ngoài vacxin nhược ñộc còn có vacxin vô hoạt. Vacxin viêm gan vịt vô hoạt ñược sản xuất từ virus viêm gan vịt type I bằng cách nuôi cấy virus trên phôi gà, thu hoạch dịch phôi, vô hoạt virus bằng BEI (Binary Ethylenimine), dùng bổ trợ dạng nhũ dầu (ES - STA (Lipid Emulsion System - Salmonella typehimurium) và có lympho B phân bào (Woolcok, 2003). Bảo quản ở 40C trong thời gian 20 tháng vẫn giữ ñược hiệu lực của vacxin. Nghiên cứu hiệu lực của vacxin viêm gan vịt vô hoạt, các tác giả ñều cho biết vacxin có khả năng tạo miễn dịch cao cho ñàn vịt (Gough, 1981). Sử dụng 3 lần vacxin viêm gan vịt type I vô hoạt nhũ dầu cho ñàn vịt giống sẽ tạo ñược miễn dịch thụ ñộng cho ñàn vịt con. Hiện nay, trên thế giới mới có vacxin viêm gan vịt nhược ñộc và vô hoạt type I. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 12 Trên thị trường Việt Nam ñang sử dụng rộng rãi một loại vacxin nhược ñộc viêm gan vịt do Xí nghiệp thuốc thú y Trung ương sản xuất. Qua khảo sát sinh học phân tử hệ gen bước ñầu cho thấy, chủng virus ñược sử dụng làm vacxin có nguồn gốc từ Hàn Quốc. Ngoài ra, một chủng virus vacxin nhược ñộc khác của Trường ðại học Nông nghiệp Hà Nội cũng ñã ñược nghiên cứu ñầy ñủ về ñặc tính sinh học (Nguyễn Phục Hưng, 2004; Nguyễn Bá Hiên, 2007), qui trình sản xuất (Bùi Thanh Khiết, 2007; Nguyễn Bá Hiên, 2007), ñặc tính phân tử và ñã bước ñầu ñược ứng dụng vào thực tế. Kết quả nghiên cứu về sinh học phân tử của chúng tôi cho thấy các loại vacxin sử dụng tại Việt Nam ñều thuộc genotype I. 2.2. Một số ñặc tính của virus viêm gan vịt 2.2.1 ðặc tính nuôi cấy của virus Virus viêm gan vịt là loại kí sinh nội bào tuyệt ñối. ðể gây bệnh, cần sử dụng huyễn dịch các cơ quan của vịt con chết do viêm gan vịt (gan, phổi, thận…) ñã ñược xử lý bằng kháng sinh. Có thể cấy chuyển viêm gan vịt trên ñộng vật cảm thụ, trên phôi trứng và trên môi trường tế bào (Trần Thị Lan Hương,2007). 2.2.1.1 Nuôi cấy trên phôi trứng - Trên phôi vịt: Tiêm virus viêm gan vịt vào xoang niệu mô của phôi vịt 10 – 14 ngày tuổi. Sau khi gây nhiễm 24 -72 h, phôi chết với bệnh tích như phôi còi cọc, xuất huyết dưới da ñặc biệt là ở vùng ñầu, bụng, chân, phôi phù, gan sưng có màu ñỏ hoặc hơi vàng, có thể có ñiểm hoại tử. Những phôi chết muộn, nước xoang niệu mô có màu xanh nhạt và có bệnh tích rõ hơn. Ở phôi vịt bị nhiễm virus viêm gan thường thấy nước ối có màu xanh và gan bị xanh – ñen, những bệnh tích này ít thấy ở phôi gà (Trần Thị Lan Hương, 2007) . - Trên phôi ngỗng: Virus viêm gan vịt cũng có khả năng nhân lên trên phôi ngỗng. Phôi chết sau khi cấy virus vào xoang niệu mô 2 -3 ngày (Nguyễn ðường, 1990). Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 13 - Trên phôi gà: Tiêm virus viêm gan vịt vào xoang niệu mô của phôi gà 9 -10 ngày tuổi. Với lần cấy chuyển ñầu tiên, virus cho tỷ lệ chết phôi 10 - 60 % sau khi gây nhiễm 5 - 6 ngày. Phôi có bệnh tích còi cọc, phù phôi, xuất huyết dưới da. Nuôi cấy liên tục trong 68 ñời, hiệu giá virus duy trì ở mức ñộ 10-4 – 10-6. Như vậy, gây bệnh cho bào thai có thể ñược sử dụng ñể chẩn ñoán viêm gan do virus (Phạm Văn Ty, 2007) . 2.2.1.2 Nuôi cấy trên môi trường tế bào Sau khi gây nhiễm thấy hàm lượng virus tăng dần và sau một vài lần hoặc nhiều lần cấy truyền trên tế bào thì thấy virus huỷ hoại tế bào S (CPE: Cytopathogen effect) với biểu hiện nhân bị co tròn, nguyên sinh chất ñặc lại tạo không bào, tế bào vỡ ra rồi chết. Căn cứ vào ñó ta có thể ñánh giá hiệu giá virus (Lê Thanh Hoà, 2002). 2.2.1.3 Nuôi cấy trên ñộng vật cảm thụ Virus viêm gan vịt chỉ có thể phát triển tốt trên vịt con dưới 7 ngày tuổi. Sau 2- 4 ngày nung bệnh, vịt có biểu._. hiện ñặc trưng: con vật mệt mỏi nghiêm trọng, nằm một chỗ, ñầu ngoẹo ra ñằng sau hay về một bên, co giật toàn thân rồi chết. Khi mổ khám quan sát bệnh tích ñặc trưng ở gan thấy: gan sưng nhũn, dễ bị nát khi ấn nhẹ, trên mặt gan có những ñiểm xuất huyết, ñôi khi có những ñiểm hoại tử màu trắng xen kẽ. Quan sát những biến ñổi vi thể trên gan thấy tổ chức gan bị viêm tụ máu, tăng sinh ống mật, các mạch máu bị sưng, các tế bào gan bị tích mỡ (Trần Thị Lan Hương, 2007) . 2.2.2 Sức ñề kháng của của virus viêm gan vịt Virus viêm gan vịt thuộc loại virus không có vỏ bọc ngoài nên mẫn cảm với formalin, ñề kháng cao với ete và chloroform. Trong ñiều kiện môi trường khắc nghiệt, virus có khả năng sống sót trong thời gian dài. Virus có khả năng tồn tại lâu bên ngoài môi trường: trong rơm lót chuồng, trong thức ăn, nước uống, virus có khả năng tồn tại từ 15 ñến 40 ngày. Virus tương ñối ổn ñịnh ở Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 14 nhiệt ñộ thấp, nhưng bị bất hoạt nhanh chóng ở nhiệt ñộ cao. Ở nhiệt ñộ 40C virus tồn tại ñược khoảng 2 năm. Ở 500C trong 1 h không ảnh hưởng ñến chuẩn ñộ virus, nhưng phần lớn virus bị vô hoạt ở 560C trong 30 phút. Ở nhiệt ñộ 370C, virus viêm gan vịt tồn tại ñược 21 ngày, khi cho virus tác dụng với dung dịch formalin 0,01% thì virus viêm gan vịt vẫn tồn tại ñược trong 8 h. Ở nhiệt ñộ 150C – 200C, virus vô hoạt hoàn toàn bởi formaldehyde 1% hay NaOH 1% trong 3 h chloramin 3% trong thời gian 5 h. Virus mất ñộc lực trong ñiều kiện nhiệt ñộ phòng từ 48 – 96 h. Trong tủ lạnh, sức hoạt ñộng của virus tồn tại 120h. Ở nhiệt ñộ -200C virus tồn tại ñược khoảng 9 năm. Làm lạnh ñến -380C, giữ ñược khả năng lây lan của virus trong 8 tháng hoặc lâu hơn ( Reuss, 1959). Ở nhiệt ñộ 560C và 600C, tuy virus kháng với tác dụng của ion Mg++ 1M nhưng khi không có mặt của cation này thì virus nhạy cảm với các nhiệt ñộ trên. Virus viêm gan vịt có khả năng kháng trypsin và ammonium sulphate. Tế bào chứa virus có thể tồn tại ở PH = 3 trong 9 h. Virus không bị vô hoạt ở Lysol 2%, creolin 15%, naphthalysol, xyonaphtha hay anhydrous sodium carbonat 20%. Ở ñiều kiện có 5% phenol virus bị vô hoạt hoàn toàn. Trong tự nhiên, khi ñiều kiện tự nhiên kém virus có thể tồn tại ñược 10 tuần. Trong phân ẩm virus có khả năng sống ñược 37 ngày (Haider,1979). 2.2.3 ðặc tính kháng nguyên của virus viêm gan vịt Theo Aplin (1965), tính kháng nguyên của virus luôn thay ñổi, virus viêm gan vịt không làm ngưng kết hồng cầu gà, vịt, thỏ, cừu nên ñã cho phép phân biệt với virus Newcastle. Huyết thanh của vịt nhiễm virus khỏi bệnh có khả năng trung hòa virus viêm gan vịt. 2.3 Sinh học phân tử của virus viêm gan vịt 2.3.1 Hình thái và cấu tạo virus viêm gan vịt Virus viêm gan vịt thuộc họ Picornaviridae, có kích thước rất nhỏ, xuyên qua ñược màng lọc Beckefeld và Seitz (Levine và Fabricant, 1950); Theo Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 15 Reuss (1959) dưới kính hiển vi ñiện tử virus là những hạt tròn bề mặt xù xì, không có vỏ bọc, kích thước từ 20-40nm, có 32 capxome. Hệ gen của virus viêm gan vịt chứa acid ribonucleic (RNA) sợi ñơn dương có ñộ dài khoàng 7600 – 7700 nucleotide và ñuôi poly A gồm 18 nucleotide ở ñầu 3’, chứa duy nhất một khung ñọc mở ORF (open reading frame) mã hóa cho một protein chung (polyprotein). Protein này, sau khi tổng hợp trải qua nhiều lần phân cắt ñể tạo nên các protein sản phẩm ñộc lập (Tseng và cs, 2007a). ( Hình 2.2. Cấu trúc không gian của picornavirus Các protein VP1, VP2 và VP3 nằm ngay trên bề mặt vỏ kháng nguyên; còn protein VP4 lặn vào sâu bên trong. Sắp xếp hệ gen của virus viêm gan vịt, bao gồm: - Tại ñầu 5’ có một vùng gen có ñộ dài khoảng 625 nucleotide không mã hóa gọi là vùng không mã hóa ñầu 5’ (untranslate region, 5’UTR) nhưng có vai trò quan trọng trong sao mã, tăng cường ñộc lực, tạo khung vỏ capsid. DHV-1 bị thiếu cấu trúc mũ ở ñầu 5’ mà thay vào ñó là một protein nhỏ gọi là VPg. Ở ñầu 5’ của hệ gen DHV-1 có bộ mã khởi ñầu ñể bắt ñầu cho quá trình dịch mã, bộ mã này ñược ñặt ở vị trí nucleotide thứ 627 của hệ gen. Vùng ñầu 5’UTR cuốn lại tạo nên một gấp khúc có cấu trúc bậc 2 trông giống như hình lá sồi (clover leaf), chứa vùng gen làm vị trí cho ribosome ñi vào dịch mã nội bào gọi là cấu trúc IRES (Internal Ribosome Entry Site). Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 16 - Tại ñầu 3’, tương tự, cũng có một vùng gen không mã hóa có ñộ dài 314 nucleotide gọi là 3’UTR (Ding, Zhang, 2007). Vùng 3’UTR có vai trò rất quan trọng trong quá trình nhân lên, trung chuyển qua giai ñoạn tạo nên sợi RNA sợi âm trung gian. - ðầu tận cùng 5’ của sợi ARN hệ gen có dính một mẩu protein gọi là protein dẫn (L) (30 amino acid). Trong họ Picornaviridae, protein L xuất hiện trong 5 chi là Teschovirus, Aphthovirus, Erbovirus, Cadiovirus và Kobuvirus. Protein L này sở hữu một motif GxCG, có chức năng như enzyme protease – trypsin. (Tseng, Tsai, 2007b). - Giữa hai vùng không mã hóa 5’UTR và 3’UTR là vùng gen mã hóa tống hợp protein. Vùng này bao gồm ba tổ hợp gen: tổ hợp gen P1 mã hóa cho ba loại protein cấu trúc là VP0, VP3 và VP1; tiếp theo là tổ hợp gen P2 mã hóa cho các protein không cấu trúc là 2A, 2B, 2C; nằm cuối cùng là tổ hợp gen P3 mã hóa cho các loại protein không cấu trúc là 3A, 3B, 3C, 3D (Hình 2.2). Dịch mã Protein chung NH2-(L)-VP0(VP4-VP2)–VP3–VP1–2A–2B–2C–3A–3B–3C–3D- COOH (1A) (1B) (1C) (1D) Hình 2.3. Sơ ñồ hệ gen và chuỗi polypeptide của virus viêm gan vịt (Tseng và cs, 2007) Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 17 - Protein 2A: Protein này có 3 phân ñoạn protein là protein 2A1, 2A2, 2A3. ðây là một trong những ñặc ñiểm ñặc trưng của DHV-1 (Johanson và cs, 2003 ; Tseng, Tsai, 2007b). - Protein cấu trúc: Có 3 protein cấu trúc gồm protein VP0, Vp3 và protein VP1. Trong ñó, vùng VP1 có tính ổn ñịnh cao và có tính sinh miễn dịch, nằm trên bề mặt ngoài cùng của các picornavirus, chứa ñựng hầu hết những motif mà có chức năng tương tác với thụ thể của tế bào và kháng thể trung hòa ñơn dòng. Trình tự protein VP1 này là khác nhau trong giữa các chi virus (Tseng, Tsai, 2007). - Protein phi cấu trúc : Một số protein phi cấu trúc như protein 2C, 3C và 3D, chứa ñựng những motif ñặc trưng khác hẳn với những motif trong các protein ñã biết ở các picornavirus khác, gồm có motif GxxGxGK (S/T) - kéo dài từ amino acid thứ 145 ñến 152 và motif DDLxQ – từ amino acid thứ 192 ñến 196 trong protein 2C, những motif này có chức năng như enzyme helicase (Ghazi và cs, 1998). Motif GxxGxGK cũng xuất hiện trong protein 2A2 (GksGsGKS; amino acid thứ 6 – 13). Trong motif DDLxQ ở protein 2C, leucine ñược thay thế bởi phenyalamine. - Trong cấu trúc hệ gen viêm gan vịt, ñược quan tâm nghiên cứu nhiều nhất là vùng gen mã hóa cho protein VP1. Vùng gen VP1 có ñộ dài 714 nucleotide. Gen này ñã ñược chứng minh là gen kháng nguyên, nó quyết ñịnh tính kháng nguyên và tính ñộc lực của virus. ðột biến trong gen VP1 dễ dẫn ñến thay ñổi thành phần amino acid, thay ñổi tính kháng nguyên và tính ñộc lực của virus, từ ñó có thể hình thành nên các biến chủng mới. 2.3.2 Xếp loại virus viêm gan vịt Ngày nay, với các phương pháp nghiên cứu sâu về sinh học phân tử, toàn bộ hệ gen của một số chủng virus viêm gan vịt trên thế giới ñã ñược xác Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 18 ñịnh. Tất cả các nghiên cứu ñều thống nhất chỉ ra rằng virus viêm gan vịt thuộc họ Picornaviridae. Trước ñây, dựa vào một số ñặc tính của chúng mà virus viêm gan vịt ñược xếp vào chi Enterovirus trong họ Picornaviridae (Woolcock, 2003). Tuy nhiên, những nghiên cứu trong những năm gần ñây về sinh học phân tử ñã chỉ ra rằng sự xếp loại ñó là chưa phù hợp và việc xếp loại virus viêm gan vịt vào chi nào trong họ Picornaviridae ñã gây rất nhiều tranh cãi. Các phân tích trình tự hệ gen của virus viêm gan vịt type 1 (DHV-1) cho thấy virus có quan hệ gần gũi với các thành viên của chi Parechovirus hơn là chi Enterovirus (Ding C, Zhang D, 2007). Nhánh mới ñược tạo ra ñã chia những Picornaviridae thành 12 chi. Trong ñó, DHV-1 tạo thành một nhánh riêng biệt nằm ở giữa Parechovirus và Hepatovirus trong cây phả hệ. ( Hệ thống phân loại thế giới ICTV ñã thống nhất xếp virus viêm gan vịt type 1 (DHV-1) thuộc vào chi mới trong họ Picornaviridae, ñặt tên chi là Avihepatovirus, ñổi tên DHV-1 (Duck hepatitis virus type 1) thành DHAV (Duck hepatitis A virus) ( studygroup.com) bao gồm genotype 1 (DHAV-1), genotype 2 (DHAV-2) và genotype 3 (DHAV-3) (Kim và cs, 2007), với cùng một cấu trúc hệ gen ñặc trưng như sau: 5’UTR/VP0/VP3/VP1/2A1/2A2/2A3/2B/2C/3A/3B/3C/3D/3’UTR Chiếm tỷ lệ cao nhất là DHAV-1, bao gồm 80 chủng virus viêm gan vịt type 1 ñã ñược phân lập trước ñây (trong ñó, 48 chủng ñã ñược giải mã toàn bộ hệ gen và 39 chủng ñã giải mã gen kháng nguyên VP1 cũng như các vùng gen quan trọng khác). Hầu hết các chủng DHAV-1ñược phân lập ở Trung Quốc. Ngoài ra có 1 chủng ñược phân lập ở ðài Loan, 1 chủng phân lập ở Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 19 Anh, 3 chủng phân lập ở Mỹ và 2 chủng phân lập ở Hàn Quốc. DHAV-2 bao gồm 2 chủng mới ñược phân lập ở ðài Loan là chủng 90D và chủng 04G. Các virus thuộc DHAV-3 bao gồm tập hợp của 22 chủng virus vừa phân lập ở Trung Quốc và Hàn Quốc, 15 trong số 22 chủng này ñã ñược giải mã toàn bộ hệ gen, số còn lại ñã ñược giải mã gen kháng nguyên VP1. ( 2.4 Miễn dịch chống virus viêm gan vịt Khi ñưa virus vào cơ thể kháng thể chưa hình thành ngay lập tức mà phải sau một thời gian tiềm tàng, dài hay ngắn phụ thuộc vào kháng nguyên chứa trong vacxin và sự xâm nhập của kháng nguyên vacxin lần ñầu hay lần 2, 3…hàm lượng kháng thể tăng dần, ñạt mức cao nhất sau 2-3 tuần rồi giảm dần và mất ñi sau vài tháng hoặc vài năm. Khi một kháng nguyên xâm nhập vào cơ thể trước hết cơ thể bảo vệ mình bằng cơ chế ñáp ứng miễn dịch không ñặc hiệu. Tham gia vào cơ chế này có vai trò của da, niêm mạc, dịch tiết của các tuyến, ñặc biệt là có vai trò của các tế bào làm nhiệm vụ thực bào. Sau ñó, cơ thể bảo vệ mình bằng cơ chế ñáp ứng miễn dịch ñặc hiệu với hoạt ñộng của các cơ quan, tế bào có thẩm quyền miễn dịch, tạo kháng thể ñặc hiệu ñể loại trừ kháng nguyên (Nguyễn Bá Hiên, Trần Thị Lan Hương, 2004). 2.4.1 Miễn dịch thụ ñộng Ở gia cầm non hệ thống miễn dịch chưa phát triển hoàn thiện. Ngay từ lúc mới sinh cơ thể chúng hoàn toàn không có khả năng chống lại các tác nhân gây bệnh một cách ñặc hiệu. Trạng thái miễn dịch chỉ có ñược sau khi cơ thể vịt mẹ có miễn dịch và truyền kháng thể ñặc hiệu cho con non qua lòng ñỏ trứng (Nguyễn Bá Hiên, Trần Thị Lan Hương, 2004). Trong bệnh viêm gan vịt, miễn dịch thụ ñộng của vịt con ñược nhận từ mẹ ñã ñược nghiên cứu nhiều. Việc tiêm nhắc lại vacxin cho vịt mẹ sẽ tạo Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 20 ñược kháng thể thụ ñộng tốt hơn cho vịt con. Theo Asplin (1958) dùng virus viêm gan vịt type I nhược ñộc qua phôi gà, tiêm bắp cho vịt giống vào thời ñiểm 2 – 4 tuần trước khi lấy trứng ñem ấp sẽ tạo ñược miễn dịch thụ ñộng cho vịt con. Ở vịt con hàm lượng kháng thể thụ ñộng sẽ giảm dần trong hai tuần ñầu sau khi nở. Ở vịt mẹ hàm lượng kháng thể phải ñạt hiệu giá 1/64 trong phản ứng ngưng kết hồng cầu thụ ñộng hoặc 1/32 trong phản ứng trung hòa mới có thể bảo hộ cho vịt con khỏi mắc bệnh (Asplin, 1958). 