Đánh giá đa dạng di truyền và khả năng kết hợp của một số dòng ngô nếp tự phối

BỘ GIÁO DỤC VÀ ðÀO TẠO TRƯỜNG ðẠI HỌC NƠNG NGHIỆP HÀ NỘI ------------  ---------- ðÀO THU THẢO ðÁNH GIÁ ðA DẠNG DI TRUYỀN VÀ KHẢ NĂNG KẾT HỢP CỦA MỘT SỐ DỊNG NGƠ NẾP TỰ PHỐI LUẬN VĂN THẠC SĨ NƠNG NGHIỆP Chuyên ngành: TRỒNG TRỌT Mã số : 60.62.01 Người hướng dẫn khoa học: PGS.TS. VŨ VĂN LIẾT HÀ NỘI - 2010 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... i LỜI CAM ðOAN Tơi xin cam đoan những số liệu và kết quả nghiên cứu trong luận văn là trun

pdf87 trang | Chia sẻ: huyen82 | Ngày: 09/12/2013 | Lượt xem: 1511 | Lượt tải: 4download
Tóm tắt tài liệu Đánh giá đa dạng di truyền và khả năng kết hợp của một số dòng ngô nếp tự phối, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
g thực và chưa từng được sử dụng để bảo vệ một học vị nào. Mọi sự giúp đỡ việc hồn thành luận văn này đã được cảm ơn và các thơng tin trích dẫn trong luận văn đều được ghi rõ nguồn gốc. Hà Nội, tháng 9 năm 2010 Tác giả luận văn ðào Thu Thảo Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... ii LỜI CẢM ƠN Trong quá trình thực hiện đề tài tơi đã nhận được sự quan tâm, giúp đỡ nhiệt tình của các cá nhân, cơ quan, tổ chức trong và ngồi trường. Trước hết, tơi xin bày tỏ lịng biết ơn sâu sắc tới thầy giáo PGS.TS. Vũ Văn Liết bộ mơn Di Truyền – Chọn giống người đã tận tình hướng dẫn, chỉ bảo, giúp đỡ tạo điều kiện để tơi hồn thành luận văn này. Tơi cũng xin chân thành cảm ơn sự giúp đỡ tận tình của TS. Hà Viết Cường cùng các anh chị thuộc Trung Tâm Nghiên Cứu Bệnh Cây Nhiệt ðới đã giúp đỡ tơi trong suốt thời gian thực hiện luận văn này. Tơi xin chân thành cảm ơn các thầy cơ giáo trong khoa Nơng học, Viện ðào Tạo Sau ðại Học, Trường ðại Học Nơng Nghiệp Hà Nội. Tơi xin chân thành cảm ơn cán bộ Viện Nghiên cứu lúa - Trường ðại học Nơng nghiệp Hà Nội đã tạo điều kiện thuận lợi và giúp đỡ nhiệt tình trong quá trình thực hiện luận văn này. Cuối cùng, tơi xin chân thành cảm ơn tới bạn bè, gia đình đã giúp đỡ, động viên tơi trong suốt quá trình học tập và nghiên cứu. Hà Nội, ngày 15/09/2010 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... iii MỤC LỤC Lời cam đoan i Lời cảm ơn ii Mục lục iii Danh mục các chữ viết tắt v Danh mục bảng vi Danh mục đồ thị, biểu đồ viii 1 MỞ ðẦU 1 1.1 Tính cấp thiết của đề tài 1 1.2 Mục đích và yêu cầu 2 1.3 Ý nghĩa khoa học và thực tiễn của dề tài 2 2 TỔNG QUAN TÀI LIỆU 3 2.1 Tình hình sản xuất, sử dụng ngơ trên thế giới và ở Việt Nam 3 2.2 Nghiên cứu phát triển dịng tự phối ở ngơ. 8 2.3 Nghiên cứu đa dạng di truyền và khoảng cách di truyền trên cây ngơ 10 2.4 Một số chỉ thị phân tử ứng dụng trong nghiên cứu đa dạng di truyền ở thực vật 13 2.5 Một số thành tựu ứng dụng chỉ thị phân tử SSR trong chọn giống cây trồng 20 3 VẬT LIỆU, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 23 3.1 Vật liệu nghiên cứu 23 3.2 ðịa điểm và thời gian nghiên cứu 25 3.3 Nội dung nghiên cứu 26 4 KẾT QUẢ NGHIÊN CỨU 39 4.1 Kết quả đánh giá nguồn vật liệu bố mẹ bằng chỉ thị phân tử SSR 39 4.1.1 Tách chiết ADN và chọn lọc mồi đánh giá đa hình nguồn vật liệu. 39 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... iv 4.2 Kết quả điện di sản phẩm PCR- SSR trên gel agarose 3%. 40 4.3 Kết quả phân nhĩm di truyền theo chỉ thị phân tử của các dịng ngơ nếp thí nghiệm. 44 4.4 Kết quả đánh giá một số đặc điểm của dịng vật liệu bố mẹ 49 4.4.1 Thời gian sinh trưởng dịng vật liệu bố mẹ 49 4.4.2 Chiều cao cây và chiều cao đĩng bắp 51 4.4.3 Mức độ nhiễm sâu bệnh của dịng vật liệu bố mẹ 52 4.4.4 Khả năng chống đổ của dịng vật liệu bố mẹ 54 4.5 Năng suất và các yếu tố cấu thành năng suất của các dịng vật liệu bố mẹ. 55 4.6 Kết quả đánh giá một số đặc điểm của tổ hợp lai 58 4.6.1 Thời gian sinh trưởng của tổ hợp lai 58 4.6.2 ðộng thái tăng trưởng chiều cao cây của các THL. 60 4.6.3.