So sánh một số phương pháp phòng thí nghiệm chẩn đoán virus Lở Mồm Long Móng tại Việt Nam

Tài liệu So sánh một số phương pháp phòng thí nghiệm chẩn đoán virus Lở Mồm Long Móng tại Việt Nam: ... Ebook So sánh một số phương pháp phòng thí nghiệm chẩn đoán virus Lở Mồm Long Móng tại Việt Nam

doc89 trang | Chia sẻ: huyen82 | Ngày: 09/12/2013 | Lượt xem: 2439 | Lượt tải: 17download
Tóm tắt tài liệu So sánh một số phương pháp phòng thí nghiệm chẩn đoán virus Lở Mồm Long Móng tại Việt Nam, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG NGHIỆP HÀ NỘI ==========&========== TRẦN ĐÌNH LĂNG SO SÁNH MỘT SỐ PHƯƠNG PHÁP PHÒNG THÍ NGHIỆM CHẨN ĐOÁN VIRUS LỞ MỒM LONG MÓNG TẠI VIỆT NAM LUẬN VĂN THẠC SĨ NÔNG NGHIỆP Chuyên ngành : Thú y Mã số : 60.62.50 Người hướng dẫn khoa học: TS. NGUYỄN VĂN CẢM HÀ NỘI - 2009 LỜI CẢM ƠN Trong quá trình thực tập và thực hiện luận văn này, ngoài sự cố gắng nỗ lực của bản thân, tôi đã được sự hướng dẫn trực tiếp của TS. Nguyễn Văn Cảm. Tôi xin được bày tỏ lòng biết ơn sâu sắc nhất tới thầy hướng dẫn TS. Nguyễn Văn Cảm, người đã giành nhiều thời gian quý báu tận tình giúp đỡ tôi trong suốt quá trình thực hiện và hoàn thành luận văn. Tôi xin chân thành cảm ơn tới: - Ban Giám đốc, tập thể phòng Virus, Trung tâm Chẩn đoán Thú y TƯ. - Lãnh đạo cùng toàn thể cán bộ, nhân viên Trung tâm Kiểm nghiệm Thuốc Thú y TƯ1. - Viện Đào tạo sau Đại học, Trường Đại học Nông nghiệp Hà Nội. - Gia đình, bạn bè, đồng nghiệp. Đã luôn tạo điều kiện, động viên, giúp đỡ tôi trong suốt quá trình học tập, nghiên cứu và hoàn thành luận văn. Nhân dịp này, tôi xin bày tỏ lòng biết ơn tới TS. Tô Long Thành, PGS. TS. Phạm Ngọc Thạch đã giúp đỡ tôi trong quá trình nghiên cứu và hoàn thành luận văn này. Hà Nội, ngày 19 tháng 9 năm 2009 Học Viên Trần Đình Lăng LỜI CAM ĐOAN T«i xin cam ®oan ®©y lµ c«ng tr×nh nghiªn cøu cña riªng t«i. C¸c sè liÖu, kÕt qu¶ nªu trong luËn v¨n lµ trung thùc vµ ch­a tõng ®­îc ai c«ng bè trong bÊt k× c«ng tr×nh nµo kh¸c. T«i xin cam ®oan r»ng c¸c th«ng tin trÝch dÉn trong luËn v¨n ®Òu ®· ®­îc chØ râ nguån gèc. Tác giả Trần Đình Lăng DANH MỤC CÁC BẢNG STT Tên Bảng Trang 1 Bảng 4.1: Chất lượng mẫu bệnh phẩm LMLM trong 3 năm (2007-4.2009) 41 2 Bảng 4.2: Kết quả chẩn đoán bằng phương pháp ELISA 45 3 Bảng 4.3: Kết quả chẩn đoán bằng phương pháp Realtime PCR 47 4 Bảng 4.4: Kết quả chẩn đoán bằng phương pháp phân lập trên môi trường tế bào BHK21 49 5 Bảng 4.5: Thời gian chẩn đoán bằng phương pháp ELISA 53 6 Bảng 4.6: Thời gian chẩn đoán bằng phương pháp Realtime PCR 54 7 Bảng 4.7: Thời gian chẩn đoán bằng phương pháp phân lập trên môi trường tế bào BHK21 56 8 Bảng 4.8: So sánh thời gian chẩn đoán của các phương pháp 57 9 Bảng 4.9: So sánh độ nhạy tương đối giữa các phương pháp 58 10 Bảng 4.10: Chi phí xét nghiệm cho một mẫu bệnh phẩm LMLM bằng phương pháp ELISA 61 11 Bảng 4.11: Chi phí xét nghiệm cho một mẫu bệnh phẩm LMLM bằng phương pháp Realtime PCR 62 12 Bảng 4.12: Chi phí xét nghiệm cho một mẫu bệnh phẩm LMLM bằng phương pháp phân lập trên tế bào BHK21 64 13 Bảng 4.13: So sánh chi phí giữa các phương pháp cho một mẫu xét nghiệm 65 14 Bảng 4.14: Năng lực thực hiện các phương pháp chẩn đoán virus LMLM của một số đơn vị 66 DANH MỤC CÁC CHỮ VIẾT TẮT VÀ ĐƠN VỊ BHK 21 Baby Hamster Kidney 21 B-ME B-Mercaptoethanol BSC Bio Safety Cabinet CEF Chicken Embryo Fibroblast CPE Cyto Pathic Effect CQTY Cơ Quan Thú y DMSO Dimethylsulfoxide DNA Dinucleotide Acid dNTP DeoxyriboNucleotide Triphosphate EDTA Ethylene Diamine Tetra-acetic Acid ELISA Emzyme - Linked Immunosorbent Assay FAO Food and Agriculture Organization FCS Foetal Cafl Serum FMD Foot and Mouth Disease FMDV Foot and Mouth Disease Virus GSO General Statistics Office KHKT Khoa Học Kỹ Thuật LMLM Lở Mồm Long Móng MDBK Madin-Darby Bovine Kidney MEM Minimum Essential Medium MHC-II Major Histocompatibility Complex class II OIE International Office des Epizootics (nay là World Organisation for Animal Health) OPD Ortho- Phenylenediamine PBS Phosphate Buffer Saline RNA Ribonucleotide Acid RT-PCR Reverse Transcription Polymerase Chain Reaction TTCĐTYTƯ Trung tâm Chẩn đoán Thú y TƯ Vero African green monkey kidney VNT Virus Neutralization Test VP1 Varial Protein 1 WTO World Trade Organization µ Micro g Gram l Lít M Mol ml Millilít N Đương lượng gram UI Đơn vị quốc tế (International Unit) ρ Picro MỤC LỤC PHẦN I MỞ ĐẦU 1.1. TÍNH CẤP THIẾT CỦA ĐỀ TÀI Nông nghiệp chiếm trên 60% tỷ trọng nền kinh tế nước ta. Chăn nuôi, đặc biệt là chăn nuôi gia súc đóng góp lượng thực phẩm lớn cho nhu cầu thịt của toàn dân. Theo Tổng Cục Thống kê (GSO) năm 2007 [62], tổng đàn trâu 2,99 triệu con, đàn bò 6,72 triệu con, đàn lợn 26,56 triệu con, đàn gia cầm 226 triệu con, và dê cừu 1,77 triệu con. Trong những năm gần đây, được sự quan tâm và chỉ đạo sát sao của Đảng và Nhà nước, ngành Nông nghiệp nói chung và ngành Chăn nuôi Thú y nói riêng đã có những bước chuyển biến rõ rệt. Tuy nhiên tình hình dịch bệnh vẫn diễn biến hết sức phức tạp, bệnh Lở Mồm Long Móng (LMLM) vẫn liên tiếp xảy ra ở trong nước cũng như trong khu vực. Bệnh được tổ chức Thú y Thế giới (OIE) đưa vào vị trí đầu tiên trong danh mục các bệnh truyền nhiễm nguy hiểm của gia súc. Bệnh do virus FMDV (Foot and Mouth Disease Virus) gây ra, thường ở thể cấp tính; lây lan nhanh, mạnh; còn được gọi là dịch LMLM. Các loài động vật guốc chẵn như trâu, bò, lợn, dê và cừu đều mắc. Bệnh gây thiệt hại lớn về kinh tế và ảnh hưởng đến thương mại, đặc biệt là việc buôn bán gia súc và sản phẩm gia súc. Ngoài những thiệt hại do việc triển khai chống dịch, bệnh LMLM trực tiếp gây sảy thai khoảng 25% cái chửa, làm giảm 25% sản phẩm thịt, 50% sản lượng sữa và 25% sản lượng lông cừu [19], [1]. Phòng chống dịch bệnh LMLM luôn là chính sách của mỗi Quốc gia trên Thế giới. Virus gây bệnh LMLM thuộc loại RNA virus, họ Picornaviridae, có hướng thượng bì. Virus được chia thành 7 serotype: O; A; C; SAT 1; SAT 2; SAT 3 và Asia 1, trong đó có hơn 70 subtype khác nhau [22], [31]. Trong những năm gần đây ở Việt Nam, ngoài type O, các type A, Asia 1 cũng lần lượt xuất hiện tại các ổ dịch LMLM [23]. Các type O, A, Asia1 đã có mặt tại Khánh Hoà [10]. Các type O, Asia1 đồng thời xuật hiện ở Lào Cai năm 2005 [23]. Thêm vào đó là hiện tượng virus biến chủng và xuất hiện topotype khác như phát hiện topotype O khác biệt từ bò lai F1 ở Đồng Tháp [21]. Các serotype này gậy bệnh có triệu chứng lâm sàng giống nhau nhưng lại không tạo đáp ứng miễn dịch chéo cho nhau. Chính vì vậy chương trình phòng bệnh bằng vacxin gặp nhiều khó khăn do cấu trúc kháng nguyên khác nhau. Xác định chính xác type virus gây bệnh cho gia súc là điều kiện tiên quyết trong chương trình phòng chống dịch bệnh [7]. Đặc biệt, khi Việt Nam đã chính thức là thành viên của Tổ chức Thương mại Thế giới (WTO), đã và đang hội nhập sâu, rộng vào nền kinh tế quốc tế. Áp lực chúng ta phải có những phương pháp chẩn đoán bệnh nhanh, chính xác, phù hợp với tiêu chuẩn quốc tế đáp ứng với tình hình dịch bệnh trong và ngoài nước. Từ những lý do cấp thiết đó, chúng tôi tiến hành thực hiện đề tài: “So sánh một số phương pháp phòng thí nghiệm chẩn đoán virus Lở Mồm Long Móng tại Việt Nam”. 