2.4.2 Miễn dịch chủ ñộng Là loại miễn dịch thu ñược khi con vật bị mắc bệnh nhưng có ñủ sức ñể chống lại bệnh và khỏi bệnh hoặc là miễn dịch mà vịt có ñược sau khi tiêm vacxin. Những vịt sống sót sau khi mắc bệnh ñều có miễn dịch chắc chắn với virus của type gây bệnh. Tạo miễn dịch chủ ñộng cho ñàn vịt bằng cách sử dụng các loại vacxin nhược ñộc và vacxin vô hoạt. Vacxin sau khi vào cơ thể sẽ ñi ñến các cơ quan miễn dịch như hạch, lách, tổ chức lympho dưới niêm mạc và kích thích cơ thể sinh ra kháng thể ñặc hiệu. Trong kháng thể dịch thể chống virus viêm gan vịt type I thì kháng thể 7S nhiều hơn kháng thể 19S. Vịt ñược tiêm vacxin có thể tạo ñược miễn dịch chủ ñộng chống lại bệnh. Sử dụng vacxin nhược ñộc viêm gan vịt tiêm cho vịt lúc 2 -3 ngày tuổi và tiêm nhắc lại bằng vacxin vô hoạt vào thời ñiểm 22 tuần tuổi sẽ tạo ñược lượng lớn kháng thể trung hòa (Nguyễn Bá Hiên, Trần Thị Lan Hương, 2004). 2.5 Các kỹ thuật sinh học phân tử 2.5.1 Phản ứng PCR PCR là phản ứng sinh hóa phụ thuộc nhiệt ñộ, sử dụng ñặc ñiểm của quá trình sao chép DNA với sự tham gia của của một loại enzyme DNA – polymerase chịu nhiệt, có hai ñoạn ngắn DNA làm mồi và dùng các ñoạn DNA mạch ñơn làm khuân ñể tổng hợp lên sợi mới bổ sung. Vì vậy, ñể khởi ñầu quá trình tổng hợp DNA cần cung cấp ñoạn mồi oligonucleotide có ñộ dài Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 21 từ 6 – 30 nucleotit. ðoạn này gắn kết với DNA khuân tại thời ñiểm sao chép và ñược DNA – polymerase ñiều khiển tổng hợp một ñoạn DNA ñặc thù. Các sợi DNA mạch ñơn làm khuân ñược tạo ra theo cách ñơn giản và nâng nhiệt ñộ lên trên 900C cho mạch xoắn kép bung ra. Hình 2.4. Mô hình các bước của phản ứng PCR Cả hai sợi DNA ñều ñược dùng làm khuân cho quá trình tổng hợp nếu các ñoạn mồi ñược cung cấp ñể bám vào vị trí tương ứng cho cả hai sợi. Trong kỹ thuật PCR các ñoạn mồi ñược chọn nằm ở hai ñầu ñoạn DNA cần nhân lên sao cho các sợi DNA tổng hợp mới ñược bắt ñầu tại mỗi ñoạn mồi và kéo dài về phía ñoạn mồi nằm trên sợi kia, cho sản phẩm có ñộ dài giới hạn giữa hai ñoạn mồi này. ðộ dài sản phẩm PCR có thể vài trăm cho ñến hàng ngàn thậm chí vài ngàn nucleotit. Như vậy, sau mỗi chu kỳ các ñiểm bám cho các ñoạn mồi lại xuất hiện trên mỗi sợi DNA mới ñược tổng hợp. Hỗn hợp phản ứng lại ñược nâng nhiệt lên thích hợp sao cho các sợi ban ñầu tách khỏi sợi mới tổng hợp, các sợi này sau ñó ñược dùng tiếp cho chu trình tiếp theo bao gồm các bước: gắn ñoạn mồi, tổng hợp DNA và tách rời các ñoạn. Kết quả cuối cùng của phản ứng PCR là sau n chu kì của phản ứng tính theo lý thuyết sẽ có 2n bản sao các phân tử DNA mạch kép nằm giữa ñoạn mồi (Lê Thanh Hoà, 2006). Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 22 2.5.2 Phản ứng RT – PCR Kỹ thuật RT – PCR hay còn gọi là phản ứng PCR ngược là một phản ứng nhân một ñoạn giới hạn của khuân RNA, theo nguyên lý của phản ứng PCR bao gồm hai giai ñoạn: giai ñoạn thứ nhất là chuyển ñổi một sợi RNA làm khuân thành cDNA, sau ñó qua giai ñoạn thứ hai dùng DNA hai sợi này làm khuân ñể tiếp tục thực hiện phản ứng PCR. Hình 2.5. Mô hình nguyên lý của phản ứng RT-PCR RNA là một sợi bao gồm 4 nucleotit liên kết với nhau, trong ñó có Adenine, Guanine, Cystein, Uracil. Chuỗi nucleotit này phải ñược chuyển ñổi thành DNA hai sợi mà thành phần Uracil ñược thay thế bằng Thyamine. Phản ứng tạo cDNA từ RNA hệ gen phải nhờ ñến vai trò của enzyme phiên mã ngược. Do vậy giai ñoạn này ñược gọi là giai ñoạn chuyển ngược. Khi ñã có DNA phản ứng tiếp theo sẽ là PCR. Toàn bộ phản ứng nhân một ñoạn DNA từ khuân RNA qua hai giai ñoạn nói trên ñược gọi là phản ứng RT- PCR hay phản ứng PCR ngược. Thay ñổi nhiệt ñộ ñể phù hợp cho mỗi chu kỳ (Lê Thanh Hoà, 2006). 2.5.3 Kỹ thuật ñiện di Kỹ thuật ñiện di trên thạch agarose là hết sức quan trọng ñối với người làm kỹ thuật di truyền và sinh học phân tử, ñó là cách chủ yếu làm cho các Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 23 ñoạn axit nucleic hiển thị trực tiếp. Phương pháp này dựa trên một ñặc tính là các phân tử axit nucleic ở pH trung tính chúng tích ñiện âm nhờ các nhóm phosphate nằm trên khung photphodieste của các sợi nucleic. Khi ñặt chúng vào một ñiện trường, các phân tử axit nucleic sẽ chuyển dịch về cực dương. Khi tiến hành trên môi trường thạch agarose hay các loại thạch ñặc biệt khác, các phân tử axit nucleic tùy theo kích thước sẽ dịch chuyển với tốc ñộ khác nhau, loại có phân tử lượng lớn dịch chuyển chậm và ngược lại loại có phân tử lượng bé sẽ dịch chuyển nhanh hơn . Có hai loại thạch agarose ñược sử dụng phổ biến trong kỹ thuật ñiện di là thạch agarose và thạch polyacrylamid. Thạch agarose ñược dùng ñể thực hiện ñiện di trong máy ñiện di, gel polyacrylamid thường ñược dùng ñể phân tách các phân tử axit nucleic có kích thước nhỏ trong các ứng dụng như xác ñịnh trình tự DNA. ðiện di ñược thực hiện bằng cách ñưa các mẫu axit nucleic có trộn chỉ thị màu bromphenol vào các giếng của bản thạch và ñặt một ñiện áp vào ñó. Các axit nucleic ở trên thạch thường hiển thị khi nhuộm bằng Ethidium Bromide và ñược quan sát dưới ánh sáng tử ngoại. Các axit nucleic hiện lên ở các dạng băng màu trắng có thể chụp ảnh và ghi nhận lại ñược. Kích thước các băng DNA ñược so sánh với chỉ thị di truyền (DNA marker). DNA marker thường ñược dùng nhất là DNA của thực khuẩn thể Lamda, có chiều dài 43kb, ñược cắt bằng enzyme giới hạn HindIII, tạo 8 phân ñoạn với các chiều dài bao gồm 23,1 kb, 9,4 kb, 6,5kb, 4,3 kb, 2,3kb, 2 kb, 0,564kb, 0,125kb. Nhờ chỉ thị di truyền này mà có thể xác ñịnh ñược ñộ dài của ñoạn axit nucleic cần phân tích (Lê Thanh Hoà, 2006). 2.5.4 Nguyên lý tách dòng và lưu giữ nguồn gen Nguyên lý của việc dòng hóa là gắn nối sản phẩm PCR hoặc RT- PCR vào vector tách dòng và chuyển nạp vào tế bào chủ tạo dòng cái tổ hợp Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 24 Theo nguyên tắc một ñoạn DNA ngoại lai (sản phẩm của PCR hoặc RT- PCR) sẽ ñược cài vào trong hệ gen DNA ñã ñược thiết kế sẵn gọi là plasmid mang – vector dẫn truyền ( thường dùng vector pCR 2.1 – TOPO) tạo thành vector tái tổ hợp. Sau ñó, vector tái tổ hợp này sẽ ñược chuyển nạp vào tế bào chủ thích ứng, thông thường là tế bào E. coli, ñể nhân lên với số lượng lớn các bản sao của DNA ngoại lai. Sau khi chuyển nạp, tiến hành chọn lọc tái tổ theo 2 cơ chế: Cơ chế X-gal và cơ chế kháng sinh nhằm loại trừ các vi khuẩn không tái tổ hợp. Tách chiết các khuẩn lạc ñơn dòng ñể thu ñược lượng DNA tái tổ hợp và kiểm tra xem ñoạn DNA ngoại lai có ñược nối vào vector hay không bằng phản ứng cắt với enzyme giới hạn (Lê Thanh Hoà, 2006). 2.6 Tình hình nghiên cứu bệnh viêm gan vịt trên thế giới và việt nam 2.6.1 Tình hình nghiên cứu trên thế giới Từ khi Levine và Hofstad lần ñầu tiên phát hiện ra bệnh viêm gan vịt vào năm 1945, cho ñến nay trên thế giới ñã có rất nhiều nghiên cứu về bệnh. Trước ñây các công trình nghiên cứu tập trung chủ yếu về ñặc ñiểm dịch tễ, triệu chứng lâm sàng, bệnh tích, ñặc tính sinh học của virus, chế tạo vacxin… sao cho việc phòng chống bệnh ñạt hiệu quả cao nhất mà chưa nghiên cứu sâu sắc về ñặc tính sinh học phân tử của hệ gen virus. Gần ñây, bệnh viêm gan vịt do virus ñược nhiều tác giả quan tâm, ñặc biệt là virus viêm gan vịt type I. Năm 2007 Tseng và Tsai ñã xác ñịnh ñược ñầy ñủ và gần như ñầy ñủ hệ gen của ba chủng virus DHV -1, gồm một chủng ñược phân lập ngoài tự nhiên ở ðài Loan: 03D, Anh: chủng H, một chủng vacxin nhược ñộc Mỹ chủng 5886. Cho ñến nay 2008, hệ gen của hàng chục chủng virus viêm gan vịt kể cả cường ñộc cũng như vacxin ñã ñược giải mã và phân tích. Qua phân tích sự tiến hóa và phát sinh loài của DHV- 1 thì DHV- 1 ñược phân loại lại vào trong một chi mới trong họ Picornaviridae, tương tự DHV- 2, DHV- 3 ñược phân loại lại vào trong họ Astroviridae và ñược ñặt tên lại là Duck Astrovirus. Dựa vào những ñặc ñiểm riêng biệt của hệ gen như: Gen VP0 không bị phân Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 25 cách, ba protein 2A không liên quan với nhau; sự tương ñồng thấp về trình tự axt amin với tất cả những Picornavirus khác và những kết quả của việc phân tích phát sinh loài mà DHV- 1 ñược xếp vào chi Picornarvirus tách biệt và ñược coi là mẫu ñầu tiên của một chi mới (Jin và cs, 2008). Một sự phân tích khác của Ding và Zhang trên chủng DHV- C80 (là một chủng vacxin thích ứng trên phôi gà ở Trung Quốc) cũng ñề nghị lên xếp DHV- 1 vào một chi riêng biệt trong họ Picornaviridae ( Ding, Zhang, 2007). 