ðộng thái tăng trưởng số lá của các THL. 61 4.6.4 Chiều cao cây, chiều cao đĩng bắp của các tổ hợp lai 62 4.6.5 Tỷ lệ sâu bệnh và khả năng chống đổ gãy của các tổ hợp lai. 63 4.7 Năng suất và các yếu tố cấu thành năng suất của các THL 65 4.8 Tương quan giữa khoảng cách di truyền và ưu thế lai của các THL về tính trạng năng suất lý thuyết và năng suất thực thu. 67 5 KẾT LUẬN VÀ ðỀ NGHỊ 70 5.1 Kết luận 70 5.2 ðề nghị 70 TÀI LIỆU THAM KHẢO 71 PHỤ LỤC 75 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... v DANH MỤC CÁC CHỮ VIẾT TẮT THL Tổ hợp lai TPTD Thụ phấn tự do Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... vi DANH MỤC BẢNG STT Tên bảng Trang 2.1 Diện tích, năng suất và sản lượng ngơ trên thế giới (2000 – 2008) 3 2.2 Diện tích, năng suất, sản lượng ngơ Việt Nam giai đoạn 1999-2008 5 3.1 Nguồn vật liệu ngơ sử dụng trong đánh giá đa dạng di truyền 23 3.2 Tên locus, nhĩm liên kết, trình tự, nhiệt độ bắt cặp và kích thước của 10 cặp mồi SSR được thể hiện dưới bảng sau : 25 3.3 Thành phần của một phản ứng PCR 28 4.1 Mức độ đa hình của các locus SSR. 43 4.2 Ma trận tương đồng của 26 dịng ngơ nếp thí nghiệm. 46 4.3.Khoảng cách di truyền của 26 dịng ngơ nếp thí nghiệm 47 4.4 Khoảng cách di truyền của 14 tổ hợp lai được chọn 48 4.5 Thời gian sinh trưởng của 26 dịng ngơ nếp trong điều kiện vụ Xuân 2010 tại Viện Nghiên cứu Lúa – Trường ðH Nơng Nghiệp Hà Nội 50 4.6 Chiều cao cuối cùng, chiều cao đĩng bắp của 26 dịng ngơ nếp trong điều kiện vụ Xuân 2010 tại Viện Nghiên cứu Lúa – Trường ðH Nơng Nghiệp Hà Nội 51 4.7 Tỷ lệ sâu đục thân hại ngơ của 26 dịng ngơ nếp trong điều kiện vụ Xuân 2010 tại Viện Nghiên cứu Lúa – Trường ðH Nơng Nghiệp Hà Nội 53 4.8 Tỷ lệ sâu xám hại ngơ của dịng vật liệu bố mẹ trong điều kiện vụ Xuân 2010 tại Viện Nghiên cứu Lúa – Trường ðH Nơng Nghiệp Hà Nội 54 4.9 Tỷ lệ cây đổ gãy của dịng vật liệu bố mẹ trong điều kiện vụ Xuân 2010 tại Viện Nghiên cứu Lúa – Trường ðH Nơng Nghiệp Hà Nội 55 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... vii 4.10 Các yếu tố cấu thành năng suất của dịng vật liệu bố mẹ trong điều kiện vụ xuân 2010. 57 4.11 Năng suất lý thuyết và năng suất thực thu của dịng vật liệu bố mẹ trong điều kiện vụ xuân 2010. 58 4.12 Thời gian sinh trưởng của các THL trong thí nghiệm vụ xuân 2010. 59 4.13 Chiều cao cây, chiều cao đĩng bắp của các tổ hợp lai ngơ nếp ở vụ Xuân năm 2010 62 4.14 Tỷ lệ sâu đục thân và sâu xám của 14 tổ hợp lai ngơ nếp ở vụ Xuân năm 2010 63 4.15 Tỷ lệ cây đổ gãy của 14 tổ hợp lai ngơ nếp ở vụ Xuân năm 2010 64 4.16 Các yếu tố cấu thành năng suất của các THL trong thí nghiệm vụ Xuân 2010 65 4.17 Năng suất lý thuyết và năng suất thực thu của các THL trong thí nghiệm vụ Xuân 2010 66 4.18 Tương quan giữa khoảng cách di truyền và ưu thế lai của các tổ hợp lai về tính trạng năng suất lý thuyết trong thí nghiệm vụ Xuân 2010 68 4.19 Tương quan giữa khoảng cách di truyền và ưu thế lai của các tổ hợp lai về tính trạng năng suất thực thu trong thí nghiệm vụ Xuân 2010 69 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... viii DANH MỤC ðỒ THỊ, BIỂU ðỒ STT Tên đồ thị Trang 4.1 DNA tổng số của các giống thí nghiệm 39 4.2.1 Cặp 1: xp-umc1354 theo thứ tự từ giếng 1-26 40 4.2.2 Cặp 2: xp-umc1824 theo thứ tự từ giếng 1-26 40 4.2.3 Cặp 3: xp-umc1184 theo thứ tự từ giếng 1-26 40 4.2.4 Cặp 4 xp-umc2281 theo thứ tự từ giếng 1-26 41 4.2.5 Cặp 5 xp-umc1325 theo thứ tự từ giếng 1-26 41 4.2.6 Cặp 6 xp-umc1186 theo thứ tự từ giếng 1-26 41 4.2.7 Cặp 7 xp-mmc 0411 theo thứ tự từ giếng 1-26 42 4.2.8 Cặp 8 xp-umc1984 theo thứ tự từ giếng 1-26 42 4.2.9 Cặp 9 xp-umc1586 theo thứ tự từ giếng 1-26 42 4.2.10 Cặp 10 xp-umc1154 theo thứ tự từ giếng 1-26 43 4.3 Sơ đồ phân nhĩm di truyền theo chỉ thị phân tử của 26 dịng ngơ nếp 45 4.4 ðộng thái tăng trưởng chiều cao cây của các THL ngơ nếp ở vụ Xuân năm 2010 60 4.5 ðộng thái tăng trưởng số lá của các THL ngơ nếp ở vụ Xuân năm 2010 61 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 1 1. MỞ ðẦU 1.1. Tính cấp thiết của đề tài Nhu cầu sản xuất giống ngơ nếp lai đang trở thành cấp thiết đối với nơng dân ở nhiều vùng vì sản xuất ngơ nếp mang lại nhiều lợi nhuận, dễ tiêu thụ, tận dụng sản phẩm thân lá dùng làm thức ăn cho trâu bị, cá. Cung cấp nguyên liệu cho ngành cơng nghiệp chế biến lương thực - thực phẩm - dược phẩm và cơng nghiệp nhẹ, đặc biệt là là nguyên liệu lý tưởng cho năng lượng sinh học, là mặt hàng nơng sản xuất khẩu cĩ giá trị, mang lại nhiều ngoại tệ. Với những đĩng gĩp và lợi ích của cây ngơ mang lại cho con người, do vậy cây ngơ được chọn làm đối tượng đầu tư nghiên cứu khá tồn diện, đặc biệt về di truyền và chọn tạo giống.