1.2. MỤC TIÊU CỦA ĐỀ TÀI Đánh giá, so sánh độ nhạy tương đối, thời gian xét nghiệm, chi phí giữa các phương pháp dựa trên kết quả đạt được. Kiến nghị phương pháp chẩn đoán phát hiện virus LMLM tối ưu. PHẦN II TỔNG QUAN TÀI LIỆU Bệnh LMLM là một trong những bệnh truyền nhiễm cấp tính lây truyền nhanh, diện gây bệnh rộng, tạo thành đại dịch [6] của các loài động vật móng guốc chẵn, chẽ đôi như: Trâu, bò, lợn, dê, cừu... bệnh gây ra do một loài virus LMLM hướng thượng bì, có đặc điểm là sốt cao và hình thành những mụn nước ở niêm mạc miệng, móng, vú của gia súc cảm thụ. Bệnh LMLM gây bệnh nhẹ ở động vật trưởng thành nhưng gây bệnh nặng ở động vật non (tỷ lệ chết 90 %) [57]. Do tính chất nguy hiểm, bệnh LMLM được tổ chức Thú y Thế giới (OIE) xếp là một bệnh đứng đầu bảng A (bảng những bệnh truyền nhiễm đặc biệt nguy hiểm ở động vật) và bắt buộc các nước thành viên khai báo khi có dịch xảy ra [33]. 2.1. CĂN BỆNH Virus LMLM, là một loại Aphthovirus LMLM (Aphthovirus xuất phát từ chữ Hy Lạp, “Alpha” có nghĩa là mụn nước), thuộc họ Picornaviridae (Pico-nhỏ, rna- ribonucleic acid) [33], [6]. Bệnh được Fracastorius mô tả lần đầu tiên ở Venice (Ý) vào năm 1514. Đến năm 1897 Loeffler và Frosh mới chứng minh được tính qua lọc của nhân tố gây bệnh [33], [61]. Bệnh ghi nhận ở châu Âu (Pháp,Ý, Đức…) từ thế kỷ XVII - XVIII, sau đó bệnh phát hiện ở khắp toàn cầu [6]. 2.1.1. Phân bố serotype virus LMLM trên thế giới Nhìn chung, sự phân bố của các type virus LMLM thường có tính đặc trưng vùng lãnh thổ: Virus LMLM type O, A, C có mặt trên khắp thế giới; type Asia 1 có nguồn gốc châu Á. Các type SAT 1, SAT 2, SAT 3 chỉ có ở châu Phi, hiếm khi thoát ra ngoài (ngoại trừ trường hợp dịch do SAT1 ở Trung Đông năm 1962). Diễn biến của type O cũng trở nên phức tạp trong những năm gần đây: Type O có mặt ở nhiều quốc gia ở khắp 4 châu lục: châu Phi (Sudan, Mali và Togo), châu Á (Iran, Pakistan, Arập Xê Út, Nepan, Bhutan, Philippin, Việt Nam, Myanmar và Thái Lan), Nam Mỹ (Brazil, Southern Cone, Ecuador và Venezuela)…[17]. Phân bố serotype virus LMLM trên thế giới (Nguồn FAO: Virus LMLM type O xuất hiện nhiều nhất ở khu vực Đông Nam Á: Malaysia, Lào, Việt Nam, Philippin, Hồng Kông, Myanmar và Thái Lan. Ổ dịch do virus LMLM type Asia1 cũng được báo cáo ở Iran, Afganistan, Georgia, Azerbezan, Mông Cổ... [17]. Chưa có những hiểu biết rõ ràng về dịch tễ học type C virus LMLM. Virus LMLM type C xảy ra ít nhất so với các type khác trong khu vực trên thế giới, virus LMLM type này là nguyên nhân gây 8% các vụ dịch xảy ra vào năm 1977-1990 và 1,6% các vụ dịch trong năm 1991-1994 [51]. Từ năm 1995 có ít nhất là 10 vụ dịch nghi ngờ do virus LMLM type C gây ra trên thế giới; châu Á (1967-2004) tiêu biểu ở Angola, 1973 châu Âu (1953-1989), Bắc Mỹ (1944 và 1996, 1971-1993), Trung Đông (1967-1970) [52]. 2.1.2. Hình thái, cấu trúc của virus LMLM Virus LMLM là loại virus thuộc nhóm Picornavirus. Kích thước 20-30 nm, hình đa diện có 30 mặt đều. Hạt virus chứa 30% acid nucleic, khoảng 8000 nucleotit, đó là một đoạn RNA chuỗi đơn có khối lượng phân tử là 8.6 KiloDalton. Vỏ capsid có 60 đơn vị gọi là capsome, mỗi capsome có 4 loại protein (VP1, VP2, VP3 và VP4) trong đó VP1 có vai trò quan trọng nhất trong việc gây bệnh, cũng như là loại kháng nguyên chính tạo ra kháng thể chống lại bệnh LMLM [9]. Vì thế, người ta đã tiến hành giải mã nucleotit của 1 phần hoặc toàn bộ gen mã hoá VP1 để phân chia chúng ra thành các serotype và các subtype [33]. Hằng số lắng (S) của hạt virus như sau: Hạt virus hoàn chỉnh (virion) có hằng số lắng 140S; phần vỏ capsid không có RNA là 75S; mảnh protein của capsid bao quanh RNA (dài 8 kilobases) là 12S khi bị tác động bởi nhiệt độ, môi trường acid hoặc nồng độ ion thấp. Virus LMLM là loại không có vỏ bọc - vỏ bọc của virus thường được cấu tạo bằng một lớp lipid [41]. Sự sai khác về bộ gen là nguyên nhân tạo ra các biến type, đặc biệt thông qua sự đa dạng của phân tử VP1. Hạt Virion của virus LMLM (Nguồn: Cấu trúc kháng nguyên virus LMLM (Nguồn: 2.1.3. Phân loại và biến type của virus Virus LMLM thuộc nhóm picornavirus có kích thước rất nhỏ. Virus LMLM có 2 đặc tính đặc biệt liên quan đến dịch tễ học, đó là tính có đa type và tính dễ biến đổi kháng nguyên, các type tuy gây ra những triệu chứng, bệnh tích giống nhau, nhưng lại không gây miễn dịch chéo [12]. Vào năm 1922, hai nhà khoa học Pháp là Vallée và Carré lần đầu tiên phát hiện ra sự tồn tại của hai type virus gây bệnh LMLM ở bò. Năm 1926, hai nhà khoa học Đức là Waldman và Traut - Wein nêu thêm một type virus gây bệnh LMLM thứ 3. Hiện nay, các type virus LMLM do hai nhà khoa học Pháp phát hiện được gọi là type A và O; còn virus mà hai nhà khoa học Đức phát hiện được gọi là type C. Ba type O, A, C được gọi là các type châu Âu. Vài năm sau, 3 type virus LMLM khác được phát hiện ở miền Nam châu Phi và được đặt tên là SAT1, SAT2, SAT3. Tiếp theo, các phòng thí nghiệm virus LMLM của Anh phân lập được type virus thứ 7 ở tại nhiều nước châu Á và đặt tên là type Asia1. Ngoài 7 type cơ bản, người ta thừa nhận có hơn 70 subtype của virus LMLM. Hiện nay, các subtype của virus được ký hiệu thống nhất ví dụ A22 và O1. Tính đa loại của virus được thể hiện khi gia súc đã khỏi bệnh, tính miễn dịch thu được không đều, có khi lại không còn nữa. Virus LMLM biến dị mạnh, một số subtype về mặt miễn dịch học hoàn toàn khác với type “bố mẹ”, thường xuất hiện cuối một ổ dịch [24]. 2.1.4. Đặc tính nuôi cấy của virus LMLM LMLM là loại virus hướng thượng bì do đó ta có thể nuôi cấy virus: - Trên tổ chức da sống (thượng bì) như tổ chức da của thai lợn, thai bò còn sống, chuột non [21]. - Nếu nuôi cấy virus LMLM trên động vật thí nghiệm như thỏ, chuột lang, chuột nhắt trưởng thành thì virus hay bị biến đổi và thường mất tính gây bệnh [12]. - Virus thích ứng trên chuột chưa cai sữa, trên phôi gà hoặc gà con 1 ngày tuổi [8]. - Phương pháp tốt nhất là nuôi cấy virus trên tổ chức thượng bì lưỡi bò trưởng thành, phương pháp này cho kết quả tốt sau nhiều lần tiếp đời, độc lực của virus vẫn giữ được đối với bò và động vật thí nghiệm. - Ngoài ra có thể nuôi cấy virus LMLM trên môi trường tế bào, tốt nhất là tế bào lấy từ tuyến yên của bò hoặc của lợn, tế bào thận bê hoặc thận cừu non hoặc các dòng tế bào có độ nhạy tương đương, như tế bào thận của chuột Hamster non gọi tắt là tế bào BHK (Baby Hamster Kidney). Sau khi cấy virus LMLM vào các môi trường tế bào này để tủ ấm 370C trong 24, 48, 72 giờ trong điều kiện có 5% CO2, virus sẽ làm huỷ hoại tế bào nuôi [28]. * Khả năng đột biến của virus LMLM Virus LMLM có khả năng đột biến cao. Qua theo dõi nhiều năm người ta quan sát được mức độ đột biến của virus LMLM là 7x10-2 năm [38]. Đây là một trong những yếu tố chính dẫn đến tính đa type và nhiều biến chủng qua hàng nghìn năm tiến hoá. Lịch sử đã ghi nhận trong các ổ dịch kéo dài ở châu Âu thường xuất hiện những biến chủng mới vào thời kỳ cuối. Thực ra những biến chủng này có nguồn gốc ngay trong ổ dịch chứ không phải đưa từ ổ dịch khác vào. Nghiên cứu về đột biến và chọn lọc đột biến dẫn đến giả thuyết về sự xuất hiện các biến chủng là hậu quả của việc sử dụng vacxin (do áp lực miễn dịch, hiện tượng tái tổ hợp giữa các topotype tạo chủng mới cũng là một phương thức dẫn đến sự đa dạng sinh học của virus LMLM) [22]. 2.1.5. Sức đề kháng - Với Dung môi hữu cơ: Virus LMLM không có lipid nên chúng có sức đề kháng cao đối với các dung môi hữu cơ như cồn, ê-te v.v…tuy nhiên, virus LMLM mẫn cảm với ánh sáng mặt trời, axít, formol v.v… - pH: Virus LMLM có thể tồn tại ở pH từ 6,7- 9,5 nhưng bền vững nhất ở pH 7,2- 7,6, virus LMLM bị vô hoạt rất nhanh ở pH 11 [8], [9]. - Với sức nóng: Virus LMLM dễ bị tiêu diệt, ở 30- 370C virus LMLM sống được 4- 9 ngày, ở 500C virus LMLM nhanh chóng bị bất hoạt, ở 700C virus LMLM chết sau 5-10 phút. Nhìn chung, virus LMLM mẫn cảm với nhiệt độ nhưng không nhạy cảm với độ lạnh [13], [28]. 