2.6.2 Tình hình nghiên cứu ở Việt Nam Ở nước ta có rất nhiều công trình nghiên cứu về bệnh viêm gan vịt và ñặc tính sinh học virus viêm gan vịt nhưng vẫn chưa có nhiều công trình nghiên cứu về ñặc tính sinh học phân tử của virus viêm gan vịt. Bệnh viêm gan vịt ñược phát hiện lần ñầu tiên vào năm 1978 khi mà một số giống vịt ngoại ñược nhập vào nước ta ồ ạt và ñược nuôi rộng rãi trong dân. Vào thời ñiểm này, Trần Minh Châu và cs ñã ghi nhận bệnh ở ðông Anh – Hà Nội, nhưng lúc ñó vẫn chưa phân lập ñược mầm bệnh. Từ năm 1979 ñến 1983, bệnh xẩy ra ở nhiều ñịa phương và làm chết rất nhiều vịt con. Năm 1983, Trần Minh Châu và cs ñã phân lập ñược một chủng virus cường ñộc tại một trại nuôi vịt ở Phú Xuyên – Hà Nội (chủng TT). Khi nuôi cấy virus này trên phôi vịt 12 ngày tuổi, virus gây chết phôi 100%, thời gian chết phôi từ 48 – 96 giờ, phôi có bệnh tích xuất huyết. Qua nuôi cấy trên phôi gà, chủng virus này yếu ñi, không gây bệnh cho vịt con (Trần Minh Châu và cs, 1985). Năm 1985, các tác giả Trần Minh Châu, Lê Thu Hồng ñã xây dựng qui trình sản xuất vacxin từ 3 chủng virus vacxin viêm gan vịt nhược ñộc: TN (Hunggari), E32 ( Pháp), và VN (Việt Nam). Cả ba chủng virus vacxin ñề an toàn và có hiệu lực khi sử dụng. Khi miễn dịch cho vịt con rồi thử thách với cường ñộc thì bảo hộ ñược 70 – 100% vịt con (Trần Minh Châu và cs, 1985) Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 26 Theo Nguyễn Văn Cảm và cs (2001), cho biết từ 1 – 6 năm 2001, qua ñiều tra 12 ổ dịch tại các ñịa phương là Hưng Yên, Hà Tây, Hà Nam, Hà Nội, Tuyên Quang, ñã ñi ñến kết luận ñây là những ổ dịch do virus viêm ga vịt gây ra. Ổ dịch có tỷ lệ nhiễm trong ñàn lên ñến gần 100%, tỷ lệ chết từ 48 - 90%. Theo Nguyễn ðức Lưu và Vũ Như Quán (2002), bệnh viêm gan vịt có cơ hội xẩy ra nhiều hơn trên các giống vịt, ngan cao sản nhập vào nước ta ở các ñịa phương như Hà Tây, Hà Nam, Thái Bình, các tỉnh ñồng bằng sông Cửu Long, gây tổn thất rất lớn cho các ñịa phương này. Năm 2001, Nguyễn Văn Cảm và cộng sự ñã nghiên cứu biến ñổi bệnh lý bệnh viêm gan vịt do virus nhằm ñưa ra một phương pháp chẩn ñoán nhanh và chính xác. Theo Bùi Thị Cúc (2002), nghiên cứu biến ñổi bệnh lý ñại thể, vi thể và siêu vi thể bệnh viêm gan vịt do virus cho biết: bệnh tích siêu vi thể ñiển hình là màng nhân của tế bào gan bị thoái hóa và hoại tử; các glycogen trong tế bào gan bị phá hủy, ñồng thời xuất hiện các tiểu thể hình cầu có bán kính 100 – 300nm. Năm 2004, Nguyễn Phục Hưng ñã nghiên cứu ñặc tính sinh học của chủng virus nhược ñộc viêm gan vịt DH- EG – 2000, ñể có thể sản xuất vacxin phòng bệnh. ðến năm 2007, Bùi Thanh Khiết ñã nghiên cứu qui trình sản xuất vacxin viêm gan vịt từ chủng virus vacxin nhược ñộc trên và ứng dụng phòng – can thiệp vào thực tế sản xuất. Ở nước ta tuy có nhiều biện pháp phòng bệnh nhưng hiệu quả phòng bệnh vẫn chưa cao, hiệu quả khi sử dụng vacxin nhược ñộc và vô hoạt còn nhiều bất cập. Một trong những nguyên nhân ảnh hưởng tới hiệu quả của việc phòng bệnh bằng vacxin có thể là những loại vacxin này ñơn chủng lại chứa phần kháng nguyên của các chủng nước ngoài nên không phù hợp lắm với những chủng virus tại Việt Nam. Do vậy ñể có những loại vacxin hiệu quả cao, phù hợp với những chủng virus ở nước ta thì cần có yêu cầu ñặt ra là phải Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 27 có những nghiên cứu về sinh học phân tử hệ gen của virus viêm gan vịt ở Việt Nam, ñể tìm hiểu về cấu trúc hệ gen, ñặc biệt là tìm hiểu về cấu trúc của gen kháng nguyên VP1 ñể từ ñó có thể tìm ra biện pháp chữa bệnh tốt nhất phù hợp với chủng virus tại Việt Nam. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 28 3. NỘI DUNG, VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1 Nội dung nghiên cứu ðể thực hiện ñề tài này chúng tôi tiến hành nghiên cứu các nội dung sau: 1. Phân lập virus cường ñộc viêm gan vịt trên ñàn vịt tại một số ñịa phương. 2. Giám ñịnh chủng virus cường ñộc viêm gan vịt phân lập ñược bằng kĩ thuật RT-PCR. 3. Thu nhận vùng gen VP1 của virus viêm gan vịt phân lập ñược. 4. Giải trình tự vùng gen VP1 của virus viêm gan vịt phân lập và vùng gen VP1 của virus vacxin nhược ñộc viêm gan vịt DH-EG-2000. 5. So sánh sự ñồng nhất về Nucleotide và sự tương ñồng amino acid của vùng gen VP1 của các chủng virus viêm gan vịt cường ñộc phân lập ñược với chủng virus vacxin DH-EG-2000. 3.2 Vật liệu nghiên cứu 3.2.1 Nguyên liệu Mẫu bệnh phẩm: Mẫu bệnh phẩm làm nguyên liệu nghiên cứu là gan của vịt mắc bệnh viêm gan vịt, ñã ñược chẩn ñoán bằng các triệu chứng lâm sàng và mổ khám kiểm tra bệnh tích, thu thập từ ñàn bệnh tại các tỉnh của miền Bắc và miền Nam của Việt Nam (Bảng 3.1). Bệnh phẩm gan ñược bảo quản ở -20oC. Huyễn dịch gan của vịt mắc bệnh sau khi xử lý ñược tiêm vào xoang niệu mô của phôi vịt mẫn cảm 13 ngày tuổi. Ở những phôi vịt chết ở 48 giờ và 72 giờ sau khi tiêm, tiến hành thu nước trứng chứa virus ñể làm nguyên liệu cho nghiên cứu giải mã hệ gen. Ngoài ra, chủng virus vaccine nhược ñộc hiện ñang sử dụng tại Việt Nam cũng ñược sử dụng làm nguyên liệu nghiên cứu, ñó là: chủng virus nhược ñộc viêm gan vịt do Bộ môn Vi sinh vật truyền nhiễm - Trường ðại học Nông nghiệp Hà Nội cung cấp kí hiệu DH- EG- 2000. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 29 Bảng 3.1. Danh sách các mẫu bệnh phẩm viêm gan vịt sử dụng trong nghiên cứu STT Ký hiệu mẫu Thời gian lấy mẫu ðịa ñiểm lấy mẫu 1 DH-EG-2000 Virus viêm gan vịt nhược ñộc chủng Ai Cập 2 DN1 2009 ðồng Nai 3 DN2 2009 ðồng Nai 4 NB 2009 Miền Bắc 5 HY 2009 Văn Giang, Hưng Yên 6 NC 2009 Miền Nam 3.2.2 Phôi vịt Phôi vịt 13 ngày tuổi khoẻ mạnh và ñược lấy từ ñàn bố mẹ khoẻ mạnh, chưa miễn dịch ñối với virus viêm gan vịt. 3.2.3 Cặp mồi Chúng tôi sử dụng các cặp mồi ñặc hiệu cho chuỗi nucleotide ở hai ñầu của vùng gen VP1 ñể có thể thu nhận ñược ñoạn gen VP1. Bảng 3.2. Các ñoạn mồi sử dụng trong phản ứng RT-PCR Tên mồi Ký hiệu mồi Trình tự mồi (5’ → 3’) Mồi xuôi DH3F 5’ GCCCCACTCTATGGAAATTTG 3’ Mồi ngược DH4R 5’ ATTTGGTCAGATTCAATTTCC 3’ Mồi xuôi DHAV3F 5’-ATGCGAGTTGGTAAGGATTTTCAG-3’ Mồi ngược DHAV3R 5’- GATCCTGATTTACCAACAACCAT-3’ Cặp mồi dùng ñể nhân ñoạn DNA chứa gen VP1 ñược thiết kế dựa trên trình tự gen ñặc hiệu của vùng biên xung quanh gen VP1 ở các chủng virus Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 30 viêm gan vịt có trong Ngân hàng gen Quốc tế. Phản ứng RT-PCR ñược thực hiện ñặc hiệu với cặp mồi DH3F - DH4R ñể thu nhận ñoạn gen kháng nguyên VP1, có ñộ dài 714 nucleotide từ vị trí nucleotide thứ 2106 ñến 2819 (hình 3.1) của các chủng virus viêm gan vịt thuộc genotype I (DHAV-1). Và cặp mồi DHAV3F – DHAV3R ñể thu nhận gen VP1 của các chủng virus viêm gan vịt thuộc genotype III (DHAV-3), tạo nguyên liệu cho quá trình giải trình tự chuỗi gen VP1. Các ñoạn mồi sẽ liên kết bổ sung tại các vị trí cần thiết trên hệ gen virus. Vị trí vùng gen VP1 và vị trí bám mồi ñược thể hiện theo sơ ñồ sau: Hình 3.1 Sơ ñồ vị trí bám của mồi ñể thu nhận ñoạn DNA (~0,8kb) chứa