[1] Trong những năm gần đây, vật liệu dịng ngơ nếp đang được nhiều Viện, trường đại học thu thập và nhiều cơng ty đang tham gia chọn tạo nhưng tỷ lệ thành cơng vẫn thấp. Một trong những lý do là tập đồn giống thì phong phú nhưng cơng tác phân nhĩm khoảng cách di truyền những dịng cĩ những đặc tính nơng sinh học tốt, năng suất cao và đánh giá chất lượng chưa thành hệ thống. Hiện nay cùng với sự phát triển của khoa học kỹ thuật, đặc biệt là việc ứng dụng cơng nghệ sinh học trong nơng nghiệp đã đem lại nhiều thành tựu to lớn. Việc nghiên cứu ứng dụng cơng nghệ sinh học trong chọn tạo giống ngơ ưu thế lai đã được nhiều nhà khoa học quan tâm. Trong đĩ việc sử dụng chỉ thị phân tử đã trở thành cơng cụ mạnh mẽ để phân tích đa dạng di truyền và xác định mối quan hệ giữa các dịng ngơ như AFLP ( Amplified Fragment Length Polymorphism), RAPD (Randomly Amplified Polymorphic DNA), RFLP (Restriction Fragment Length Polymorphism)… Trong đĩ, chỉ thị SSR ( Microsatellites) được sử dụng như là một cơng cụ phân nhĩm khoảng cách di truyền khá hữu hiệu với nhiều ưu điểm như dự đốn ưu thế lai, giảm chi Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 2 phí và cơng sức lai tạo tổ hợp lai. Với những lý do như vậy chúng tơi tiến hành thực hiện đề tài : “ðánh giá đa dạng di truyền và khả năng kết hợp của một số dịng ngơ nếp tự phối” 1.2. Mục đích và yêu cầu 1.2.1. Mục đích ðánh giá đa dạng di truyền các dịng ngơ nếp tự phối bằng maker phân tủ nhằm xác định quan hệ giữa khoảng cách di truyền và khả năng kết hợp của các dịng vật liệu phục vụ cơng tác phát triển dịng thuần và tạo giống ngơ ưu thế lai. 1.2.2. Yêu cầu - ðánh giá mức độ sai khác các dịng vật liệu dựa trên kiểu hình và marker phân tử - ðánh giá sinh trưởng, phát triển, khả năng chống chịu, năng suất của dịng bố mẹ. - ðánh giá sinh trưởng, phát triển, khả năng chống chịu, năng suất của các tổ hợp lai. - ðánh giá mối tương quan giữa khả năng phối hợp và khoảng cách di truyền của các dịng. 1.3. Ý nghĩa khoa học và thực tiễn của dề tài 1.3.1. Ý nghĩa khoa học - ðề tài đánh giá được đa dạng di truyền bằng maker phân tử, trên cơ sở phân tích ADN để xác định khoảng cách di truyền giữa các dịng ngơ nếp vật liệu từ đĩ đánh giá tương quan giữa khoảng cách di truyền và khả năng kết hợp của các dịng vật liệu và chọn ra tổ hợp lai cĩ ưu thế lai. - ðề tài cung cấp thơng tin định hướng cho các nhà nghiên cứu tham khảo. 1.3.2. Ý nghĩa thực tiễn: - Nghiên cứu của đề tài sẽ loại nhanh các dịng cùng nhĩm cĩ đặc tính nơng học kém đề xuất được một số tổ hợp lai cĩ khả năng kết hợp tốt sử dụng trong chọn tạo giống ngơ. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 3 2. TỔNG QUAN TÀI LIỆU 2.1. Tình hình sản xuất, sử dụng ngơ trên thế giới và ở Việt Nam 2.1.1. Tình hình sản xuất, sử dụng ngơ trên thế giới Cây ngơ được trồng ở tất cả các châu lục, thích nghi với tất cả các loại sinh thái khí hậu từ ơn đới, cận nhiệt đới đến nhiệt đới cao và nhiệt đới thấp.Với những ưu điểm nổi bật so với các loại cây trồng khác nên ngơ được gieo trồng rộng khắp thế giới với sản lượng cao nhất trong các cây lương thực chủ yếu. Nếu như đến cuối thế kỷ XX, so với lúa nước và lúa mỳ thì ngơ thua kém về cả diện tích lẫn tổng sản lượng thì bước sang thế kỷ XXI, sản lượng ngơ đã vươn lên đứng đầu. Nếu như sản lượng ngơ tồn thế giới năm 2000 là 592,3 triệu tấn thì năm 2008 Sản lượng tồn thế giới là trên 786,5 triệu tấn. Bảng 2.1 Diện tích, năng suất và sản lượng ngơ trên thế giới (2000 – 2008) Năm Diện tích (Triệu ha) Năng suất (Tạ/ha) Sản lượng (Triệu tấn) 2000 138,2 42,8 592,3 2001 139,1 44,8 614,5 2002 138,7 42,4 602,6 2003 142,3 43,1 637,4 2004 147,0 49,0 721,4 2005 147,2 47,2 694,4 2006 149,4 48,0 711,1 2007 160,2 49,0 790,9 2008 157 50,0 786,5 Nguồn faostat.fao Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 4 Mỹ luơn là nước đứng đầu về sản lượng trong các nước trồng ngơ với trung bình đạt 299,8 triệu tấn, chiếm hơn 40,8% sản lượng ngơ thế