2.1.6. Độc lực của virus LMLM Độc lực là khả năng gây bệnh lâm sàng hay mức độ gây bệnh của virus LMLM. Mọi chủng virus LMLM đều được coi là cường độc, mà không có chủng nhược độc. Về mặt lâm sàng, gia súc nhiễm virus LMLM có thể biểu hiện dưới nhiều mức độ khác nhau, từ bệnh rất nghiêm trọng đến dạng lâm sàng thể ẩn [9]. 2.1.7. Cơ chế sinh bệnh Thời kì nung bệnh thường từ 1- 3 ngày khi gây bệnh thực nghiệm: 2-7 ngày hoặc 11 ngày khi gây bệnh trong tự nhiên [24]. Virus LMLM xâm nhập vào động vật chủ theo đường hô hấp hoặc theo vết sước trên da, đầu tiên chúng nhân lên với số lượng nhỏ tại nơi xâm nhập [61]. Vùng yết hầu của động vật nhai lại được coi như vùng sinh bệnh ban đầu của virus LMLM, sau đó virus LMLM xâm nhập vào tổ chức lympho vùng hầu hay các hạch liên quan rồi đi vào máu [8]. Thời kì đầu (virus LMLM ở trong máu) có trước sự phát triển những mụn nước đặc trưng [61]. Sau khi vào máu, virus LMLM được đưa đến các vị trí thứ cấp gồm các cơ quan tuyến, hạch lympho khác và biểu mô quanh mồm, chân, nơi phát sinh các mụn nước [8]. Mụn nước dày đặc sẽ xuất hiện ở viền móng, vòm khẩu cái, mõm, lưỡi, đầu vú [38]. Virus LMLM có thể qua đường sinh dục, qua các niêm mạc khác, qua da của vành móng [14]. 2.1.8. Sự mang trùng của động vật mẫn cảm Nét đặc trưng của bệnh LMLM là hiện tượng mang trùng virus LMLM. Hiện nay, động vật mang trùng được định nghĩa là những động vật có thể phân lập virus LMLM sau 28 ngày hoặc muộn hơn nữa sau khi chúng nhiễm bệnh [36]. Số lượng động vật vật mang trùng cao như vậy có thể do sự tiếp xúc giữa động vật cảm nhiễm cao, trong khi đó phạm vi động vật mẫn cảm với bệnh lại khá lớn [36]. Số lượng động vật mang trùng trong một quần thể phụ thuộc vào loài động vật đó, khả năng chống chịu với sự nhiễm bệnh (sự mẫm cảm), trạng thái miễn dịch của đàn (tiêm hoặc chưa tiêm vacxin), trâu bò mang trùng có thể kéo dài 3- 5 năm điều này cũng thấy ở cừu và dê nhưng không thấy ở lợn, trâu châu Phi mang trùng tới 5 năm, bò châu Phi có thể mang virus LMLM hơn 3 năm [11]. Một điều đặc biệt ở bệnh LMLM là lợn không mang trùng [2], [33]. Bằng phương pháp nested - PCR tác giả Aliasghar Bahari và cộng sự đã xác định tỷ lệ mang trùng tại Iran, động vật mang trùng là 43,59% [36]. Cơ chế của sự hình thành và duy trì trạng thái mang trùng vẫn chưa được biết rõ, Alexandersen và cộng sự đã giả thuyết hai cơ chế cho sự phát triển của virus LMLM trong hầu họng. Một giả thuyết rằng virus LMLM có thể nhiễm vào tế bào của hệ thống miễn dịch ví dụ như đại thực bào hoặc các tế bào ở các cơ quan có thẩm quyền miễn dịch làm cho chúng có thể tránh được sự đáp ứng miễn dịch. Baxt và Mason đã xem xét sự nhân lên của virus LMLM trong bạch cầu đơn nhân lớn ngoại vi trên bò và đã chỉ ra rằng virus LMLM có thể nhiễm … [33]. Hơn nữa, có ý kiến cho rằng virus LMLM được vận chuyển trong cơ thể nhờ hệ thống tế bào langerhans (tế bào trình diện kháng nguyên có dấu ấn bề mặt MHC-II). Khi những tế bào này tiếp xúc với những tế bào bị nhiễm [37]. Cơ chế thứ hai cho rằng virus LMLM có thể xâm nhập vào tế bào vật chủ để cung cấp điều kiện nội bào cho sự tồn tại lâu dài [33]. 2.2. TÌNH HÌNH BỆNH LMLM TRÊN THẾ GIỚI Bệnh LMLM đã xảy ra ở hầu hết ở các nước trên thế giới, ở nhiều nước thuộc châu Á, châu Âu, châu Mỹ La Tinh và châu Phi [31]. Thế giới đã ghi nhận một đợt dịch lớn kéo dài từ năm 1981-1985, xảy ra trên phạm vi 80 nước, gây tổn hại kinh tế lớn cho các nước này [28]. Bản đồ dịch tễ thế giới bệnh LMLM năm 2009 (Nguồn FAO: Châu Âu Vào năm 1544, căn bệnh sốt Aphovirus LMLM đã hoành hành tại Pháp, Anh và miền Nam Italia. Kể từ đó đến nay, gần như toàn bộ lục địa châu Âu liên tục bị nhiễm bệnh [61]. Bệnh LMLM được ghi nhận ở châu Âu (Pháp, Ý, Đức…) từ thế kỷ 17, 18, sau đó bệnh phát hiện ở hầu khắp toàn cầu. Riêng nước Anh, mãi tới năm 1939 mới ghi nhận có dịch [6]. Cuối thế kỷ XIX, ở châu Âu trong vài tháng bệnh đã lây nhanh chóng từ Nga sang Đức, Hà Lan, Thụy Sĩ, Bỉ, Hungary, Áo, Đan Mạch, Pháp, Italia. Có đến hàng chục triệu con bò mắc bệnh, kéo dài đến hàng chục năm không tắt [19]. Từ khi ngừng việc dùng vacxin ở các nước thuộc Liên minh châu Âu (EU) vào năm 1991, dịch LMLM lại xảy ra ở Italia (1993), Hy Lạp (1994, 1996), Bungari (1991, 1993, 1996), Nga (1995), Anbani và Cộng hoà Macedonia (Liên bang Nam Tư cũ), Kosovo (1996). Bởi vì phần lãnh thổ phía Bắc của Bosphorrus (thuộc Thổ Nhĩ Kì) là một phần của châu Âu, nên có thể nói rằng châu Âu chưa bao giờ hoàn toàn không có bệnh LMLM [12]. Gần đây, vào năm 2001 một đợt dịch khác đã khởi phát từ Anh với 2030 trang trại nhiễm bệnh (chi phí cho các ổ dịch năm 2001 đối với nền kinh tế nước Anh vượt quá 8 tỉ USD) [11], sau đó bệnh lan sang Pháp, Hà Lan, Ireland mặc dù số lượng ổ dịch đã được giới hạn ở các nước này [33]. Vào tháng 12/2005 và 1/2007 xảy ra các vụ dịch do type O gây ra ở Israel; Năm 2006 xảy các ra vụ dịch do type A ở Ai Cập, type O ở Hebron, Gaza… Châu Mỹ Bệnh xuất hiện lần cuối cùng ở Canada vào năm 1952, Mexico năm 1954. Tại nước Mỹ đã xảy ra 9 vụ dịch từ 1870 đến 1929. Nước này đã công bố hoàn toàn hết dịch vào năm 1929. Một số nước thuộc Trung Mỹ, Newzealand, Panama được xem là chưa từng có dịch bệnh LMLM [45]. Argentina xảy ra 3 ổ dịch từ năm 2000- 2001 do type O và type A gây ra. Đến tháng 4 năm 2001 virus LMLM type A ở Argentina lan sang Uruguay, sau đó dịch LMLM xuất hiện ở Brazil và một số nước Nam Mỹ khác [17]. Trong năm 2005- 2006 xảy ra các vụ dịch ở Argentina, (type O), Brazil (type O). Châu Phi Tình trạng bệnh LMLM ở các nước Châu Phi là không rõ ràng do không tiến hành điều tra hoặc điều tra rất ít. Hầu hết các quốc gia ở Tây, Trung và Đông Phi có khả năng xuất hiện dịch [17]. Năm 1989, virus LMLM serotype O đã thâm nhập vào Tuynidi do cừu và dê mắc bệnh nhập khẩu từ vùng Trung Đông, sau đó bệnh lây lan sang bò và đã được phát hiện. Tuy nhiên, lúc này bệnh đã có thời gian lây lan và trước khi các biện pháp phòng chống được triển khai, bệnh đã lan toả ở Ai Cập, Libia và liên tục có sự xâm nhập của virus LMLM, có lẽ là từ Libi vào Tuynidi vào những năm 1990. Ở hầu hết vùng hạ Sahara của Châu Phi, Phía nam Tandania, Malauy, Zaia và Angola đều có dịch LMLM. Cộng hoà Nam Phi nhưng bệnh lại sảy ra chủ yếu ở trâu của các nước này, tập trung chủ yếu ở các vườn thú. Các ổ dịch LMLM do virus LMLM thuộc serotype SAT2 tái xuất hiện ở Zimbabue trong những năm 1980, thường được coi là lây lan từ trâu. Ổ dịch cuối cùng trong số các ổ dịch này là vào năm 1991, ổ dịch cuối cùng ở Bôtxoana là vào năm 1980. Ở Namibia có một ổ dịch do virus LMLM thuộc serotype SAT3 vào năm 1994 và Ở cộng hoà Nam Phi, ổ dịch cuối cùng được thông báo là do serotype SAT2, ở loài linh dương tại vườn thú quốc gia Kruger vào năm 1993 [12]. Tây Bắc Phi có thể thỉnh thoảng xuất hiện dịch bệnh nhưng không có báo cáo từ năm 1999. Virus LMLM type O gây nên dịch địa phương ở Ai Cập và có thể cả Libia. Trong năm 2001, Uganda báo cáo có hàng loạt ca bệnh do type O gây nên trên bò ở một đồng cỏ lớn gần với vùng Kiboga. Malauy báo cáo có một ở dịch xuất hiện vào tháng 4-5/2000. Trong tháng 1/2001 tại Swziland xuất hiện một ổ dịch do virus LMLM type SAT1 gây ra trên bò ở miền bắc vùng Hhohho theo dọc biên giới Nam Phi, trong một vùng an toàn dịch LMLM từ lâu Swaziland. Trong tháng 2/2001, xuất hiện một ổ dịch do virus LMLM type SAT2 gây ra trên bò ở một quận của tỉnh Mhana-phía Bắc của Nam Phi. Zimbabue thống kê có 18 ổ dịch do virus LMLM type SAT2 gây ra từ 17/8 đến 22/10/2001 tại các tỉnh Metabeland và Masvingo [17]. Trong năm 2005-2006 xảy ra các vụ dịch ở Namwala, Itezhi, Mumbwa, Chibombo, Monzo, Zimbabwe, Công Gô… Châu Á Theo OIE, từ năm 1995 đến nay, bệnh LMLM đã được thông báo tại