gen VP1 (714bp) và chiến lược giải mã gen VP1 của virus viêm gan vịt bằng cặp mồi DH3F-DH4R (ảnh minh hoạ) 3.2.4 Dụng cụ và hoá chất thí nghiệm 3.2.4.1 Dụng cụ thiết bị - Panh, kéo, kẹp, hộp lồng, ống nghiệm, seringer các loại 1 và 5ml, dùi tiêm trứng, ống Eppendoft, pipet, găng tay... - Tủ ấm 37oC, tủ sấy khô, nồi hấp cao áp. Tủ lạnh các loại: 0 - 4oC, - VP1(714 bp) 3’UTR AAAn DHVR 5’UTR DHVF DHV-1 VPg (2106-2819) (~ 0.8kb) Mồi ngược DH4R (2810-2830) Mồi xuôi DH3F (2064-2084) Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 31 20oC, -86oC. Buồng cấy vô trùng. ðèn soi trứng, khay ñựng trứng. - Máy ly tâm, máy PCR, máy ñiện di, máy chụp ảnh gel... - Máy nuôi lắc tế bào, máy ổn nhiệt, máy giải trình tự tự ñộng ABI Avant Genetic Analyzer 3100, máy tính và các phần mềm sinh – tin học. 3.2.4.2 Hoá chất và môi trường cần thiết - Nước sinh lý 0,9%, cồn 70o, cồn Iod 5%; Kháng sinh: Penicillin, Streptomycin... - Hóa chất sử dụng cho phản ứng RT – PCR: Nuclease free water, dNTP, enzyme, primers, TBE, agarose... - Bộ kit tách chiết RNA tổng số, QIAmp Viral Mini kit (QIA GEN Inc, USA) và hóa chất do hãng QIAGEN cung cấp. - Bộ kit dùng cho phản ứng RT-PCR do hãng Invitrogen cung cấp. - Bộ kit dùng ñể tinh sạch sản phẩm PCR/RT-PCR do hãng QIAGEN và BIOONER cung cấp. - Bộ kit tách dòng ”TA-cloning kit” do hãng Invitrogen cung cấp. - Bộ kit tách DNA plasmid tái tổ hợp, ”QIAprep Spin Miniprep kit” do hãng QIAGEN cung cấp. - Bộ kit dùng cho phản ứng PCR giải trình tự. - Bộ kit dùng ñể tinh sạch sản phẩm PCR giải trình tự Kit DyeEx do hãng QIAGEN cung cấp. - Enzyme giới hạn EcoRI của New England BioLabs. 3.3. Phương pháp nghiên cứu 3.3.1 Phân lập virus bằng phương pháp nuôi cấy virus trên phôi vịt 3.3.1.1 Xử lý bệnh phẩm Bệnh phẩm là gan của vịt mắc bệnh viêm gan vịt, ñược nghiền nhỏ, bệnh phẩm là huyễn dịch ñều pha với nước sinh lý thành huyễn dịch 1/5 xử lý kháng sinh (Penicillin, Streptomycin), ñể ở nhiệt ñộ 4oC trong 2 giờ. Mẫu gan ly tâm với tốc ñ._. tách chiết vector tái tổ hợp mà chúng tôi thực hiện là hoàn toàn phù hợp. 4.5 Kết quả giải trình tự nucleotide và axit amin của gen kháng nguyên vp1 ở các chủng virus viêm gan vịt phân lập ñược và chủng virus vacxin dh-eg-2000 Chúng tôi nhận thấy trong các công bố từ năm 2006 trở lại ñây, các nhà khoa học nước ngoài ñã ñi sâu nghiên cứu về sinh học phân tử của hệ gen virus viêm gan vịt, trong ñó ñối tượng ñầu tiên ñược quan tâm nghiên cứu là gen mã hoá cho protein VP1. VP1 ñược cho là protein cấu trúc quan trọng nhất, chiếm hầu hết phía ngoài vỏ virus và chi phối tất cả các protein bề mặt, có chứa các motif có vai trò tương tác với các thụ thể của tế bào và các kháng thể trung hoà ñơn dòng (Feigelstock,1996). Chính vì vậy mà gen kháng nguyên VP1 ñược coi là chỉ thị phân tử trong nghiên cứu giám ñịnh virus viêm gan vịt. ðể khẳng ñịnh hoàn toàn chắc chắn kết quả thu ñược và ñể có số liệu cho việc nghiên cứu, chúng tôi tiến hành tinh sạch DNA plasmid tái tổ hợp và giải trình tự gen này trên máy giải trình tự tự ñộng ABI – 3100 Avant Genetic Analyzer của hãng Applied Biosystems (Mỹ). Chuỗi nucleotide ñược xử lý bằng hệ chương trình MacVector 8.2. Trình tự Nucleotide và aminoacid suy diễn tương ứng của VP1 của 5 chủng mà chúng tôi thu nhận ñược trình bày ở hình 4.6. Qua hình 4.6 cho thấy, các nucleotide khác nhau sẽ bắt màu thuốc nhuộm huỳnh quang có màu sắc khác nhau. ðây là cơ sở xác ñịnh vị trí của tầng nucleotide. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 60 Hình 4.6. Giản ñồ giải trình tự (chromatogram) thành phần nucleotide của vùng gen VP1 virus viêm gan vịt của các chủng lần lượt là: DN2, DN1, NB, HY, DH-EG-2000 và NC. Các nucleotide tiếp nhận thuốc nhuộm huỳnh quang (fluorescent dye), khi ñọc bằng tia laze cho hiển thị Adenine có màu ñỏ (red), Thymine có màu xanh nước biển (blue), Guanine có màu xanh lá cây (green) và Cystosine có màu ñen (black). Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 61 1.DN2 2.DN1 30 60 90 120 GGTGATTCCAATCAGCTTGGTGATGATGAACCAGTGTGTTTTCTCAATTTTGAGACCGCAAACGTGCCAATACAAGGGGAGTCACACACCTTGGTGAAACATTTTTTTGGCCGTCAATGG G D S N Q L G D D E P V C F L N F E T A N V P I Q G E S H T L V K H F F G R Q W> _______________________________________________________ VP1 - DN2 - DHAV3 _____________________________ _________ __________> 150 180 210 240 CTGGTTCGAACTGTTCAACACACTGGTGAAGTGCAAGAGTTAGATTTGCCAGTGCCTGACCGGGGTCATGCATCTCTTTTGCGCTTCTTTGCCTATTTTTCTGGAGAAGTGATTCTGACC L V R T V Q H T G E V Q E L D L P V P D R G H A S L L R F F A Y F S G E V I L T> ________________________________________________________VP1 - DN2 - DHAV3 _____________________________ ___ _______________> 270 300 330 360 ATTGTCAATAATGGAACAACACCCTGCATGGTTGCACATTCTTACACAACAGACAATCTCACTTCTGAATATGCTGTCACTGCTATGGGGGGTATTCTCATCCCAGCAAACTCTGCTAAA I V N N G T T P C M V A H S Y T T D N L T S E Y A V T A M G G I L I P A N S A K> ________________________________________________________VP1 - DN2 - DHAV3 ____________ _______________________________ __ ___> 390 420 450 480 AATATTAGTATTCCATTTTATTCTGTCACACCTCTACGTCCCACACGACCCATGCCAGCATCTCAGGGGGGAGGTTTGACTTTTGGTAGGTTGTATATCTGGACACAATCTGGGAGTGTC N I S I P F Y S V T P L R P T R P M P A S Q G G G L T F G R L Y I W T Q S G S V> ________________________________________________________VP1 - DN2 - DHAV3 _____________________________________ _ ___ __ ____> 510 540 570 600 TCTGTTTTTATGGGTCTCCATAAGCCAGCTTTGTTTTTTCCACTGCCTGCATCAACCTACACAACACCCATGCGGTCGAATGAGCTTGAAACCATGAATCTGCATGATCAATCAGATCAT S V F M G L H K P A L F F P L P A S T Y T T P M R S N E L E T M N L H D Q S D H> ________________________________________________________VP1 - DN2 - DHAV3 ___________________________ _ _______________ ____> 630 660 690 7 20 CCAGACTGTCATTTGTGTAATATTTGCAGGAAAATGAAGAGGTGGTCTCGCAACTATCGCCCATTCCGCTTCTGTTTGAGACTTAAAACACTTGCCTTTGAGCTTCATTTGGAAATTGAA P D C H L C N I C R K M K R W S R N Y R P F R F C L R L K T L A F E L H L E I E> _______ ________________________________________________VP1 - DN2 - DHAV3 __________________________________________________> 30 60 90 120 GGTGATTCCAATCAGCTTGGTGATGATGAACCAGTGTGTTTTCTCAATTTTGAGACCGCAAACGTGCCAATACAAGGGGAGTCACACACCTTGGTGAAACATTTTTTTGGCCGTCAATGG G D S N Q L G D D E P V C F L N F E T A N V P I Q G E S H T L V K H F F G R Q W> ________________________________________________________VP1-DN1-DHAV3 __________________________________________________> 150 180 210 240 CTGGTTCGAACTGTTCAACACACTGGTGAAGTGCAAGAGTTAGATTTGCCAGTGCCTGACCGGGGTCATGCATCTCTTTTGCGCTTCTTTGCCTATTTTTCTGGAGAAGTGATTCTGACC L V R T V Q H T G E V Q E L D L P V P D R G H A S L L R F F A Y F S G E V I L T> ________________________________________________________VP1-DN1-DHAV3 __________________________________________________> 270 300 330 360 ATTGTCAATAATGGAACAACACCCTGCATGGTTGCACATTCTTACACAACAGACAATCTCACTTCTGAATATGCTGTCACTGCTATGGGGGGTATTCTCATCCCAGCAAACTCTGCTAAA I V N N G T T P C M V A H S Y T T D N L T S E Y A V T A M G G I L I P A N S A K> ________________________________________________________VP1-DN1-DHAV3 __________________________________________________> 390 420 450 480 AATATTAGTATTCCATTTTATTCTGTCACACCTCTACGTCCCACACGACCCATGCCAGCATCTCAGGGGGGAGGTTTGACTTTTGGTAGGTTGTATATCTGGACACAATCTGGGAGTGTC N I S I P F Y S V T P L R P T R P M P A S Q G G G L T F G R L Y I W T Q S G S V> ________________________________________________________VP1-DN1-DHAV3 __________________________________________________> 510 540 570 600 TCTGTTTTTATGGGTCTCCATAAGCCAGCTTTGTTTTTTCCACTGCCTGCATCAACCTACACAACACCCATGCGGTCGAATGAGCTTGAAACCATGAATCTGCATGATCAATCAGATCAT S V F M G L H K P A L F F