giới. Hiện nay, Mỹ cũng là nước cĩ diện tích trồng ngơ lớn nhất thế giới và hầu hết diện tích này đều trồng ngơ lai với năng suất đạt 92.86 tạ/ha.Và Mỹ cũng là nước xuất ngơ lớn nhất chiếm 60% Ngay sau Mỹ là Trung Quốc xếp thứ hai cả về diện tích lẫn sản lượng ngơ trên thế giới và là cường quốc ngơ lai số một Châu Á với 27 triệu ha trong đĩ cĩ tới 90% diện tích được trồng bằng ngơ lai đạt tổng sản lượng trung bình 145 triệu tấn. Năng suất ngơ bình quân của Trung Quốc đã tăng từ 1,5 tấn/ha năm 1950 lên 5,2 tấn/ha vào năm 2006- 2008. Xuất khẩu ngơ ở Trung Quốc đạt 10-15% ( 6 triệu tấn). ðiều này lại một lần nữa khẳng định giá trị của ngơ lai về mặt năng suất. Tiếp theo sau Mỹ và Trung Quốc lần lượt là các nước Achentina, Brazil, Ấn ðộ, Indonesia, Philippin, Việt Nam và Thái Lan .Kết quả trên cĩ được là nhờ ứng dụng khoa học kỹ thuật đặc biệt là cơng nghệ sinh học trong nơng nghiệp.[34] 2.1.2. Tình hình sản xuất, sử dụng ngơ ở Việt Nam Ở Việt Nam trong mấy năm gần đây cây ngơ phát triển rất mạnh mẽ cả về diện tích và năng suất. Trong thời gian từ 1990 đến 2002, tổng sản lượng ngơ Việt Nam đã tăng 4 lần, năng suất ngơ cả nước tăng gấp 2; ở nhiều vùng ngơ rộng lớn năng suất bình quân đã đạt từ 5 đến 7 tấn/ha vụ. So với các nước trên thế giới và trong khu vực, tổ chức Nơng Lương Thế giới (FAO), Trung tâm Ngơ Quốc tế (CIMMYT) đánh giá Chương trình nghiên cứu và phát triển ngơ lai Việt Nam cĩ tốc độ phát triển nhanh nhất thế giới. (10 năm gần đây, tăng trưởng ngơ bình quân hàng năm ở Việt Nam đã đạt 3,7% về diện tích, 5,5% về năng suất và 9,2% về sản lượng, trong khi tỷ lệ tương ứng trên thế giới là 0,7%; 2,4% và 3,1%). Thực hiện mục tiêu đưa tổng sản lượng ngơ cả nước đến năm 2000 lên 2,5 triệu tấn, 4 triệu tấn năm 2005 và 6 triệu tấn vào năm 2010 đây cũng là nhiệm vụ hết sức khĩ khăn đối với nền khoa học trong nước.[1] Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 5 Bảng 2.2.Diện tích, năng suất, sản lượng ngơ Việt Nam giai đoạn 1999-2008 Năm Diện tích (nghìn ha) Năng suất (tấn/ha) Sản lượng (nghìn tấn) 1999 691,8 2,53 1753,1 2000 730,2 2,75 2005,9 2001 729,5 2,96 2161,7 2002 816,0 3,08 2511,2 2003 912,7 3,44 3136,3 2004 991,1 3,46 3430,9 2005 1052,6 3,60 3787,1 2006 1033,1 3,73 3854,6 2007 1096,1 3,93 4303,2 Sơ bộ 2008 1125,9 4,02 4531,2 Nguồn tổng cục thống kê, 2009 ðể cĩ được những thành tựu trên, Việt Nam đã cĩ những thành tựu trong nghiên cứu chọn tạo những dịng ngơ cho ưu thế lai cao. Việt Nam đã tiếp cận ngơ lai từ những năm 1960 đã cĩ những nghiên cứu về chọn tạo và sử dụng giống ngơ lai nhưng do vật liệu khởi đầu cịn nghèo, cơ sở vật chất chưa đáp ứng được yêu cầu của quá trình sản xuất ngơ giống, mãi đến năm 1990 ngơ lai mới phát huy được vai trị của nĩ. Từ diện tích 5 ha trồng thử nghiệm năm 1990 tăng lên 230.000 ha năm 1996 chiếm 46% diện tích ngơ cả nước và đến năm 2003 diện tích cả nước đạt 909.800 ha. sản xuất ngơ lai ở nước ta đã cĩ bước phát triển , với năng suất bình quân từ 25,5 tạ/ha lên 32,2 tạ/ha (đạt trên 2,9 triệu tấn năm 2003).[4] Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 6 Một số giống ngơ lai năng suất cao đã được chọn tạo ở nhiều tỉnh thành trong cả nước, ở ðắc Lắc với giống ngơ lai DK 9955 trồng thử nghiệm trên diện tích 2 sào, đến nay đã cho thu hoạch với năng suất đạt 1,2 tấn/sào, với mức giá ngơ hiện tại 5.200 đồng/kg thì chỉ trên diện tích 2 sào đã cho tổng thu gần 15 triệu đồng, sau khi trừ chi phí khoảng 2,2 triệu đồng thì người trồng ngơ thu lãi hơn 10 triệu đồng (tương đương 50 triệu/ha). Tại Thanh Hố giống ngơ SSC 557 đã được Bộ NN-PTNT cơng nhận đưa vào sản xuất. Ngồi, Cty đã triển khai trồng ở ðoan Hùng - Phú Thọ năng suất đạt 2,95 tạ/sào Bắc Bộ (8 tấn/ha), trồng tại Bảo Thắng-Lào Cai năng suất đạt 8,44 tấn/ha, ngồi ra cịn trồng ở Sơn La, Lạng Sơn, Hà Giang, Yên Bái, Tuyên Quang và cả tỉnh Udomxay, Lào đều cho năng suất cao. Giống ngơ SSC 557 cĩ hạt đá, màu vàng cam, phơi hạt khơng bị hao như giống khác. Khi sắp thu hoạch hạt đã khơ nhưng lá vẫn cịn xanh, cĩ thể tận dụng lá làm thức ăn lý tưởng cho trâu, bị… Tại hội nghị đầu bờ, nghiệm thu kết quả giống ngơ lai mới LVN66 tại xã Thiệu Nguyên (Thiệu Hĩa, Thanh Hĩa) năng suất giống LVN66 tại các tỉnh ðồng Nai, ðăk Lăk, Hà Nội, Hịa Bình… cĩ lúc đạt 97,79 tạ/ha/vụ. Cán bộ và nơng dân ở những địa phương này cũng cĩ những đánh giá rất tốt về LVN66 và hi vọng giống ngơ mới sẽ đem đến những bước đột phá về năng suất và sản lượng, đặc biệt là những vùng đất cĩ điều kiện khĩ khăn. Tại Kim Bơi – Hịa Bình, giống ngơ lai đơn ngắn ngày năng suất cao LVN 25.