Đài Loan (1997), gây thiệt hại vô cùng lớn cho đất nước này làm ngừng ngay xuất khẩu vào thị trường Nhật Bản và Hàn Quốc (gây thiệt hại trên 4 tỉ USD, 90% trong số này bị mất từ lợi nhuận xuất khẩu) [11]. Năm 2000, dịch lây lan đến các nước Đông Bắc Á (Nhật Bản và Hàn Quốc), đến năm 2000 châu Á có 22 quốc gia chính thức công bố dịch LMLM [16]. Năm 2004, các nước thuộc khu vực Đông Á là Mông Cổ và Trung Quốc báo cáo có dịch. Từ năm 2005, tại Trung Quốc, Myanmar đã xuất hiện type virus LMLM Asia1 làm cho diễn biến dịch LMLM trong khu vực đã phức tạp lại càng phức tạp hơn. Tình hình dịch LMLM tại khu vực Đông Nam Á diễn ra theo chiều hướng gia tăng và phức tạp. Các nước có dịch là Thái Lan, Myanmar, Lào, Campuchia, Malaysia, Philippin và Việt Nam. Giữa năm 2006 xảy ra các vụ dịch ở Campuchia do type O gây ra (Cathay và topotype Southeast Asia), Việt Nam, Lào nguyên nhân do type A. 2.3. DỊCH TỄ HỌC BỆNH LMLM 2.3.1. Loài vật mắc bệnh Trong tự nhiên: Trâu, bò, dê, lợn, lạc đà, hươu, bò rừng. Bò là động vật cảm nhiễm nhất. Bò là một thành phần đóng vai trò quan trọng trong dịch tễ bệnh LMLM bởi sự cảm nhiễm cao và khả năng bài thải virus LMLM ít nhất 4 ngày trước khi xuất hiện những triệu chứng lâm sàng đầu tiên. Mặc dù vậy cừu và dê cũng nhiễm bệnh LMLM nhưng triệu chứng của nó không biểu hiện hoặc có biểu hiện không rõ dưới dạng tiền lâm sàng. Lợn là nguồn tàng trữ mầm bệnh LMLM quan trọng của sự gieo rắc virus LMLM trong không khí. Do vậy lợn được coi là vật chủ cho virus LMLM nhân lên và bò là sự chỉ điểm cho sự có mặt của virus LMLM. Cừu có thể là vật dự trữ bởi vì chúng thường mắc ở thể nhẹ hoặc không xuất hiện triệu chứng lâm sàng, không những thế virus LMLM còn có khả năng gây nhiễm ở động một số loại động vật khác trong cùng một vùng nhiễm bệnh [56]. Trong phòng thí nghiệm: Các loài động vật thí nghiệm đều mẫn cảm với virus LMLM. Tuy nhiên, người ta thường gây bệnh cho bê, chuột lang [28], [9]. Virus LMLM có thể phân lập trên phôi gà và trên môi trường nuôi cấy tế bào tuyến giáp trạng bò sơ cấp, tế bào thận cừu, thận bê hoặc thận lợn sơ cấp. Các tế bào dòng, ví dụ như tế bào thận chuột Hamter một ngày tuổi (BHK 21) [22], [9]. 2.3.2. Lứa tuổi Động vật ở các lứa tuổi đều có thể bị bệnh, súc vật non bị mắc bệnh nặng hơn súc vật trưởng thành [28]. Virus LMLM gây bệnh nhẹ ở động vật trưởng thành với tỉ lệ chết trên 5%. Tuy nhiên ở động vật non gây bệnh rất nặng, tỷ lệ chết lên đến 90% [57]. 2.3.3. Mùa vụ Bệnh lây lan quanh năm, nhưng thường xảy ra vào những tháng mưa phùn, ẩm ướt, ánh sáng dịu của mùa đông (từ tháng 12 đến tháng 3) [44]. 2.3.4. Khả năng lây lan Bệnh LMLM là bệnh lây lan rất mạnh rất nhanh, rất rộng trong một thời gian ngắn. Sự di chuyển virus LMLM trong điều kiện thích hợp có thể là 250 km trong không khí [46]. 2.3.5. Tỷ lệ ốm và chết Tỷ lệ tử vong ở động vật trưởng thành thấp nhưng tỷ lệ tử vong ở động vật non có thể lên tới 100%, động vật non chết chủ yếu do viêm cơ tim nặng dẫn đến suy tim và chết [34], nguyên nhân khác là do gia súc non, sức đề kháng kém nên dễ bị nhiễm kế phát các bệnh khác khi mắc bệnh LMLM. 2.3.6. Đường truyền bệnh Có nhiều nhân tố ảnh hưởng đến sự phát tán mầm bệnh. Yếu tố quan trọng nhất là động vật cảm nhiễm, sự tiếp xúc trực tiếp hay gián tiếp giữa các động vật với nhau (sự di chuyển của động vật và con người) mật độ của động vật trong một vùng, phương thức chăn nuôi, điều kiện môi trường và các biện pháp kiểm soát sự nhân lên của bệnh. Sự lây truyền chính của virus LMLM thông qua đường không khí, sự tiếp xúc trực tiếp và thông qua đường thức ăn nước uống. Nhìn chung virus LMLM xâm nhập thông qua đường hô hấp. Cơ chế của sự lây truyền virus LMLM, sự di chuyển của động vật cảm nhiễm đóng vai trò quan trọng nhất tiếp theo sự trao đổi sản phẩm động vật. Một hoặc hơn một động vật trong đàn nhiễm bệnh số virus LMLM thải ra môi trường là rất lớn virus LMLM có thể phát tán rất xa bởi các động vật mang trùng hoặc ủ bệnh, các phương tiện vận chuyển như xe tải vận chuyển thức ăn, chim, chó hoang, các động vật nuôi như chó và mèo, loài gặm nhấm và các động vật có xương sống khác, vecter cơ học. Rác bao gồm các mảnh thức ăn chưa được nấu chín và xương từ những động vật nhiễm bệnh là nguồn gây nhiễm ở lợn. Con người có thể hít hoặc là nơi ẩn náu của virus LMLM trong thời gian 24 giờ và cũng là nguồn lây nhiễm cho động vật. Nét đặc trưng của bệnh LMLM là sự bài thải virus LMLM trước khi động vật bị nhiễm có những dấu hiệu lâm sàng, giai đoạn ủ bệnh dài phụ thuộc từng chủng virus LMLM, sự phơi nhiễm và con đường lây nhiễm. Virus LMLM lây nhiễm qua đường không khí sẽ phát bệnh từ 4-5 ngày ở động vật bị bệnh LMLM và bài thải virus LMLM lên đến 4 ngày trước khi có những dấu hiệu lâm sàng đầu tiên. Virus LMLM lây theo đường không khí phát tán trên khoảng cách 60 km ở đất liền và 200 km ở biển so với nơi xảy ra. Nhân tố đóng vai trò quan trọng nhất trong việc phát tán virus LMLM là gió, độ ẩm cao, điều kiện thích hợp nhất cho virus LMLM là độ ẩm trên 60%, không khí ổn định… [57]. 2.4. TRIỆU CHỨNG VÀ BỆNH TÍCH BỆNH LMLM 2.4.1. Triệu chứng lâm sàng Triệu chứng đặc trưng của bệnh LMLM là: “lở mồm” và “long móng” đúng như tên gọi của bệnh. Ở lợn, thời gian ủ bệnh nhiều hơn. Các triệu chứng của bệnh bao gồm: Tăng thân nhiệt: Sốt thành 2 đợt, đợt một do virus LMLM, đợt hai do nhiễm trùng thứ cấp. - Ngày thứ nhất đến ngày thứ hai: gia súc nhai nhóp nhép, chảy nước dãi, bắt đầu xuất hiện mụn nước ở miệng, lợi, kẽ móng, núm vú... - Ngày thứ ba đến ngày thứ năm: mụn nước vỡ ra. - Ngày thứ sáu đến ngày thứ mười: hình thành các vết sẹo tại nơi có mụn nước vỡ. Gia súc đi khập khiễng do xuất hiện các mụn nước và vết lở loét ở xung quanh gờ vành móng, khe ngón và đế guốc. Nếu nặng thì què do long móng. Con vật ăn kém hoặc không ăn do đau khi nhai [9]. Các loài động vật guốc chẵn có mức độ mẫn cảm ngang nhau đối với virus LMLM nhưng mức độ phát bệnh lâm sàng khác nhau. Bệnh thường biểu hiện rõ nhất và nặng ở trâu bò, sau đó đến lợn và sau cùng là dê cừu. [9] Triệu chứng ở trâu bò Trâu bò mắc bệnh thường sốt cao (40-410C), bỏ ăn, run rẩy, giảm sản lượng sữa trong 2-3 ngày, miệng chảy nhiều nước dãi, đi khập khiễng. Mụn nước (hoặc vết loét khi mụn nước đã vỡ) xuất hiện ở niêm mạc miệng, má, lưỡi, bờ lợi, phía trong mũi, núm vú, kẽ và viền móng. Triệu chứng ở dê, cừu Triệu chứng bệnh LMLM ở dê và cừu là không điển hình, tổn thương nhẹ thường chỉ thấy các vết loét ở vùng lợi. Những tổn thương ở chân không rõ ràng. Mất sữa là triệu chứng đặc trưng nhất của bệnh LMLM ở cừu và dê cho sữa. Dê và cừu non cũng dễ bị chết khi nhiễm virus LMLM. Triệu chứng ở lợn Tổn thương ở miệng của lợn nhẹ hơn của trâu bò. Biểu hiện rõ nhất ở lợn là đi lại khập khiễng do tổn thương nghiêm trọng ở các móng, đặc biệt là lợn nuôi trên nền chuồng bê tông, bệnh gây chết với tỷ lệ cao ở lợn con. 2.4.2. Bệnh tích Bệnh tích đại thể Bệnh tích chủ yếu của bệnh LMLM là mụn nước, vết loét, sẹo ở xoang miệng, gờ vành móng, kẽ ngón, da vú v.v…và hiện tượng lở mồm, long móng [9]. Khi mổ động vật, ta có thể gặp các bệnh tích sau: Mặt ngoài của tim có vết xuất huyết thành vệt như da hổ, gọi là “tim hổ” [9]. Nếu con vật sống sót thì thấy tim bị co giãn, to và mềm nhũn. Trên vết cắt cơ tim xuất hiện vết sọc với những nốt vàng rải rác nổi rõ trên phần cơ tim bình thường [4]. Ngoài biến đổi ở tim, con vật còn có những biến đổi sau [15]. Viêm khí quản và viêm phổi, lách sưng to và có đốm sẫm, có mụn nước kèm theo tụ huyết, xuất huyết ở niêm mạc đường tiêu hoá như lợi, mép chân răng, thực quản, dạ múi khế, ruột non v.v.. Hạn hữu