P L P A S T Y T T P M R S N E L E T M N L H D Q S D H> ________________________________________________________VP1-DN1-DHAV3 __________________________________________________> 630 660 690 720 CCAGACTGTCATTTGTGTAATATTTGCAGGAAAATGAAGAGGTGGTCTCGCAACTATCGCCCATTCCGCTTCTGTTTGAGACTTAAAACACTTGCCTTTGAGCTTCATTTGGAAATTGAA P D C H L C N I C R K M K R W S R N Y R P F R F C L R L K T L A F E L H L E I E> ________________________________________________________VP1-DN1-DHAV3 __________________________________________________> Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 62 3.NB 4. HY GGTGATTCCAACCAGTTGGGGGATGATGAGCCGGTTTGCTTTCTGAATTTTGAGACAGCTAATGTCCCAATACAAGGTGAATCTCACACTCTTGTCAAACACCTGTTTGGGAGGCAATGG G D S N Q L G D D E P V C F L N F E T A N V P I Q G E S H T L V K H L F G R Q W> ___ ___ _______________________ _ ____ _______________________VP1 - HY - DHAV1 ________ _______________________________ ______> 150 180 210 240 TTAGTTAGGACTGTGCAACACGCCTCAACTGTGCAAGAGCTCGACCTCCAAGTTCCAGACAGAGGACATGCCTCTCTCATCCGGCTCTTTGCCTATTTCTCTGGAGAGATCATTCTTACC L V R T V Q H A S T V Q E L D L Q V P D R G H A S L I R L F A Y F S G E I I L T> ___ ___ _______________________ _ ____ _______________________VP1 - HY - DHAV1 ________ ______________________________ _____> 270 300 330 360 ATTGTCAACAATGGCACTACACCAGCAATGGTAGCACACTCTTATTCTATGGATGACCTCACTTCAGAGTATGCTGTTACAGCAATGGGAGGTGTGATGATTCCTGCTAACAGTGCCAAA I V N N G T T P A M V A H S Y S M D D L T S E Y A V T A M G G V M I P A N S A K> ___ __ ______________________ __ ____ _______________________VP1 - HY - DHAV1 ________ _ ____________________________ _______> 390 420 450 480 AATATTTCTGTGCCATTCTACTCTGTGACACCACTCAGGCCAACTCGACCAATTCCTGGCACATCAGAGGCAACTTTTGGCAGACTGTTTATGTGGACTCAATCAGGAAGTCTTTCAGTT N I S V P F Y S V T P L R P T R P I P G T S E A T F G R L F M W T Q S G S L S V> ___ ___ _______________________ _ ____ _______________________VP1 - HY - DHAV1 ________ _______________________________ ______> 510 540 570 600 TTTATGGGTCTCAAAAAGCCAGCTCTCTTCTTTCCACTCCCTGCTCCTACCTCCACAACATCATCACGGAGATCCAATGATGCTATTCCCACATTGAATCAGTCTGGGGATGAAGTAGAT F M G L K K P A L F F P L P A P T S T T S S R R S N D A I P T L N Q S G D E V D> ___ ___ _______________________ _ ____ _______________________VP1 - HY - DHAV1 ________ _______________________________ ______> 630 660 690 TGTCACTTCTGCGAAATTTGTTCTAAAATGAAGAGGAGGTGGAAGCCAAGAGGGCACTTCAGATTTTGCTTTAGACTCAAAACACTAGCATTTGAACTCAATCTGGAAATTGAA C H F C E I C S K M K R R W K P R G H F R F C F R L K T L A F E L N L E I E> ___ ___ ______________________ __ ____ ______________VP1 - - DHAV1 ________ ________________________________ _______> 30 60 90 120 GGTGATTCCAATCAGCTTGGTGATGATGAACCAGTGTGTTTTCTCAATTTTGAGACCGCAAACGTGCCAATACAAGGGGAGTCACACACCTTGGTGAAACATTTTTTTGGCCGTCAATGG G D S N Q L G D D E P V C F L N F E T A N V P I Q G E S H T L V K H F F G R Q W> ______________________________ _______________________VP1 - NB - DHAV3 ____________________________________ ____________> 150 180 210 240 CTGGTTCGAACTGTTCAACACACTGGTGAAGTGCAAGAGTTAGATTTGCCAGTGCCTGACCGGGGTCATGCATCTCTTTTGCGCTTCTTTGCCTATTTTTCTGGAGAAGTGATTCTGACC L V R T V Q H T G E V Q E L D L P V P D R G H A S L L R F F A Y F S G E V I L T> ______________________________ _________________________VP1 - NB - DHAV3 ______ __________________________________________> 270 300 330 360 ATTGTCAATAATGGAACAACACCCTGCATGGTTGCACATTCTTACACAACAGACAATCTCACTTCTGAATATGCTGTCACTGCTATGGGGGGTATTCTCATCCCAGCAAACTCTGCTAAA I V N N G T T P C M V A H S Y T T D N L T S E Y A V T A M G G I L I P A N S A K> ______________________________ _________________________VP1 - NB - DHAV3 ________ _______________________________ _________> 390 420 450 480 AATATTAGTATTCCATTTTATTCTGTCACACCTCTACGTCCCACACGACCCATGCCAGCATCTCAGGGGGGAGGTTTGACTTTTGGTAGGTTGTATATCTGGACACAATCTGGGAGTGTC N I S I P F Y S V T P L R P T R P M P A S Q G G G L T F G R L Y I W T Q S G S V> ______________________________ __________________________VP1 - NB - DHAV3 __________________________________________________> 510 540 570 600 TCTGTTTTTATGGGTCTCCATAAGCCAGCTTTGTTTTTTCCACTGCCTGCATCAACCTACACAACACCCATGCGGTCGAATGAGCTTGAAACCATGAATCTGCATGATCAATCAGATCAT S V F M G L H K P A L F F P L P A S T Y T T P M R S N E L E T M N L H D Q S D H> ______________________________ _________________________VP1 - NB - DHAV3 ___________ _____________________________________> 630 660 690 72 0 CCAGACTGTCATTTGTGTAATATTTGCAGGAAAATGAAGAGGTGGTCTCGCAACTATCGCCCATTCCGCTTCTGTTTGAGACTTAAAACACTTGCCTTTGAGCTTCATTTGGAAATTGAA P D C H L C N I C R K M K R W S R N Y R P F R F C L R L K T L A F E L H L E I E> ________ _____________________ __________________________VP1 - NB - DHAV3 ___________________________________________ _____> 30 60 90 120 HY Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 63 5. DH-EG-2000 6. NC 30 60 90 120 GGTGATTCCAACCAGTTGGGGGATGATGAGCCGGTTTGCTTTCTGAATTTTGAGACAGCTAATGTCCCAATACAAGGTGAATCTCACACTCTTGTCAAACACCTGTTTGGGAGGCAATGG S N Q L G D D E P V C F L N F E T A N V P I Q G E S H T L V K H L F G R Q W> ___ _ _______________________ __ ____ _______________________VP1 - NC - DHAV1 ________ _______________________________ ______> 150 180 210 240 TTAGTTAGGACTGTGCAACACGCCTCAACTGTGCAAGAGCTCGACCTCCAAGTTCCAGACAGAGGACATGCCTCTCTCATCCGGCTCTTTGCCTATTTCTCTGGAGAGATCATTCTTACC L V R T V Q H A S T V Q E L D L Q V P D R G H A S L I R L F A Y F S G E I I L T > ___ _ _______________________ __ ____ _______________________VP1 - NC - DHAV1 ________ ______________________________ _______> 270 300 330 360 ATTGTCAACAATGGCACTACACCAGCAATGGTAGCACACTCTTATTCTATGGATGACCTCACTTCAGAGTATGCTGTTACAGCAATGGGAGGTGTGATGATTCCTGCTAACAGTGCCAAA I V N N G T T P A M V A H S Y S M D D L T S E Y A V T A M G G V M I P A N S A K> ___ __ ______________________ __ ____ _______________________VP1 - NC - DHAV1 ________ ______________________________ _______> 390 420 450 480 AATATTTCTGTGCCATTCTACTCTGTGACACCACTCAGGCCAACTCGACCAATTCCTGGCACATCAGAGGCAACTTTTGGCAGACTGTTTATGTGGACTCAATCAGGAAGTCTTTCAGTT N I S V P F Y S V T P L R P T R P I P G T S E A T F G R L F M W T Q S G S L S V > ___ ___ _____________________ ______ _______________________VP1 - NC - DHAV1 ________ _______________________________ _______> 510 540 570 600 TTTATGGGTCTCAAAAAGCCAGCTCTCTTCTTTCCACTCCCTGCTCCTACCTCCACAACATCATCACGGAGATCCAATGATGCTATTCCCACATTGAATCAGTCTGGGGATGAAGTAGAT F M G L K K P A L F F P L P A P T S T T S S R R S N D A I P T L N Q S G D E V D > ___ __ ______________________ __ ____ _______________________VP1 - NC - DHAV1 ________ _____________________________________> 630 660 690 C H F C E I C S K M K R R W K P R G H F R F C F R L K T L A F E L N L E I E> ___ ___ _______________________ __ ____ _______________VP1 - NC - DHAV1 ________ _________________________________ ______> G D TGTCACTTCTGCGAAATTTGTTCTAAAATGAAGAGGAGGTGGAAGCCAAGAGGGCACTTCAGATTTTGCTTTAGACTCAAAACACTAGCATTTGAACTCAATCTGGAAATTGAA 30 60 90 120 GGTGATTCCAACCAGTTGGGGGATGATGAGCCGGTTTGCTTTCTGAATTTTGAGACAGCTAATGTCCCAATACAAGGTGAATCTCACACTCTTGTCAAACACCTGTTTGGGAGGCAATGG G D S N Q L G D D E P V C F L N F E T A N V P I Q G E S H T L V N H L F G S Q W> ___ ___ _______________________ __ ____ ______________________VP1 - DH-EG-2000 - DHAV1 ________ ______________________________> 150 180 210 240 TTAGTTAGGACTGTGCAACACGCCTCAACTGTGCAAGAGCTCGACCTCCAAGTTCCAGACAGAGGACATGCCTCTCTCATCCGGCTCTTTGCCTATTTCTCTGGAGAGATCATTCTTACC L V S T V Q H A S T V Q E L D L Q V P D S G H A S L I R L F A Y F S G E I I L T> ___ __ _______________________ __ _ _______________________VP1 - DH-EG-2000 - DHAV1 ________ ______________________________ _ ___> 270 300 330 360 