Ưu điểm nổi bật của giống ngơ này là mặc dù hạn hán nhưng cây vẫn sinh trưởng tốt, cho năng xuất cao hơn hẳn các giống ngơ khác. Chúng tơi khuyến cáo bà con nên đưa giống ngơ này vào sản xuất các vụ trong năm. Ngồi ra cịn rất nhiều các giống ngơ khác như LVN154, LVN61, C919... hiện nay cho năng suất cao chống chịu được với nhiều điều kiện bất thuận của khí hậu.[35], Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 7 Với những thành tựu về ngơ lai trong thời gian qua đã đưa năng suất và sản lượng ngơ của nước ta đạt được những thành tựu to lớn. Tuy hiện nay cây lúa vẫn đang giữ vị trí đứng đầu về sản lượng cũng như tầm quan trọng nhưng với khả năng phát triển trong tương lai, cây ngơ đã từng bước tự chứng tỏ được mình. Mục tiêu quan trọng đối với cây ngơ trong thời gian tới là đáp ứng đủ cho nhu cầu trong nước, giảm nhập khẩu và tiến tới xuất khẩu thu ngoại tệ. Tuy nhiên, để đạt được mục tiêu đĩ cần đưa ra các giải pháp lớn mang tính đột phá của các cấp quản lý, đồng thời cũng cần cĩ sự phối hợp đồng bộ giữa các ban ngành, doanh nghiệp và hộ nơng dân trực tiếp liên quan. Bên cạch những thành tựu đã đạt được, nền nơng nghiệp nĩi chung và sản xuất ngơ nĩi riêng đang phải đối mặt với sự cạnh tranh hùng hậu của các cơng ty nước ngồi, trong cơ chế thị trường, nhiều mâu thuẫn, thách thức lớn đặt ra cho các nhà nghiên cứu và phát triển ngơ nước nhà, cĩ thể thấy trên các mặt: nhiều cơng ty kinh doanh ngơ giống nước ngồi vào ào ạt, đã nắm gần như tồn bộ thị trường ngơ lai nước ta với những lợi thế: tiềm lực khoa học cơng nghệ , nguồn tài chính lớn và nghệ thuật kinh doanh trên thị trường. ðứng trước thực tế đĩ ngành nơng nghiệp nĩi chung và sản xuất ngơ nĩi riêng phải phải nhanh chĩng tạo ra được những giống ngơ lai cĩ năng suất cao, chất lượng tốt và quan trọng là phù hợp với điều kiện sinh thái Việt Nam, cĩ được hệ thống sản xuất hạt giống chất lượng tốt. Và vấn đề về chế biến bảo quản sản phẩm sau thu hoạch cần cĩ hệ thống làm khơ, chế biến, đĩng gĩi cơng nghiệp để đảm bảo chất lượng ngang tầm hạt giống của các cơng ty nước ngồi. Và phải cĩ chiến lược để giành lại thị trường dựa vào tiêu chí chất lượng cao, giá thành hạ. [34] Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 8 2.2. Nghiên cứu phát triển dịng tự phối ở ngơ. Ưu thế lai ở ngơ thể hiện rất rõ khi lai giữa các giống và khi lai giữa các dịng tự phối thuần. Kết quả nghiên cứu ở nhiều nước cho thấy trong điều kiện tương tự, ngơ lai giữa các giống tăng 10-20%, ngơ lai giữa các dịng tự phối thuần tăng 20-30% và hơn nữa so với các giống địa phương tốt nhất. Tuy nhiên việc nhận biết các dịng bố mẹ tự phối thuần trong tạo giống ưu thế lai là một giai đoạn cĩ giá trị nhất và tiêu tốn nhiều thời gian nhất trong phát triển giống ngơ ưu thế lai. Biểu hiện của các dịng ngơ tự phối thuần là khơng dự đốn được ưu thế lai về năng suất hạt (Hallauer and Miranda, 1988). Dự đốn được giá trị ưu thế lai đơn hoặc ưu thế lai giữa các dịng tự phối thuần bởi thế cĩ thể tăng hiệu quả của chương trình tạo gống. Mức độ ưu thế lai phụ thuộc vào sự biểu hiện của các dịng thuần bố mẹ, nhưng mơi trường cĩ ảnh huởng khác nhau đến ưu thế lai và các dịng bố mẹ chính là sự thay đổi mối quan hệ giữa khoảng cách di truyền và ưu thế lai. Ở vùng nhiệt đới hạn chế và thay đổi về khả năng cung cấp nước và dinh dưỡng tạo ra các mơi trường tương phản. Ảnh hưởng của các bất thuận phi sinh học đến khoảng cách di truyền để chuẩn đốn ưu thế lai cịn rất ít. Ưu thế lai cĩ thể coi là trạng thái dị hợp tối đa và nhận được dị hợp tối đa này khi lai giữa hai dịng tự phối khác nhau. Phát triển và sử dụng ưu thế lai khá phức tạp và trải qua các giai đoạn như sau: 1) Lựa chọn vật liệu cho dịng tự phối 2) Phát triển