có những trường hợp xuất hiện mụn nước ở những vùng da đáy chậu, vùng da ở bên ngoài bộ phận sinh dục con đực cũng như con cái và ở mí mắt của chúng [43]. Bệnh tích vi thể Bệnh tích vi thể có thể quan sát thấy ở bề mặt biểu mô, cơ tim và cơ bắp. Đặc biệt là ở cơ tim của động vật non có thể bị hoại tử kéo dài, kèm theo sự xâm nhiễm mạnh của các tế bào lympho. Đây là nguyên nhân phổ biến dẫn đến tử vong ở gia súc non [43]. Bệnh tích ở lớp thượng bì: Tổn thương ở các tế bào biểu bì, thoái hoá ở các tế bào ở giữa lớp biểu ._.bì. Bên trong tế bào bị thoái hoá, nhân tế bào co lại và thẫm màu. Dịch thuỷ thũng có thể có sợi fibrin. Lớp tế bào bì có sự thâm nhiễm bạch cầu đơn nhân lớn. Có hiện tượng hoại tử tan và thấm nước phù. Bệnh tích ở cơ vân: Hoại tử các sợi cơ tạo thành những nốt kết hợp với sự thâm nhiễm các tế bào viêm. 2.5. CHẨN ĐOÁN BỆNH LMLM 2.5.1. Chẩn đoán lâm sàng Chẩn đoán lâm sàng bệnh LMLM có thể thực hiện trong trường hợp bệnh xảy ra trong khu vực đã được xác định là có dịch LMLM. Triệu chứng chính của bệnh là sốt, chảy nước dãi, xuất hiện những mụn nước trong xoang miệng, quanh mũi, vành tiếp giáp da móng chân, kẽ chân và đầu vú. Kèm theo các triệu chứng trên là hiện tượng con vật bị què do bị đau chân, gây ra khó khăn trong khi đi lại, gây ra khó khăn trong khi di chuyển [9]. 2.5.2. Chẩn đoán phòng thí nghiệm 2.5.2.1. Chẩn đoán bằng phương pháp virus học. Huyễn dịch nghi là có virus LMLM cần phải ly tâm trước khi cấy vào tế bào nuôi hoặc tiêm cho chuột nhắt trắng chưa cai sữa. Tiêm cho chuột: Dùng chuột nhắt trắng 2-7 ngày tuổi và thuần chủng, khía gan bàn chân chuột, bôi huyễn dịch bệnh phẩm lên vùng da bị khía. Nếu bệnh phẩm có chứa virus LMLM, sau 12 giờ sẽ nổi vết đỏ, có thuỷ thũng và đau ở vết khía [22]. Nuôi cấy trên tế bào: Các tế bào nhạy cảm với virus LMLM bao gồm tế bào tuyến giáp trạng bò sơ cấp, tế bào thận cừu, thận bê hoặc thận lợn sơ cấp. Các tế bào dòng, ví dụ như tế bào thận chuột Hamster một ngày tuổi (BHK21), sau 24 giờ nếu bệnh phẩm có virus LMLM thì sẽ thấy bệnh tích tế bào [22]. Tiêm động vật cảm thụ: Tiêm vào nội bì lưỡi bò (bò không nằm trong phạm vi ổ dịch, chưa được tiêm phòng vacxin), sau 24 giờ nếu xuất hiện mụn nước ở chỗ tiêm, khi mụn nước tạo ra các vết loét thì kết luận gia súc bị bệnh. 2.5.2.2. Chẩn đoán bằng các phương pháp huyết thanh học * Phản ứng miễn dịch gắn với enzyme (ELISA) Theo quy định của phòng thí nghiệm tham chiếu về LMLM của OIE, FAO, biện pháp thích hợp nhất để phát hiện kháng nguyên của virus LMLM và giám định các serotype của virus LMLM là phương pháp ELISA. Hiện nay ELISA là một phản ứng chẩn đoán nhanh dùng cho bệnh LMLM cũng như giám định serotype của virus LMLM. * Phản ứng kết hợp bổ thể Nguyên lý của phản ứng: Phản ứng kết hợp bổ thể dùng hai hệ thống: Hệ thống dung khuẩn và hệ thống dung huyết với sự tham gia của bổ thể. - Huyết thanh miễn dịch của từng type được chế trên chuột lang bằng phương pháp gây tối miễn dịch. Tiêm vacxin LMLM của từng type virus LMLM khác nhau vào trong da dưới gan bàn chân chuột lang (mỗi type một chuột) hai lần mỗi lần cách nhau một tháng, sau đó lấy máu, chắt huyết thanh có chứa kháng thể. - Kháng nguyên là máu gia súc nghi mắc bệnh LMLM hoặc bệnh phẩm cấy vào trong môi trường tổ chức lấy từ tuyến yên của bò hoặc của lợn, tế bào thận bê hoặc thận cừu non hoặc các dòng tế bào có độ nhạy tương đương, khi tế bào xuất hiện nhưng dấu hiệu bệnh tích tế bào thì lấy dịch làm phản ứng kết hợp bổ thể [28]. * Phản ứng trung hoà virus LMLM (Virus neutralization test- VNT) Nguyên lý: Virus LMLM khi xâm nhập vào cơ thể kích thích cơ thể sản sinh kháng thể dịch thể đặc hiệu. Sự kết hợp giữa kháng thể dịch thể đặc hiệu và virus LMLM làm cho virus LMLM bị trung hoà, mất khả năng lây nhiễm. 2.5.2.3. Phân lập và giám định virus LMLM * Giám định bằng cách phân tích protein Virus LMLM là virus có mức độ đột biến cao nhưng mỗi biến chủng có dấu ấn riêng. Bằng phương pháp sinh hoá học có thể đưa ra những kết luận về đặc tính của chủng, tính đặc hiệu của chủng cũng như tiến hoá của các biến chủng. Điện di polyacrylamid gel cho phép so sánh điểm đẳng điện của các protein, phát hiện dấu vết sai khác giữa các biến chủng của virus LMLM và quan hệ họ hàng giữa các biến chủng [22], [30]. * Chẩn đoán phát hiện RNA virus Các phương pháp phát hiện virus LMLM trong bệnh phẩm bằng RT-PCR và real-time PCR hiện đang được áp dụng rộng rãi trong các phòng thí nghiệm trên thế giới. 2.6. PHÒNG BỆNH 2.6.1. Khi chưa có dịch xảy ra Chăm sóc và vệ sinh phòng bệnh - Cho gia súc ăn uống đầy đủ về chất lượng và số lượng - Định kỳ tẩy uế chuồng trại, bãi chăn thu gom phân rác đốt hay ủ phân theo phương pháp sinh vật học. - Khi nhập gia súc từ nơi này sang nơi khác phải thực hiện kiểm dịch chặt chẽ, nhất là qua biên giới [22]. Phòng bệnh bằng vacxin - Đối với bệnh LMLM đến nay người ta chỉ sử dụng vacxin vô hoạt [28]. - Virus LMLM có nhiều type và subtype, có khả năng đột biến mạnh và không gây miễn dịch chéo nên chủng virus dùng sản xuất vacxin phải phù hợp với chủng virus gây bệnh trên thực địa thì việc tiêm phòng mới có hiệu quả. Sau khi tiêm vacxin mức độ bảo hộ tốt nhất thường được ghi nhận ở bò là từ 21-28 ngày sau khi tiêm, nhưng có một số trường hợp đỉnh cao này lại quan sát thấy ở ngày 14 sau khi tiêm [40], [42], [41]. Mỗi lần tiêm bảo hộ được 3 tháng do vậy chúng ta cần phải tiêm nhắc lại. - Các loại vacxin đang dùng hiện nay: + Vacxin formol keo phèn Vacxin formol keo phèn sản xuất theo phương pháp của Valê (Pháp 1925), Smits (Đan Mạch 1938) và Vanman (Đức 1938) 1954 [23]. Vacxin này được chế tạo bằng cách gây bệnh cho bò bằng cách khía da trên lưỡi hoặc tiêm vào cơ lưỡi virus LMLM thuộc các type gây bệnh. Mụn nước hình thành trên lưỡi sau 24h, mụn nước được lấy ra cẩn thận, và bảo quản lạnh sau đó vô hoạt bằmg formalin nồng độ 1% [28]. + Vacxin vô hoạt nuôi cấy trên môi trường tế bào Vacxin này được chế từ virus nuôi cấy trên mô bào; biểu mô lưỡi bò trưởng thành tế bào nguyên sinh thận bê hoặc các dòng tế bào mẫn cảm như: BHK 21, sau đó vô hoạt bằng formalin, acetylethyleneimine, binary, Ethyleneimine sau đó vô hoạt các chất trên, người ta nhũ hoá với chất bổ trợ dầu sẽ được vacxin virus hữu hiệu, hơn vacxin formalin bởi vì độ dài miễn dịch ở bò và lợn dài hơn [28]. Các loại vacxin LMLM hiện dùng ở Việt Nam Tại Việt Nam hiện đang sử dụng 2 loại vacxin đơn giá và đa giá nhập từ các nước là Merial (Pháp) và Intervet (Hà Lan), Trung Quốc (vacxin vô hoạt type O), Nga, Ấn Độ (Posi-FMD). Intervet giới thiệu ở Việt Nam hai loại vacxin LMLM có tên thương mại là DECIVAC- FMD- ALSA (dùng cho thú nhai lại) và DECIVAC- FMD- DOE (dùng chung cho lợn và thú nhai lại). Merial có vacxin Aftovax (dùng cho thú nhai lại) và Aftopor (dùng cho lợn và thú nhai lại) [37]. Viện Thú y Lan Châu, Trung Quốc có vaxin nhị giá Foot and Mouth Disease (type O, Asia1) Bivalent Vaccine, Inactivated cũng đang được sử dụng ở nước ta. Vacxin đa giá ở Việt Nam chứa các type O, A và Asia1 [37]. 