ATTGTCAACAATGGCACTACACCAGCAATGGTAGCACACTCTTATTCTATGGATGACCTCACTTCAGAGTATGCTGTTACAGCAATGGGAGGTGTGATGATTCCTGCTAACAGTGCCAAA ___ ___ _______________________ __ ____ _____ __________________VP1 - DH-EG-2000 - DHAV1 ________ _______________________________ _______> 390 420 450 480 AATATTTCTGTGCCATTCTACTCTGTGACACCACTCAGGCCAACTCGACCA ATTCCTGGCACATCAGAGGCAACTTTTGGCAGACTGTTTATGTGGACTCAATCAGGAAGTCTTTCAGTT N I S V P F Y S V T P L S P T R P I P G T S E A T F G S L F M W T Q S G S L S V> ___ ___ ______________________ __ ____ ______________________ _VP1 - - DHAV1 ________ ______________________________ > 510 540 570 600 TTTATGGGTCTCAAAAAGCCAGCTCTCTTCTTTCCACTCCCTGCTCCTACCTCCACAACATCATCACG GAGATCCAATGATGCTATTCCCACATTGAATCAGTCTGGGGATGAAGTAGAT F M G L N K P A L F F P L P A P T S T T S S R S S N D A I P T L N Q S G D E V D> ___ ___ _______________________ __ ___ _______________________VP1 - DH-EG-2000 - DHAV1 _ ______________________________ __> 630 660 690 TGTCACTTCTGCGAAATTTGTTCTAAAATGAAGAGGAGGTGGAAGCCAAGAGGGCACTTCAGATTTTGCTTTAGGCTCAAAACACTAGCAT TTGAACTCAATCTGGAAATTGAA C H F C E I C S N M K S S W K P S G H F S F C F S L N T L A F E L N L E I E> ___ ___ _______________ ___________________ _________ VP1 - DH-EG-2000 - DHAV1 ________ _____________________________ __ __> Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 64 Hình 4.7. Trình tự Nucleotit và axit amin tương ứng của vùng gen VP1 của các chủng virus viêm gan vịt lần lượt là: DN2, DN1, NB, HY, DH- EG-2000 và NC. Ghi chú: - Dòng trên: Trình tự xắp xếp của các Nucleotit của gen VP1 - Dòng dưới: Trình tự xắp xếp của các axit amin tương ứng ñược hiển thị bằng một chữ cái qui ñịnh của các axit amin Sau khi giải trình tự DNA plasmid tái tổ hợp tách dòng, chúng tôi ñã thu ñược gen kháng nguyên VP1 của các chủng DN1, DN2 và NB có ñộ dài 720 bp, ñược xác ñịnh thuộc genotype III (DHAV-3); và gen VP1 của các chủng HY, DH-EG-2000 và NC có ñộ dài 714 bp ñược xác ñịnh thuộc genotype I (DHAV-1). Sau khi truy cập Ngân hàng gen sử dụng các chuỗi nucleotide mới thu nhận, chúng tôi nhận thấy tất cả 5 chủng cung cấp gen VP1 ñều thuộc virus viêm gan vịt nhóm A (duck hepatitis A), bao gồm cả hai loại genotype: genotype III (DHAV-3) và genotype I (DHAV-1). Bằng phương pháp giám ñịnh phân tử sử dụng gen VP1, chúng tôi ñã xác ñịnh ñược một số chủng virus viêm gan cường ñộc và chủng virus vacxin DH-EG-2000 có tại Việt Nam. Như vậy là ñã có sự xuất hiện của cả loại genotype: genotype III (DHAV-3) và genotype I (DHAV-1) ở cả miền Nam và miền Bắc của Việt Nam. 4.6 So sánh sự ñồng nhất nucleotide, sự tương ñồng amino acid của vùng gen vp1 giữa các chủng virus viêm gan vịt cường ñộc nb, dn1, nc và chủng virus vacxin dh-eg-2000. Sau khi giải ñược trình tự vùng gen mã hóa cho protein VP1 của các chủng virus viêm gan vịt cường ñộc DN1, NB, NC và chủng virus vacxin viêm gan vịt nhược ñộc DH-EG-2000 chúng tôi ñưa vào chương trình GeneDoc 2.5 ñể phân tích sự ñồng nhất về thành phần nucleotide và tương ñồng về amino acid. Kết quả so sánh ñược trình bày ở Bảng 4.3. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 65 Bảng 4.3. Tỷ lệ (%) ñồng nhất về nucleotide (trên ñường chéo) và tương ñồng axit amin (dưới ñường chéo) giữa các chủng virus viêm gan vịt cường ñộc NB, DN1, NC và chủng virus vacxin DH-EG-2000. DHAV-3 DHAV-1 Chủng DN1 NB DH-EG- 2000 NC DN1 99 92 92 NB 99 91 91 DH-EG-2000 89 87 99 NC 89 87 99 Kết quả so sánh cho thấy: - Tỷ lệ ñồng nhất về nucleotide và tương ñồng về amino acid giữa 2 chủng trong cùng một genotype là rất cao, cụ thể là: 99% về nucleotide và 99% về amino acid giữa 2 chủng của DHAV-3, DN1 và NB; 99% cả về nucleotide và amino acid giữa 2 chủng của DHAV-1 là NC và DH-EG-2000. - Từng cặp chủng thuộc về một genotype biểu hiện thống nhất khi so sánh tỷ lệ ñồng nhất về nucleotide và tương ñồng về amino acid với các cặp chủng thuộc genotype khác. Cụ thể: 91-92% (nucleotide) và 87-89% (amino acid) giữa cặp chủng DN1/NB (DHAV-3) và DH-EG-2000/NC (DHAV-1). Hiện nay, genotype II mới chỉ phát hiện có 2 chủng (40G và 90D) tại ðài Loan nên vấn ñề quan tâm về dịch tễ học, kháng nguyên và vaccine ñối với genotype này là chưa lớn. Ngược lại, sự xuất hiện DHAV-3 ngày càng nhiều ở Trung Quốc, Hàn Quốc, Việt Nam bên cạnh sự phân bố khá rộng ở nhiều quốc gia của DHAV-1 ñã làm tăng mối quan tâm về vấn ñề phòng chống bệnh viêm gan vịt (ðoàn Thị Thanh Hương, 2010). Sai khác 9% về amino acid của vùng gen VP1 giữa genotype I và III là một chênh lệch lớn nếu sử dụng vaccine hay chế phẩm chẩn ñoán huyết thanh học thuộc DHAV- Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 66 1 ñể phòng bệnh và chẩn ñoán các trường hợp do DHAV-3 gây ra. ðiều này có ý nghĩa khi chúng tôi so sánh chủng virus cường ñộc ñang lưu hành với chủng virus nhược ñộc vacxin ñang sử dụng tại Việt Nam về tương quan nucleotide và amino acid. Sự chênh lệch về thành phần amino acid của chủng vacxin genotype I với chủng cường ñộc thuộc genotype III có thể sẽ không cho miễn dịch tốt mặc dù vịt vẫn ñược tiêm phòng bằng loại vacxin hiện có. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 67 5. KẾT LUẬN VÀ ðỀ NGHỊ 5.1 Kết luận Từ những kết quả ñạt ñược, chúng tôi ñưa ra một số kết luận sau: 1. ðã phân lập và giám ñịnh ñược virus viêm gan vịt cường ñộc ở các mẫu bệnh phẩm thu thập ñược trên ñàn vịt ở một số ñịa phương của Việt Nam thông qua các kết quả phân lập trên phôi vịt và kĩ thuật RT-PCR. 2. Với hai cặp mồi DHAV3F – DHAV3R và DH3F – DH4R, vùng gen VP1 của 6 chủng virus viêm gan vịt ñã ñược thu nhận thành công bằng phản ứng RT-PCR, cung cấp nguồn gen cho việc nghiên cứu vacxin viêm gan vịt tại Việt Nam. 3. Chuỗi nucleotide của 5 gen kháng nguyên VP1 từ virus viêm gan vịt thu nhận tại các vùng ñịa lý khác nhau của Việt Nam và 1 gen kháng nguyên VP1 từ chủng vacxin nhược ñộc ñang sử dụng tại Việt Nam có kích thước 720 bp (DHAV-3) và 714 bp (DHAV-1) ñã ñược thu nhận và lưu giữ trong plasmid. 4. Vùng gen VP1 của 6 chủng virus nghiên cứu ñược giải trình trình tự thành công về chuỗi nucleotide và trình tự chuỗi axit amin tương ứng. 5. Tại các tỉnh phía Nam và phía Bắc của Việt Nam có sự lưu hành cả 2 serotypye virus viêm gan vịt là genotype I (DHAV-1) và genotype III (DHAV-3). 6. Có sự khác nhau về ñồng nhất nucleotide và tương ñồng amino acid gen kháng nguyên VP1 giữa chủng virus vaccine DH-EG-2000 thuộc genotype I và các chủng virus viêm gan vịt cường ñộc phân lập ñược thuộc genotype III. 5.2 ðề nghị 1. Cần giám ñịnh và sàng lọc thêm nhiều chủng virus viêm gan vịt phân lập tại Việt Nam, ñặc biệt là các chủng ñương nhiễm hiện nay ñể tìm hiểu sự có mặt hay không của DHAV-2 tại Việt Nam, cũng như phát hiện thêm DHAV-3, nhằm bổ sung dữ liệu về virus viêm gan vịt của Việt Nam. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 68 2. Cần nghiên cứu và giải mã toàn bộ hệ gen của một số chủng virus viêm gan vịt cường ñộc phân lập ở Việt Nam. Từ ñó lập phả hệ xem xét mối quan hệ giữa các chủng virus cường ñộc và virus vacxin có mặt ở Việt Nam. 3. Việc sản xuất vacxin DHAV-3 phòng bệnh cho vịt tại Việt Nam cũng như trên thế giới là một vấn ñề cấp bách hiện nay. Các nguồn nguyên liệu là gen kháng nguyên VP1 mà chúng tôi thu nhận ñược sẽ tạo cơ sở dữ liệu sinh học phân tử cho những nghiên cứu về vacxin thế hệ mới. 4. Thực hiện tốt khâu vệ sinh phòng bệnh và tạo miễn dịch cho ñàn vịt con với bệnh viêm gan vịt. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 69 TÀI LIỆU THAM KHẢO A. TÀI LIỆU TIẾNG VIỆT 1. Nguyễn Văn Cảm, Nguyễn Thị Thu Hà, Nguyễn Khánh Ly (2001), Nghiên cứu biến ñổi bệnh lý bệnh viêm gan virus vịt. Tạp chí Khoa học và kỹ thuật Thú y 4: tr 48-51. 