dịng tự phối 3) Thử khả năng phối hợp[19] Nghiên cứu tự phối tạo nguồn vật liệu cho tạo giống ngơ nếp lai đã được nhĩm nghiên cứu của Trường ðại học Nơng nghiệp I thực hiện và thực hiện tự phối trên 6 gièng ngơ nếp địa phương là N1 ( giống ngơ nếp nương) của người H’Mơng thu thập tại ðiện Biên, N7 ( giống ngơ nếp) của người Khơ Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 9 Mú ðiện Biên, N10 (pâu cừ lầu ) giống ngơ nếp của người H’Mơng thu tại ðiện Biên, N12 ( giống ngơ nếp) của người Tày thu tại Cao Bằang, N9 ( khẩu li ĩ) giống ngơ nếp của người Thái thu tại xã Nà Tấu huyện ðiện Biên và N24 (khẩu li ĩn lĩn) giống ngơ nếp khẩu li ĩn lĩn của người H’Mơng thu tại ðiện Biên. Ngơ nếp địa phương trong quá trình tự phối tạo dịng thuần bị suy giảm mạnh về sức sống và các tính trạng số lượng như chiều cao cây, chiều dài bắp, khối lượng hạt, khả năng chống chịu sâu bệnh, năng suất và các yếu tố tạo thành năng suất. Kết quả phù hợp với những nghiên cứu trong nước và thế giới trước đây (Vasal,1997) Các giống ngơ nếp khác nhau mức độ suy giảm khác nhau trong 6 giống suy giảm mạnh trên tất cả các tính trạng là N7 ( ngơ nếp) của người Khơ Mú, N10 ( pâu cừ lầu) ngơ nếp của người H’Mơng và N24 ( Khẩu li ĩn lĩn) ngơ nếp của người H’Mơng. Như vậy khi tự phối ngồi lựa chọn bố mẹ cho tự phối cĩ sự sai khác di truyền cần lựa chọn những giống cĩ mức độ suy giảm thấp. Các tính trạng cĩ mức suy giảm khác nhau suy giảm mạnh nhất là khối lượng hạt, đến khả năng chống chịu, chiều cao cây, khối lượng bắp. Những tính trạng cĩ mức suy giảm mạnh cũng là những tính trạng cĩ mức phân ly cao. Do vậy khi tiến hành tự phối các giống ngơ nếp địa phương cần quan tâm đến kỹ thuật canh tác, phân bĩn và phịng trừ sâu bệnh để thu được số lượng dịng thuần lớn khi tự phối. [8] Ưu thế lai cĩ thể ảnh hưởng bởi mơi trường khác nhau đến dịng bố mẹ và con lai. Khi nghiên cứu về 17 dịng ngơ tự phối nhiệt đới, ưu thế lai cao hơn dưới điều kiện hạn và nhỏ hơn dưới điều kiện mức đạm thấp và điều kiện khơng bất thuận. Sự ảnh hưởng của các yếu tố bất thuận, phi sinh học như thế nào đến biểu hiện ưu thế lai. Mức độ thuần của các dịng bố mẹ cĩ thể ảnh hưởng đối với điều kiện bất thuận và sau đĩ là ưu thế lai. Bởi vậy các dịng với mức độ thuần khác nhau nên thử dưới cả điều kiện mơi trường bất thuận và thuận lợi để ước lượng ưu thế lai[12] Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 10 2.3. Nghiên cứu đa dạng di truyền và khoảng cách di truyền trên cây ngơ Phân tích quan hệ di truyền ở các lồi cây trồng là một phần quan trọng trong chương trình cải tiến giống cây trồng, nĩ cung cấp thơng tin về đa dạng di truyền và là cơ sở để phân nhĩm quần thể tạo giống. Phân nhĩm quan hệ di truyền cĩ ý nghĩa vơ cùng quan trọng trong chọn tạo giống cây trồng bao gồm:phân tích biến dị di truyền trong chọn giống, nhận biết đa dạng của bố mẹ để tạo ra con lai cĩ hệ số biến dị di truyền tối đa là cơ hội chọn lọc tạo giống thành cơng hơn, chuyển được gen mong muốn từ nguồn gen đa dạng vào nguồn gen cơ bản đặc biệt là các dịng tự phối, dịng thuần, hỗ trợ phân loại các mẫu nguồn grn thu thập để sử dụng cho mục tiêu tạo giống đặc thù. Phân tích đa dạng di truyền là quá trình phân tích biến động giữa các cá thể hoặc quần thể được phân tích bằng các phương pháp đặc thù hoặc phối hợp các phương pháp. Số liệu thường bao gồm một số lớn các số liệu đo đếm và trong trong nhiều trường hợp là phối hợp của các loại số liệu. Bộ số liệu đa dạng của các nhà nghiên cứu sử dụng để xử lý phân tích đa dạng di truyền trong cây trồng quan trọng nhất là bộ số liệu phả hệ. Số liệu hình thái, số liệu sinh hĩa và gần đây là những số liệu của chỉ thị phân tử cho biết sự khác nhau về kiểu gen một cách đáng tin cậy.[15] ðể nghiên cứu mức độ đa dạng di truyền người ta thường dựa vào 3 cơng thức tính hệ số tương đồng là: hệ số Jaccard (1908), hệ số Nei & Li (1979) hay cịn gọi là hệ số Dice (1945),hệ số SM (Sokal and Michener (1958) hay cịn gọi là hệ số phù hợp đơn giản SMC (simple matching coefficient). Phân tích đa dạng di truyền cĩ ý nghĩa lớn ở một số cây trồng như lúa mỳ (Triticum aestivum L.), lúa (Orzyza sativa L), lúa mạch (Hordeum vulgare L), và đậu tương (Glycine max L) [10]. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 11 Phân tích đa dạng di truyền nhằm xác định mối quan hệ giữa khoảng cách di truyền và ưu thế lai đã được nghiên cứu bằng marker di truyền trước đây (Moll et al 1965). Cấu trúc bản đồ liên kết di truyền bằng marker DNA đã cĩ đối với cây ngơ (Coe et al., 1995).. Các marker DNA phân tử đã được sử dụng phân tích quan hệ di truyền giữa các dịng ngơ và xác định mối quan hệ giữa cơ sở marker DNA khoảng cách di truyền và năng suất hạt lai đơn của ngơ vùng ơn đới (Stuber, 1989; Lee et al., 1989; Smith et al., 1990; Godshalk et al., 1990; Boppenmeier et al., 1992; Melchinger, 1993).[25] Một số bằng chứng chỉ ra rằng ngơ được thuần hĩa từ lồi cỏ mexican hoang dại teosinte ( Zea mays ssp. Parviglumis hoặc ssp mexicana) Những bằng chứng khảo cổ học chứng minh rằng thời gian thuần hĩa ngơ vào khoảng 5000 đến 10.000 năm trước đây. Những năm 1940 Anderson and Cutler đã nhận thấy mức độ quan trọng của đa dạng di truyền ở ngơ. Cơ sở này được chứng minh trên băng di truyền phân tử và chúng đã cung cấp nguồn gen để tạo giống ngơ ưu thế lai hiện nay và hầu hết các khu vực trên thế giới.Một số lượng lớn khi lai các dịng hoặc các giống khác nhau về di truyền đã cho sức sống ưu thế lai và ưu thế lai ở thế hệ F1. Con lai F1 cĩ sức sống và năng suất cao hơn bố mẹ của chúng. F. J. Betrán*,a, J. M. Ribautb, D. Beckb and D. Gonzalez de Leĩn, năm 2002 đã đánh giá đa dạng và khoảng cách di truyền giữa các dịng ngơ nhiệt đới (Zea mays L.) và tương quan giữa khoảng cách di truyền -genetic distance (GD) và ưu thế lai. Tương quan giữa khoảng cách di truyền và ưu thế lai- Correlation between Genetic Distance and Hybrid Performance: khoảng cách di truyền tương quan dương với F1, SCA, MPH, và HPH trong tất cả các mơi trường bao gồm tất cả giống ưu thế lai. Sau đĩ tương quan giữa khoảng cách di truyền và khả năng kết hợp riêng qua các mơi trường [r(SCA,GD)] giảm từ Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 12 0.64 đến 0.31, từ 0.53 đến 0.17 của r(GD,F1), từ 0.41 đến 0.14 của r(MPH,GD), và từ 0.28 đến 0.05 của r(HPH,GD). Kết quả tương tự cũng đã thấy ở ngơ ơn đới, khoảng cách di truyền tương quan với ưu thế lai của các dịng họ hàng hoặc các dịng cùng nhĩm ưu thế lai. Khoảng cách di truyền khơng tương quan với ưu thế lai khi lai giữa các dịng từ các nhĩm ưu thế lai khác nhau (Godshalk et al., 1990; Boppenmeier et al., 1992; Melchinger, 1993; Ajmone Marsan et al., 1998). Charcosset and Essioux (1994). [17] Sự biểu hiện khác nhau đĩ liên kết khơng ngang bằng giữa các markers và quần thể lai giữa các nhĩm ưu thế lai cĩ thể giải thích sự thiếu sự tương quan Bernardo (1992) Kết luận rằng ít nhất 30 đến 50% quần thể lai ảnh hưởng tính trạng (như là năng suất hạt) cho nên liên kết với DNA markers cĩ hiệu quả để dự đốn ưu thế lai với DNA marker dị hợp. Loại trừ P1, các dịng khoảng cách lớn nhất tăng tương quan giữa khoảng cách di truyền với F1 và SCA . Tương quan giữa khoảng cách di truyền GD và khả năng kết hợp riêng SCA tăng từ 0.31 đến 0.45 , giữa khoảng cách di truyền và F1 từ 0.17 đến 0.38. Moll et al. (1965) cũng tìm thấy ưu thế lai giảm khi đa dạng quá mức. Nhìn chung sự dự đốn ưu thế lai tốt hơn khi khoảng cách di truyền nhỏ hơn ở một ngưỡng nào đĩ phụ thuộc vào ngồn gen. Khả năng kết hợp được biểu hiện bằng giá trị trung bình của ưu thế lai, quan sát ở tất cả các cặp lai, và độ chênh lệch so với giá trị trung bình đĩ của một cặp lai cụ thể nào đĩ. Giá trị trung bình biểu thị khả năng kết hợp chung (General combining ability- SCA) cịn độ chênh lệch biểu thị khả năng kết hợp riêng (Specific combining ability – SCA). Sprague (1957) cho rằng đánh giá dịng về khả kết hợp thực chất là xác định tác động của gen. Sprague và Tatum chia tác động gen lien quan đến khả năng kết hợp thành hai loại: Khả năng kết hợp chung được xác định bởi yếu tố di truyền cộng, cịn khả năng kết hợp riêng được xác định bởi yếu tố di truyền cộng, cịn khả năng kết hợp Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 13 riêng được xác định bởi yếu tố ức chế, tính trội, siêu