2.6.2. Khi dịch xảy ra Khi dịch bệnh LMLM xảy ra, phải thực hiện các biện pháp chống dịch, khai báo có dịch và công bố dịch, khoanh vùng ổ dịch. 2.7. TÌNH HÌNH VÀ NGHIÊN CỨU BỆNH LMLM Ở VIỆT NAM 2.7.1. Tình hình bệnh LMLM ở Việt Nam Ở Việt Nam, bệnh được ghi nhận đầu tiên tại Nha Trang (1989) [6]. Trước đây, bệnh thường thấy ở các tỉnh miền Trung và miền Nam, giáp với biên giới Camphuchia và Lào. Ở miền Bắc, bệnh được ghi nhận trong thời gian dài từ những năm 1921-1963. Bệnh không xảy ra ở khu vực các tỉnh phía Bắc từ 1963-1992. Năm 1993, dịch bệnh xuất hiện ở các tỉnh Quảng Ninh, Hà Tĩnh, Quảng Bình, Thừa Thiên Huế. Năm 1995, bệnh xảy ra ở 107 huyện thuộc 26 tỉnh làm nhiều trâu, bò, lợn bị chết. Diễn biến bệnh LMLM ngày càng trở nên phức tạp, hàng năm bệnh xảy ra ở diện rộng với số lượng lớn gia súc bệnh [4]. Theo số liệu của Cục Thú y [5], năm 1999, trong khi vẫn chưa chấm dứt các đợt dịch từ các tỉnh miền Trung và miền Nam thì ở miền Bắc, đợt dịch mới từ Trung Quốc tràn sang tấn công hàng loạt các tỉnh giáp biên. Cao Bằng là điểm dịch đầu tiên, từ đó dịch lan sang các tỉnh khác. Đến 10/3/2000 đã có 58 tỉnh bị dịch, 297.808 trâu, bò và 36.530 lợn mắc bệnh. Năm 2001, bệnh xảy ra ở 16 tỉnh thành với 3.976 trâu, bò mắc bệnh. Năm 2002, bệnh xảy ra ở 26 tỉnh thành với 10.287 trâu, bò mắc bệnh. Năm 2003, 38 tỉnh thành có dịch, trong đó 28 tỉnh thành có dịch ở trâu, bò và 28 tỉnh có dịch ở lợn, với tổng số 20.303 trâu, bò; 1.178 dê và 3.533 lợn mắc bệnh, chủ yếu ở các tỉnh: Quảng Trị, Phú Yên, Khánh Hoà, Gia Lai, Hà Giang. Theo Tô Long Thành và cộng sự, tình hình dịch bệnh LMLM trong mấy năm gần đây diễn biến hết sức phức tạp và có chiều hướng gia tăng. Năm 2004, số tỉnh có dịch LMLM là 24 tỉnh, trong đó có 9 tỉnh do virus LMLM serotype A (phát hiện lần đầu tiên tại Ninh Thuận và Bình Định vào 8/2004), 12 tỉnh do virus LMLM serotype O và 3 tỉnh do cả 2 virus LMLM serotype O và A. Nguyên nhân của việc xuất hiện virus LMLM type A có thể là do việc nhập lậu bò từ Camphuchia. Năm 2005, số tỉnh có dịch LMLM là 37 tỉnh với 28.241 trâu, bò, 3.976 lợn mắc bệnh, trong đó có 3 tỉnh do virus LMLM serotype A, 13 tỉnh do virus LMLM serotype O, 3 tỉnh do cả 2 virus LMLM serotype O và A, 2 tỉnh do virus LMLM serotype Asia 1 (Lào Cai và Khánh Hoà vào tháng 10/2005). Năm 2006, số tỉnh có dịch LMLM là 27, trong đó 26 tỉnh là type O và Hà Giang là type Asia 1 (phát hiện tháng 5/2006 bằng kít 3ABC và giám định bằng phương pháp RT-PCR) với tổng số 9.271 trâu bò và 12.461 lợn bị bệnh. Năm 2007 có 37 tỉnh có dịch, chủ yếu xảy ra ở trâu bò, với tổng số 11.355 trâu bò ốm và phải xử lý, chết là 3.765 con trong 225 huyện, 294 xã có dịch LMLM. Có 172 xã thuộc 71 huyện có dịch LMLM trên lợn với tổng số con ốm là 12.386 con và phải xử lý là 11.122 con. Các type virus lưu hành là type O, A và Asia1. Tình hình dịch bệnh LMLM trong năm 2008 có giảm so với các năm trước, 43 huyện có dịch trên trâu bò, 2.408 trâu bò mắc bệnh, số trâu bò chết, tiêu hủy là 218 con. Type O vẫn là type virus xuất hiện nhiều nhất trong các ổ dịch bên cạnh type A và Asia1. Đến ngày 15 tháng 9 năm 2009 đã có 21 tỉnh có dịch LMLM trên trâu, bò và lợn, số mắc ở trâu là 1.439 con, bò là 1.768 con và lợn là 238 con. Những tỉnh có số trâu bò lợn mắc và tiêu hủy nhiều là Kon Tum, Quảng Bình, Quảng Ngãi, Sơn La… 2.7.2. Những nghiên cứu về bệnh LMLM ở Việt Nam Năm 2003, Hồ Đình Chúc và Ngô Thanh Long đã sử dụng kit ELISA CHECKIT - FMD- 3ABC để phát hiện trâu bò nhiễm virus LMLM [3]. Năm 2004, Tô Long Thành và cộng sự đã phân lập thành công virus LMLM trên tế bào BHK21. Sử dụng kỹ thuật RT- PCR với cặp mồi chung 1F/1R đặc hiệu cho 7 type của virus LMLM gây bệnh LMLM và cặp mồi P33/P38 đặc hiệu cho type O đã được xác định virus LMLM phân lập được là virus LMLM type O [27]. Năm 2005, Lê Văn Phan và cộng sự đã tách dòng và giải mã thành công đoạn mã hoá cho serotype O của virus LMLM gây bệnh LMLM thu thập tại Quảng Trị [18]. Tháng 10/2005, Nguyễn Viết Không và cộng sự đã phát hiện type Asia1 của virus LMLM tại Khánh Hòa. Như vậy, ở Nha Trang được ghi nhận có 3 type virus LMLM là O, A và Asia1 [10]. Năm 2006, Thái Thuỷ Phượng và Lê Thanh Hoà đã tách dòng, giải trình tự và phân tích chuỗi gene từ các mẫu bệnh phẩm từ bò lai và lợn Đồng Tháp đã phát hiện ra topotype khác biệt của virus LMLM [20]. Năm 2007, Thái Thủy Phượng, Lê Thanh Hoà đã định type virus LMLM trên heo, bò tại Tiền Giang và Đồng Tháp qua sử dụng chỉ thị phân tử gene kháng nguyên 1D- 2A- 2B (VP1-2A-2B) [21]. Như vậy ở nước ta hiện nay có 3 serotype virus LMLM gây bệnh LMLM O, A, Asia1. Virus LMLM serotype O có 3 topotype: Topotype SAE (South- EAST), topotype Cathay, topotype ME-SA (Trong đó topotype Cathay và topotype ME-SA là phổ biến nhất trong các ổ dịch). PHẦN III ĐỐI TƯỢNG, NỘI DUNG, ĐỊA ĐIỂM, VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1. ĐỐI TƯỢNG, NỘI DUNG VÀ ĐỊA ĐIỂM NGHIÊN CỨU 3.1.1. Đối tượng nghiên cứu Gia súc nghi mắc bệnh LMLM, mẫu bệnh phẩm nghi có virus LMLM. 3.1.2. Nội dung nghiên cứu - Nhận xét, đánh giá chất lượng mẫu bệnh phẩm được gửi đến Trung tâm Chẩn đoán Thú y TƯ và mẫu bệnh phẩm do cán bộ Trung tâm đi lấy. - Chẩn đoán phát hiện virus LMLM bằng phương pháp ELISA. - Chẩn đoán phát hiện virus LMLM bằng phương pháp Real-time PCR. - Chẩn đoán phát hiện virus LMLM bằng phương pháp phân lập virus trên tế bào BHK21. - Thu thập kết quả, đánh giá, so sánh độ nhạy tương đối, thời gian chẩn đoán, chi phí giữa các phương pháp dựa trên kết quả đạt được. Kiến nghị phương pháp chẩn đoán phát hiện virus tối ưu. - Khảo sát năng lực thực hiện ba phương pháp chẩn đoán trên tại một số đơn vị. 3.1.3. Địa điểm nghiên cứu - Một số tỉnh có dịch. - Trung tâm Chẩn đoán Thú y TƯ. - Trung tâm Kiểm nghiệm Thuốc Thú y TƯ1. 3.2. VẬT LIỆU NGHIÊN CỨU 3.2.1. Máy móc - Tủ lạnh âm - Tủ lạnh thường - Tủ ấm 37oC - Máy lắc đĩa (orbital shaker) - Máy lắc trộn (vortex mixer) - Nồi đun cách thuỷ (water bath) - Máy đọc ELISA với kính lọc 492 nm - Máy rửa đĩa ELISA. - Buồng cấy vô trùng (BSC-Biosafety cabinet) - Máy ly tâm, máy ly tâm lạnh - Máy real-time PCR Smart Cycler 3.2.2. Dụng cụ - Bình tam giác các cỡ: 100, 200, 500 và 1000 ml - Ống đong thuỷ tinh các cỡ: 50, 100, 200, 500 và 1000 ml - Cốc có mỏ các cỡ: 100, 200, 500 và 1000 ml - Ống nghiệm - Lọ nhỏ chắt huyết thanh - Máng trộn chất phản ứng (reagent trough) - Pipette thuỷ tinh: 1, 5 và 10 ml - Micropipette đơn: 0,5-10, 5-40, 40-200, 200-1000 µl - Micropipette đa kênh (8-12): 5-50, 50-300 µl - Bộ cối, chày sứ - Cát sạch để nghiền bệnh phẩm - Khăn bông - Dao, kéo, panh kẹp. 3.2.3. Hoá chất - Nước cất hoặc nước khử ion - Water free RNA - Dung dịch đệm Phosphate/citrate - Chất phát màu OPD (ortho-phenylenediamine) - Cơ chất (H2O2) - Viên Carbonate/bicarbonate - Đỏ phenol 1% - Tween 20 - Axit citric - HCl - H2SO4 1,25M - Na2HPO4.2H2O - KH2PO4 - KCl - NaCl. - Ethanol 100% - Dung dịch TE - Dung dịch TAE 50X. - B-Mercaptoethanol 3.2.4. Nguyên liệu 3.2.4.1. Bộ kit ELISA phát hiện kháng nguyên LMLM (Pirbright- Anh Quốc) 3.2.4.2. Bộ kit Qiagen và primer phát hiện kháng nguyên LMLM (Qiagen- Hàn Quốc) 3.2.4.3. Nguyên liệu cho phân lập tế bào - Giống tế bào BHK21: do Bộ môn Virus, TT Chẩn đoán Thú y TƯ cung cấp. - Môi trường cơ bản RPMI 1640, MEM (Minimum Essential Medium), MEM non essential amino acid solution 100x, MEM amino acid solution 50x, Foetal Bovine (Cafl) Serum, Dimethylsulfoxide (DMSO), L - Glutamine, Sodium pyruvate, Penicilline - Streptomycine, Amphotericin, Trypsin, Trypan blue, Hepes free acid, NaHCO3, PBS Ca2+, Mg2+ free, HCl 1N, NaOH 1N… 3.3. PHƯƠNG PHÁP NGHIÊN CỨU 3.3.1. Phương pháp lấy mẫu, bảo quản, vận chuyển bệnh phẩm phát hiện virus LMLM Mẫu bệnh phẩm để phát hiện bệnh và định type virus là các mẫu biểu mô, nơi có bệnh tích ở lợi, lưỡi, mép, chân, vú … ; dịch mụn nước lấy từ các mụn nước chưa vỡ ở các tổ chức trên. Cách lấy: - Dùng panh, kéo cắt vùng có bệnh tích mới vỡ, lấy phần biểu mô. Lượng biểu mô lấy ít nhất là 2 g cho vào lọ có dung dịch bảo quản. - Nếu mụn nước chưa vỡ có thể dùng bơm tiêm 5 ml hút dịch bên trong cho vào lọ đựng bệnh phẩm sạch (không có dung dịch bảo quản), lấy ít nhất 2ml dịch mụn nước. Bảo