2. Trần Minh Châu, Lê Thu Hồng (1985), Thăm dò tạo chủng vaccine nhược ñộc viêm gan vịt bằng chủng phân lập tại ñịa phương. Tạp chí Khoa học và kỹ thuật Thú y 4: tr 3-8. 3. Lê Minh Chí, Hồ ðình Chúc, Bùi Quý Huy (1999), Kết quả ñiều tra dịch bệnh gia súc, gia cầm 5 tỉnh phía Bắc (1995 - 1997). Tạp chí Khoa học và kỹ thuật Thú y 6(3): tr 75-78. 4. Bùi Thị Cúc (2002), Nghiên cứu biến ñổi bệnh lý ñại thể, vi thể và siêu vi thể bệnh viêm gan siêu vi trùng vịt. Luận văn Thạc sĩ Khoa học Nông nghiệp 5. Nguyễn ðường, Nguyễn Như Thanh, Nguyễn Khắc Tuấn, Nguyễn Thị Bích Lộc, Nguyễn Bá Hiên (1990) Vi sinh vật học ñại cương. Nhà Xuất bản Nông nghiệp, Hà Nội. 6. Nguyễn Bá Hiên, Trần Thị Lan Hương (2004), Một số vấn ñề về miễn dịch thụ ñộng ở gia súc, gia cầm non, NXB Nông nghiệp Hà Nội. 7. Lê Thanh Hoà (2002), Sinh học phân tử: nguyên lý và ứng dụng, Viện công nghệ sinh học, Viện Khoa học và công nghệ Việt Nam, (104 trang). 8. Lê Thanh Hoà (2006), Y-Sinh học phân tử, Nhà Xuất bản Y học, Hà Nội. 9. Nguyễn Phục Hưng (2004), Tình hình mắc bệnh viêm gan vịt do virus ở một số tỉnh ñồng bằng Bắc bộ, phân lập virus gây bệnh, Nghiên cứu ñặc tính sinh học của chủng virus nhược ñộc viêm gan vịt DH-EG-2000 và qui trình sản xuất vaccine. Luận văn thạc sĩ nông nghiệp, Trường ðại học Nông nghiệp Hà Nội. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 70 10. Trần Thị Lan Hương (2007), Phân lập virus gây bệnh viêm gan vịt trên ñàn vịt con nuôi tại một số vùng phụ cận Hà Nội. Tạp chí Khoa học và kỹ thuật Thú y 5: tr.13-16. 11. ðoàn Thị Thanh Hương (2010), Nghiên cứu giải mã gen và hệ gen virus viêm gan vịt phân lập tại Việt Nam và xác ñịnh vị trí phân loại. Luận văn tiến sỹ hoá sinh học. tr. 45-65. 12. Bùi Thanh Khiết (2007), Nghiên cứu quy trình sản xuất vaccine viêm gan vịt từ chủng virus vaccine nhược ñộc DH-EG-2000 và ứng dụng phòng, can thiệp dịch vào thực tế sản xuất, Luận văn thạc sĩ nông nghiệp, Trường ðại học Nông nghiệp Hà Nội. 13. Nguyễn ðức Lưu, Vũ Như Quán (2002) Bệnh viêm gan virus vịt. Tạp chí Khoa học và kỹ thuật Thú y 9(1): tr. 87-90. 14. Nguyễn Vĩnh Phước, Hồ ðình Chúc, Nguyễn Văn Hanh, ðặng Thế Huynh (1978), Giáo trình bệnh truyền nhiễm gia súc, gia cầm, NXB Nông nghiệp, Hà Nội. 15. Phạm Văn Ty (2007), Virus học. Nhà xuất bản giáo dục. B. TÀI LIỆU NƯỚC NGOÀI 16. Asplin FD (1958), An attenuated strain of duck hepatitis virus. Vet Rec 70: 1226-1230. 17. Asplin FD (1961), Notes on epidemiology and vaccination for virus hepatitis of ducks. Off Int Epizoot Bull 56: 793-800. 18. Davis D, Hannant D (1987), Fractionation of neutralizing antibodies in serum of ducklings vaccinated with live duck hepatitis virus vaccine Res Vet Sci 43: 276-277. 19. Ding C, Zhang D ( 2007), Molecular analysis of duck hepatitis virus type 1. Virol 361: 9-17. 20. Gough RE, Spackman D (1981), Studies with inactivated duck virus hepatitis vaccines in breeder ducks. Avian Pathol 10: 471-479. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 71 21. Gough RE, Borland ED, Keymer IF, Stuart JC (1985), An outbreak of duck hepatitis type II in commercial ducks. Avian Pathol 14: 227-236. 22. Haider SA, Calnek BW (1979), In vitro isolation, propagation, and characterization of duck hepatitis virus typee III. Avian Dis 23: 715-729. 23. Hwang J (1965), A chicken embryo-lethal-strain of duck hepatitis virus. Avian Dis 6: 435-440. 24. Feigelstock D, Mateu MG, Valero ML, Andreu D, Domigo E, Palma EL (1996), Emerging foot-and-mouth disease virus variants Antigenic heterogeneity of a foot-and mouth disease virus serotype in the field is mediated by very limited sequence variation at several antigenic sites. J Virol 68: 1407-1417. 25. Jin X, Zhang W, Zhang W, Gu C, Cheng G, Hu X (2008), Identification and molecular analysis of the highly pathogenic duck hepatitis virus type 1 in Hubei province of China. Res Vet Sci 85(3): 595-598. 26. Johansson ES, Niklasson B, Tesh R B, Shafren DR, da Rosa APAT, Lindberg A.M (2003), Molecular characterization of M1146, an American isolate of Ljungan virus (LV) reveals the presence of a new LV genotype. J Gen Virol 84: 837–844. 27. Kim MC, Kwon YK, Joh SJ, Kwon JH, Kim JH, Kim SJ (2007), Development of one-step reverse transcriptase-polymerase chain reaction to detect duck hepatitis virus type 1. Avian Dis 51: 540-545. 28. Levine PP, Hofstad MS (1945), Duck disease investigation. Annu Rep New York State Vet Coll, Ithaca Vet 40: 71-86. 29. Levine P, Fabricant J (1950), A hitherto-undescribed virus disease of ducks in North America. Cornell Vet 40: 71-86. 30. Reuss RC, Landmann L, Gosert R, Tang BL, Hong W, H.P H, Egger D, Bienz K (1959), Cellular COPII proteins are involved in production of the vesicles that form the poliovirus replication complex. J Virol 75: 9808-9818. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 72 31. Stanway G, Brown F, Christian P, Hovi T, Hyypiä T, King AMQ, Knowles NJ, Lemon SM, Minor PD, Pallansch MA, Palmenberg AC, Skern T (2005) Family Picornaviridae, In: Fauquet C.M., Mayo M.A., Maniloff J., Desselberger U., Ball L.A (Eds), Virus Taxonomy. Eighth Report of the International Committee on Taxonomy of Viruses, Elsevier/Academic Press, London. 757-778. 32. Tseng CH, Knowles NJ, Tsai HJ (2007), Molecular analysis of duck hepatitis virus type 1 indicates that it should be assigned to a new genus. Virus Res 123: 190-203. 33. Tseng CH, Tsai HJ (2007a), Molecular characterization of a new serotype of duck hep-atitis virus. Virus Res 126: 19-31. 34. Tseng CH, Tsai HJ (2007b), Sequence analysis of a duck picornavirus isolate indicates that it together with porcine enterovirus type 8 and simian picornavirus type 2 should be assigned to a new picornavirus genus. Virus Res 129 1-104. 35. Woolcock PR (1998), Duck hepatitis, In: Swayne, D.E., Glisson, J.R., Jackwood, M.W., Pearson, J.E., Reed, W.M. (Eds.), A Laboratory Manual for the Isolation and Identification of Avian Pathogens, 4th ed. American Association of Avian Pathologists, Kennett Square, PA. 200-204. 36. Woolcock PR (2003), Duck hepatitis, Diseases of Poultry, 11th Ed, Iowa State Press, Ames, IA. 343-354. Trang Web tham khảo 37. 38. 39. 40. Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 73 PHỤ LỤC Phụ lục 1: Bảng mã di truyền sử dụng cho virus TTT TTC TTA TTG F Phe F Phe L Leu L Leu TCT TCC TCA TCG S Ser S Ser S Ser S Ser TAT TAC TAA TAG Y Tyr Y Tyr * STOP * STOP TGT TGC TGA TGG C Cys C Cys * STOP W Trp CTT CTC CTA CTG L Leu L Leu L Leu L Leu CCT CCC CCA CCG P Pro P Pro P Pro P Pro CAT CAC CAA CAG H His H His Q Gln Q Gln CGT CGC CGA CGG R Arg R Arg R Arg R Arg ATT ATC ATA ATG I Ile I Ile I Ile M Met ACT ACC ACA ACG T Thr T Thr T Thr T Thr AAT AAC AAA AAG N Asn N Asn K Lys K Lys AGT AGC AGA AGG S Ser S Ser R Arg R Arg GTT GTC GTA GTG V Val V Val V Val V Val GCT GCC GCA GCG A Ala A Ala A Ala A Ala GAT GAC GAA GAG D Asp D Asp E Glu E Glu GGT GGC GGA GGG G Gly G Gly G Gly G Gly XXX: Poteltial initiation codon (always encodes fMet) TAA, TAG, TGA: Termination codon Trường ðại học Nông nghiệp Hà Nội - Luận văn thạc sĩ khoa học nông nghiệp …………………………… 74 Phụ lục 2: Bảng kí hiệu 20 axit amin thông thường Glycin G Gly Asparagin N Asn Alanin A Ala Glutamin Q Glu Valin V Val Phenylalanin F Phe Leucin L Leu Tyrosin Y Tyr Isoleucin I Ileu Tryptophan W Trp Prolin P Pro Aspartat D Asp Serin S Ser Glutamat E Glu Threonin T Thr Lysin K Lys Cystein C Cys Arginin R Arg Methionin M Met Histidin H His ._.

Các file đính kèm theo tài liệu này:

  • pdfCH2281.pdf
Tài liệu liên quan