quản: - Mẫu tổ chức biểu mô sau khi lấy đựng trong lọ thuỷ tinh dày, có nút vặn kín với dung dịch bảo quản ít nhất là 20 ml. Phía ngoài lọ đựng bệnh phẩm phải ghi nhãn về chủ gia súc, loại gia súc, loại bệnh phẩm, nơi lấy mẫu... - Bên ngoài lọ đựng bệnh phẩm phải khử trùng. - Lọ mẫu bệnh phẩm sau khi lấy nếu chưa kịp gửi đến phòng xét nghiệm cần bảo quản ngay trong ngăn đá tủ lạnh hoặc tủ lạnh âm. Vận chuyển: Khi gửi mẫu cần quấn bông thấm nước quanh lọ để chống vỡ và cho vào 2 lượt túi nilon bên trong có phiếu gửi bệnh phẩm, buộc kín. Mẫu bệnh phẩm được để vào hộp giữ lạnh có đủ đá trong quá trình vận chuyển, đậy nắp, gắn nhãn bên ngoài, ghi rõ tên và địa chỉ nơi gửi và gửi nhanh đến phòng chẩn đoán xét nghiệm. Ghi phiếu gửi bệnh phẩm (cần có những thông tin sau): - Tên và địa chỉ nơi gửi - Tên và địa chỉ chủ gia súc - Số lượng, loài, và giống gia súc mắc bệnh trên tổng số - Bệnh phẩm: loại bệnh phẩm, ngày lấy mẫu, ngày gửi mẫu - Tuổi của đàn mắc bệnh - Ngày mắc bệnh, mức độ lây lan - Lịch sử bệnh: đã từng mắc bệnh hay đã tiêm phòng, loại vacxin… 3.3.2. Phương pháp nuôi cấy virus LMLM trên môi trường tế bào BHK21 3.3.2.1. Hồi phục tế bào BHK21 từ nguồn giống bảo quản ở tủ âm sâu - Giống tế bào BHK21 được giữ tại Bộ môn Virus, Trung tâm Chẩn đoán Thú y TƯ. - Các bước tiến hành hồi phục tế bào BHK21: + Bước 1: Giải đông: Lấy 1 ống tế bào ra khỏi tủ âm sâu (-800C), cho vào cốc nước sạch và để ở nhiệt độ phòng, quan sát đến khi ống tế bào chuyển màu và tan đông. + Bước 2: Cân bằng môi trường: Thêm 1ml môi trường đầy đủ (10% FCS) (đã làm ấm ở 37oC trước khi giải đông tế bào) vào ống tế bào. Nhẹ nhàng dùng pipette chuyển huyễn dịch tế bào sang ống ly tâm 15ml. + Bước 3: Ly tâm loại bỏ dung dịch bảo quản: Ly tâm 700 vòng/phút trong 5 phút, dùng pipette loại bỏ phần dung dịch ở trên (giữ lại cặn tế bào màu trắng). + Bước 4: Hoà tan trong môi trường nuôi cấy tế bào: Thêm vào ống 1-2 ml môi trường đầy đủ (10% FCS), sau đó nhẹ nhàng dùng pipette hoà tan tế bào. + Bước 5: Cấy tế bào vào chai nuôi (T25): Chuyển huyễn dịch trên sang chai nuôi cấy tế bào T25 ( đáy 25 cm2) đã có sẵn 4-5 ml môi trường đầy đủ (10% FCS). Ghi tên tế bào, ngày, giờ nuôi. + Bước 6: Theo dõi tế bào phát triển: Giữ ở 37oC, 5% CO2. Quan sát tế bào phát triển trên kính hiển vi đến khi đạt mật độ cần thiết. 3.3.2.2. Nuôi trên đĩa nhựa 6 giếng và 24 giếng + Loại bỏ môi trường cũ. Tráng chai bằng dung dịch PBS (-) hoặc bằng Trypsin: 0,1- 0,2 ml/cm2. + Cho 0,1 ml/cm2 trypsin vào chai, để từ 3-5 phút hoặc trong tủ ấm 37oC (nếu nhiệt độ thấp). + Sau khi tế bào bong ra bổ sung ngay từ 5-7 ml môi trường có chứa huyết thanh, vỗ vào thành chai. + Dùng pipette làm tan các tế bào, sau đó hút hết tế bào vào ống ly tâm 15ml và ly tâm ở 700 vòng/phút trong 5 phút. + Ly tâm xong, bỏ dịch nổi phía trên, lấy cặn tế bào. + Hoà tan cặn tế bào trong 2-3 ml môi trường đầy đủ, pipette để tách rời tế bào. + Bổ sung môi trường đầy đủ tới lượng cần thiết. Dùng pipette 10ml hút môi trường có chứa tế bào ở trên và cho vào các giếng của đĩa nuôi cấy được xếp theo bố trí thí nghiệm: 3ml/giếng (đối với đĩa 6 giếng), 1ml/giếng (đối với đĩa 24 giếng). + Ghi tên tế bào nuôi, ngày, giờ, nồng độ pha loãng… trên các đĩa. + Theo dõi tế bào phát triển: Giữ ở 37oC, 5% CO2. Quan sát sự phát triển của tế bào trên kính hiển vi đến khi đạt mật độ cần thiết. 3.3.2.3. Phân lập virus LMLM trên tế bào BHK21 Xử lý bệnh phẩm Mẫu bệnh phẩm là biểu mô của mụn nước được nghiền trong cối chày sứ với dung dịch PBS 0,04M tỷ lệ 1:10. Ly tâm huyễn dịch bệnh phẩm 2.000 vòng/10 phút. Lấy dịch nước trong ở trên, xử lý kháng sinh. Phân lập trên môi trường tế bào BHK21 Chuyển 1ml huyễn dịch bệnh phẩm đã được xử lý ở trên vào chai tế bào (T25) hoặc đĩa 6 giếng, 0,5ml/ giếng với đĩa 24 giếng. - Ủ ở nhiệt độ 37oC/60 phút, sau cho dung dịch MEM (Eagle’s) không có huyết thanh nuôi tiếp. - Theo dõi hàng ngày kiểm tra bệnh lý tế bào (CPE: Cytopathic Effect): theo dõi đến 96 giờ. Nếu xuất hiện CPE: dương tính Nếu sau 96 giờ không có CPE xuất hiện: âm tính (không có virus LMLM). 3.3.3. Phương pháp ELISA xác định type virus LMLM 3.3.3.1. Nguyên lý Kháng nguyên tương ứng sẽ được gắn với kháng thể đặc hiệu cho từng type virus đã được hấp phụ lên bề mặt các giếng của đĩa phản ứng, kháng thể tiếp theo sẽ gắn vào kháng nguyên. Mẫu kiểm tra có kháng nguyên tương ứng sẽ được gắn vào các lỗ của đĩa, mẫu kháng nguyên không tương ứng sẽ bị rửa trôi. Mẫu dương tính sẽ kết hợp với conjugate có gắn enzyme, phản ứng chuyển màu sẽ xảy ra khi có sự tham gia của chất xúc tác Substrate/Chromogen. 3.3.3.2. Tiến hành a. Sơ đồ đĩa Đĩa xét nghiệm gồm 96 lỗ, được đánh số hàng ngang theo thứ tự từ 1-12 và theo hàng dọc từ A-H (08 hàng). + Theo hàng dọc: đĩa được chia làm 2 phần từ A-D và từ E-H tương ứng từng hàng với các serotype O, A ,C , Asia 1. + Theo hàng ngang: Từ cột số 1- 4 là các đối chứng kháng nguyên (+) mạnh và các kháng nguyên (+) yếu. Sơ đồ đĩa phản ứng ELISA phát hiện kháng nguyên (+) mạnh (+) yếu Blank Mẫu 1 Mẫu 3 Mẫu 5 1 2 3 4 5 6 7 8 9 10 11 12 O A C Asia 1 O A C Asia 1 Mẫu 2 Mẫu 4 Mẫu 6 b. Sơ đồ xét nghiệm Phương pháp ELISA để phát hiện kháng nguyên virus LMLM được tiến hành theo sơ đồ sau: Hấp thụ kháng thể thỏ kháng virus LMLM của các serotype O, A, C, Asia1 được pha theo tỷ lệ 1:1000 với dung dịch gắn Carbonate/bicacbonate 50 µl/lỗ theo hàng tương ứng. ủ 40C qua đêm hoặc lắc 1 giờ ở 370C. Rửa 3 lần (dung dịch PBS 0,002 M) Thấm khô. Cho kháng nguyên đối chứng (+) của từng type virus O, A, C, Asia 1 và các huyễn dịch mẫu bệnh phẩm cần kiểm tra vào các hàng tương ứng đã gắn kháng thể thỏ. Lắc, ủ ở nhiệt độ 370C/1 giờ. Rửa 3 lần. Thấm khô. Cho kháng thể chuột lang kháng virus LMLM của từng serotype O, A, C, Asia1 vào các hàng tương ứng, 50 µl/ lỗ. Lắc, ủ ở nhiệt độ 370C/1 giờ. Rửa 3 lần. Thấm khô. Gắn Conjugate bằng dung dịch Buffer 1:200, cho 50 µl/ lỗ. Lắc, ủ ở nhiệt độ 370C/1 giờ. Rửa 3 lần. Thấm khô. Cho Substrate/Chromogen lượng 50 µl/lỗ tham gia phản ứng và cột BLANK. Để nhiệt độ phòng 15 phút trong hộp tối Dừng phản ứng, cho H2SO4 1,25 M 50 µl/lỗ tham gia phản ứng và cột BLANK. Đọc kết quả trên máy ELISA, kính lọc 492 nm. Các mẫu kiểm tra có OD > 0,1 được coi là dương tính. 3.3.4. Phương pháp Real-time PCR phát hiện virus LMLM 3.3.4.1. Nguyên lý của phản ứng Real-time PCR Kỹ thuật PCR (Polymerase Chain Reaction) được Kary Mullis và cộng sự phát minh ra vào năm 1985. Kỹ thuật này tiếp tục được hoàn thiện, phát triển thông qua sự phân lập và sản xuất thành công emzyme tổng hợp DNA chịu nhiệt từ vi khuẩn Thermus aquaticus và sự thiết kế thành công các máy chu kỳ nhiệt cho phép thay đổi nhanh chóng và chính xác nhiệt độ cho từng giai đoạn phản ứng. Kỹ thuật PCR cho phép khuếch đại một đoạn gene đặc hiệu. Trong PCR thông thường, sau 20 – 30 vòng có tới hàng triệu phân tử được copy từ một phân tử DNA (1 đoạn gene), có thể quan sát được trên màn hình máy tính sau từng chu kỳ. RT-PCR: Đối với virus LMLM, trước khi tiến hành PCR thông thường RNA của virus LMLM cần được chuyển thành cDNA nhờ enzyme Reverse Transcriptase. Phương pháp PCR như vậy được gọi là RT-PCR. RT-PCR được áp dụng rộng rãi trong chẩn đoán nhanh và định type virus LMLM. Phương pháp PCR đặc biệt có ý nghĩa trong chẩn đoán phân biệt bệnh LMLM và bệnh mụn nước do virus LMLM ở lợn. Nguyên lý của phản ứng PCR: Dựa vào đặc điểm sao chép DNA; DNA Polymease sử dụng các đoạn DNA mạch đơn làm khuôn mẫu để tổng hợp nên sợi DNA bổ sung, bắt đầu từ đầu 3’OH của chuỗi oligo nucleotide (mồi hay primer) Mồi là những đoạn DNA ngắn (thường có độ dài từ 6-30 nucleotide), có khả năng bắt cặp bổ sung với một đầu của DNA sợi khuôn. Sau đó enzyme DNA-Polymerase sẽ có chức năng kéo dài mồi để tạo thành sợi DNA mới. Tuy nhiên, để khuếch đại một trình tự DNA xác định thì ta phải có được thông tin về trình tự gene của nó đủ để tạo mồi chuyên biệt. Mỗi cặp mồi gồm có một mồi xuôi (forward primer) và một mồi ngược (reverse primer). Mồi càng dài khả năng tổng hợp mạch càng chính xác, mồi ngắn bắt cặp dễ nhưng kết quả kém chính xác. Phải tránh có sự bổ sung giữa hai mồi xuôi, ngược. Trong phản ứng PCR thì cả hai sợi DNA đều được làm khuôn cho quá trình tổng hợp nếu như mồi được cung cấp cho cả hai sợi. Các đoạn mồi sẽ bắt cặp với hai đầu của đoạn DNA cần nhân lên sao cho sự tổng hợp DNA mới được bắt đầu tại mỗi đoạn mồi và kéo dài về phía đoạn mồi nằm trên sợi bổ sung với nó. Như vậy sau mỗi một chu kỳ của phản ứng thì số bản sao DNA cần nhân lên tăng gấp đôi và điểm khởi đầu cho mồi bắt cặp lại xuất hiện trên mỗi sợi DNA mới được tổng hợp. Kết quả cuối cùng của phản ứng PCR sau n chu kỳ được tính theo lý thuyết là 2n bản sao của phân tử DNA mạch kép. 3.3.4.2. Tiến hành Giai đoạn tách chiết RNA bằng Kit Qiagen RNeasy. - Lắc mẫu bằng máy Vortex trong 5 giây, ly tâm nhanh xuống bằng máy Spindown. - Cho 600 µl dung dịch RLT đã có B-ME vào ống eppendorf 1,5 ml mới. Chuyển 200 µl mẫu vào trong ống này, lắc đều trên máy Vortex trong 15 giây, ly tâm nhanh bằng máy Spindown để tránh dịch mẫu đọng ở nắp ống. - Cho 400 µl cồn ETOH 100% (ethanol), lắc mạnh bằng Vortex trong 15 giây. Ly tâm mẫu đã bị dung giải trong 1 phút ở tốc độ ≥ 10.000 vòng/phút ở nhiệt độ phòng. - Chuyển tất cả dịch nổi chứa mẫu bị dung giải sang cột RNeasy Qiagen đã ghi sẵn ký hiệu mẫu. Ly tâm 15 giây ở tốc độ 10.000 vòng/phút ở nhiệt độ phòng. Kiểm tra dịch mẫu đã thấm qua cột lọc chưa. Lặp lại bước này cho đến khi toàn bộ mẫu đã qua cột lọc. - Bổ sung 700 µl dung dịch rửa 1 (RW1 buffer) vào cột RNeasy Qiagen, ly tâm trong 15 giây ở tốc độ ≥ 10.000 vòng/phút, thay ống thu mẫu mới (collection tube) vào cột lọc. - Cho 500 µl dung dịch RPE vào cột RNeasy và ly tâm trong 15 giây ở tốc độ ≥ 10.000 vòng/phút, thay ống thu mẫu mới vào cột lọc. - Lặp lại bước trên một lần nữa với dung dịch rửa RPE buffer. Sau lần rửa cuối cùng thay ống thu mẫu mới loại 2 ml vào cột lọc. - Ly tâm cột lọc trống không trong 2 phút ở tốc độ tối đa (12.000 vòng/phút), bỏ ống thu mẫu. - Đặt cột lọc vào ống eppendorf 1,5 ml mới đã được ghi sẵn ký hiệu mẫu. Cho 50 µl Rnase free H2O vào cột lọc. Chú ý không được chạm đầu pipette vào mặt thạch Silica trong cột lọc. Ủ ở nhiệt độ phòng trong ít nhất 1 phút. Tách RNA bằng cách ly tâm cột trong 1 phút ở 10.000 vòng/phút. Bỏ cột lọc RNeasy. Chuyển toàn bộ dung dịch RNA này sang một ống eppendorf 1,5 ml mới. - Bảo quản mẫu RNA thu được ở -200C đến khi sử dụng. Phương pháp real-time PCR: sử dụng primer của hãng Qiagen, Hàn Quốc chạy trên máy real-time PCR Smart Cycler. - Pha mẫu theo công thức pha áp dụng cho kit RT-PCR 1 bước của hãng Qiagen Nguyên liệu Thể tích (µl) H2O 10,5 5X Buffer 5,0 MgCl2 (25 mM) 1,2 dNTP 0,8 Enzyme mix 1,0 Primer forward (20 µM) 0,5 Primer reverse (20 µM) 0,5 Probe (6 µM) 0,5 Mẫu RNA 5,0 Tổng cộng 25,0 - Đưa hỗn dịch mẫu đã pha vào trong máy chạy Real- time PCR Smart Cycler đã được cài đặt các thông số của chu trình nhân gene: Chu trình nhân gene: Bước Chu kỳ Thời gian Nhiệt độ Bước phiên mã ngược 1 chu kỳ 15 phút 500C 2 phút 950C Bước biến tính 40 chu kỳ 10 giây 950C Bám của cặp mồi 50 giây 600C Cặp mồi của kit là: Cặp mồi Chuỗi (5 – 3)- FAM Prime forward AGATGCAGGARGACATGTCAA Prime reverse TTGTACCAGGGYTTGGCYT Probe AAACACGGACCCGACTTTAACCG - Đọc kết quả: + Mẫu dương tính: Khi 35 ≥ Ct ≥ 20. + Mẫu âm tính: Khi không có đường cong đồ thị đi lên. + Mẫu nghi ngờ: Khi 40 ≥ Ct > 35. 3.3.5. Xử lý số liệu Xử lý số liệu theo phương pháp thống kê sinh học, so sánh kết quả theo chương trình excel 2007 trên máy vi tính. PHẦN IV KẾT QUẢ VÀ THẢO LUẬN 4.1. CHẤT LƯỢNG MẪU BỆNH PHẨM NHẬN VÀ MẪU BỆNH PHẨM ĐI LẤY TẠI TRUNG TÂM CHẨN ĐOÁN THÚ Y TƯ Trong xét nghiệm và chẩn đoán, mẫu và mẫu bệnh phẩm là yếu tố đầu tiên quyết định đến tính chính xác của kết quả. Nếu mẫu bệnh phẩm không đạt yêu cầu xét nghiệm thì sẽ không thực hiện được xét nghiệm đó. Mẫu bệnh phẩm khi đến được phòng xét nghiệm thì phải qua ba công đoạn: Lấy mẫu, bảo quản mẫu và vận chuyển mẫu. Thực chất của quá trình này là lấy mẫu, bảo quản tạm thời, vận chuyển đến phòng xét nghiệm và bảo quản. Bảo quản cuối cùng là bảo quản để lưu mẫu. Ta có thể bảo quản ở tủ lạnh âm -200C hoặc -800C. Mẫu bảo quản này có thể dùng vào nhiều mục đích khác nhau. Lấy mẫu bệnh phẩm: mẫu bệnh phẩm nên được lấy từ những con vật đang trong giai đoạn nung bệnh hoặc đang phát bệnh, biểu hiện các triệu chứng lâm sàng rõ ràng như sốt cao, hình thành mụn loét ở miệng, lợi, nhai nhóp nhép, chảy nước dãi, sưng các kẽ móng chân, ăn uống, đi đứng khó khăn. Khi các mụn nước vỡ ra có dịch màu vàng nhạt, mụn nước vỡ đó tạo thành các vết loét. Các loại mẫu bệnh phẩm thường được lấy là biểu mô từ mụn nước chưa vỡ hoặc mới vỡ, dịch từ mụn nước chưa vỡ, máu, huyết thanh, sữa, dịch hầu họng. Khi lấy mẫu bệnh phẩm dùng trong chẩn đoán nói chung và chẩn đoán virus LMLM nói riêng, người lấy mẫu cần lưu ý tuyệt đối không dùng các loại dung dịch sát trùng vị trí lấy mẫu hoặc mẫu bệnh phẩm, nếu cần thiết chỉ nên dùng nước sinh lý để rửa. Sau khi lấy mẫu bệnh phẩm, cần phải bảo quản mẫu đúng phương pháp. Tùy từng loại bệnh phẩm mà cần hay không cần dung dịch bảo quản, khối lượng, thể tích mẫu bệnh phẩm là bao nhiêu. Đối với bệnh phẩm là dịch từ các mụn nước, máu, sữa thì không cần dung dịch bảo quản, dùng bơm tiêm vô trùng hút ít nhất 2 ml dịch mụn nước, sữa rồi cho vào lọ đựng mẫu vô trùng. Đối với bệnh phẩm là biểu mô, lấy ít nhất 2 g cho vào lọ có chứa 10 ml dung dịch bảo quản. Có thể cạo các tổn thương ở kẽ móng rồi bỏ vào lọ đựng mẫu có dung dịch bảo quản như trên. Nếu là dịch hầu họng thì lấy ít nhất 2 ml dịch rồi cho vào lọ thủy tinh 5ml có nút vặn chứa 2 ml dung dịch bảo quản. Nếu như chỉ còn thân thịt thì lấy hạch lâm ba trước vai, tuyến thượng thận, thận và tuyến giáp trạng rồi cũng cho vào dung dịch bảo quản mẫu. Sau khi cho mẫu vào trong lọ đựng mẫu, vặn chặt nắp nhôm. Mẫu bệnh phẩm sau khi lấy phải được để ngay vào hộp giữ lạnh có đủ đá trong quá trình vận chuyển. Trên mỗi lọ đựng mẫu bệnh phẩm phải được dán nhãn bên ngoài, ghi: - Tên và địa chỉ chủ gia súc. - Loài, giống gia súc mắc bệnh. - Bệnh phẩm: loại bệnh phẩm, ngày lấy mẫu, ngày gửi mẫu. Sau đó cho vào thùng đựng mẫu chuyên dụng có đá hoặc bảo ôn bên trong, gửi nhanh đến phòng chẩn đoán xét nghiệm. Bảng 4.1: Chất lượng mẫu bệnh phẩm LMLM trong 3 năm (2007-4.2009) Năm Mẫu bệnh phẩm nhận (mẫu) Mẫu bệnh phẩm đi lấy (mẫu) Tổng số (mẫu) Đạt Không đạt Đạt Không đạt 2007 69 15 47 0 131 2008 55 6 32 0 93 4.2009 14 0 9 0 23 Tổng 138 21 (15%) 88 0 247 Để đánh giá chất lượng mẫu bệnh phẩm dùng trong chẩn đoán bệnh LMLM, chúng tôi đã thống kê tình trạng mẫu bệnh phẩm được gửi đến và mẫu bệnh phẩm đi lấy của Trung tâm Chẩn đoán Thú y TƯ qua 3 năm, kết quả được trình bày ở bảng 4.1. Các mẫu bệnh phẩm không đạt yêu cầu xét nghiệm thường là: không đủ về trọng lượng hoặc thể tích cho xét nghiệm, bảo quản không đúng kỹ thuật làm chất lượng mẫu kém. Qua bảng 4.1 chúng tôi nhận thấy 100% mẫu bệnh phẩm do cán bộ Trung tâm Chẩn đoán Thú y TƯ đi lấy đạt yêu cầu xét nghiệm. Trong khi đó mẫu bệnh phẩm do các nơi khác gửi đến Trung tâm c._.

Các file đính kèm theo tài liệu này:

  • docCHTY09021.doc
Tài liệu liên quan