trội và điều kiện mơi trường. [24] Khi nghiên cứu về 17 dịng ngơ trắng nhiệt đới. Tương quan được tìm thấy giữa khoảng cách di truyền và khả năng kết hợp riêng, ưu thế lai trung bình (MPH) và ưu thế lai thực (HPH) khả năng phối hợp riêng tương quan chặt với khoảng cách di truyền và tương quan chặt hơn khi điều kiện bất thuận. Max A. Glover, David B. Willmot, Larry L. Darrah,* Bruce E. Hibbard, and Xiaoyang Zhu, 2005, Phân tích Diallel các tính trạng nơng học sử dụng nguồn gen ngơ của Mỹ và Trung Quốc cho kết quả đa dạng di truyền hiệu ứng cộng giữa các ngơ thương mại (Zea mays L.) cĩ thể cho ưu thế la._.i năng suất cao hơn hơn và giảm bớt sự dễ tổn thương di truyền.[21] 2.4. Một số chỉ thị phân tử ứng dụng trong nghiên cứu đa dạng di truyền ở thực vật 2.4.1. Chỉ thị phân tử AFLP ( Amplified Fragment Length Polymorphism) Kỹ thuật AFLP (amplified fragment length polymorphism) được sử dụng lần đầu tiên bởi Vos et al. vào năm 1995 và hiện nay là một trong các kỹ thuật sinh học phân tử được sử dụng nhiều nhất trong nghiên cứu đa dạng thực vật, nấm và vi khuẩn. ðiều thú vị là mặc dù AFLP là một trong số các kỹ thuật hiệu quả nhất trong nghiên cứu DNA fingerprinting thì số lượng các nghiên cứu tương tự dùng kỹ thuật này trên động vật lại ít hơn rất nhiều so với trên thực vật và vi sinh vật. AFLP là kỹ thuật kết hợp ưu điểm của RFLP (RE trên tồn bộ bộ gen) và PCR. ðặc điểm quan trọng nhất của AFLP là khả năng đánh giá mức độ đa hình trên tồn bộ bộ gen hay nĩi cách khác là kiểm tra đồng thời một cách ngẫu nhiên các sản phẩm từ nhiều locus trên. ưu điểm: Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 14 − ðộ tin cậy và khả năng lặp lại cao − Khơng cần biết trước về thơng tin genome của đối tượng nghiên cứu. − Rất giàu thơng tin vì cĩ thể đánh giá đồng thời nhiều locus (cĩ nghĩa cĩ khả năng đánh giá đa hình trên tồn bộ bộ gen) với chỉ một cặp mồi và trên một lần chạy điện di (lợi thế quan trọng nhất so với RFLP, RAPD và microsatellite + các kỹ thuật tương tự) − Các sản phẩm cùng kích thước phần lớn là cùng nguồn (homology) và đặc hiệu locus (trừ ngoại lệ là các lồi đa bội) nhược điểm − Yêu cầu nhiều bước để thực hiện − Giống như đối với kỹ thuật RFLP, chất lượng DNA yêu cầu cao (vì bước đầu tiên sau khi chiết DNA là cắt bằng RE). − Phát hiện sản phẩm bằng điện di polyacrylamide ( nhuộm AgNO3 hoặc đánh dấu bức xạ hoặc đánh dấu huỳnh quang) hoặc điện di bằng sequencer vì vậy chi phí đắt và tốn lao động hơn − ðắt hơn vì phải thêm chi phí RE và adapter. − Giống như đối với RAPD, phần lớn các locus AFLP là trội nên khơng phân biệt được cá thể đồng hợp tử trội với cá thể dị hợp tử. ðiều này làm giảm tính sát thực trong phân tích di truyền quần thể, lập bản đồ di truyền và chọn lọc bằng marker phân tử đối với các lồi giao phối bắt buộc.[20] 2.4.2. Chỉ thị phân tử RAPD (Randomly Amplified Polymorphic DNA) Chỉ thị RAPD (random amplified polymorphic DNA) là kỹ thật dựa trên PCR, sử dụng một mồi tùy ý để nhân DNA với sản phẩm nhìn chung cĩ kích thước < 3000 bp. RAPD Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 15 thường dùng 1 mồi cĩ kích thước khoảng 10 bp cĩ nhiệt độ gắn mồi Ta thấp (34 – 37 OC). Mặc dù trình tự mồi là tùy ý nhưng cần đảm bảo 2 chỉ tiêu cơ bản: hàm lượng GC tối thiểu = 40% (thơng thường 50 – 80 %) và phải khơng chứa các chuỗi đối song (palindromic) Phần lớn các đoạn RAPD hình thành từ một locus nên 2 loại đa hình sẽ xuất hiện: (1) cĩ hay khơng cĩ băng và (2) độ đậm của băng. Vì độ đậm của băng cĩ thể hình thành từ số copy hoặc số lượng của khuơn nên dựa theo độ đậm, người ta cĩ thể phân biệt được cá thể trội đồng hợp tử với cá thể dị hợp tử. Tuy nhiên điều này khơng luơn luơn đúng vì độ đậm của băng cịn phụ thuộc vào mức độ mismatch tại vị trí gắn mồi; do vậy nhiều tác giả khơng tính mức độ đậm nhạt của băng. Nhược điểm: − Tính lặp lại thấp. Do kỹ thuật dựa vào PCR nên nhiều yếu tố cĩ thể ảnh hưởng đến kết quả RADP: chất lượng và số lượng khuơn DNA, nồng độ MgCl2, Ta, nguồn Taq, nguồn máy PCR. Hậu quả là RADP cĩ thể cho các dấu hiệu (+) giả hoặc (-) giả. − Di truyền trội. Do các marker RAPD là marker của các allele trội nên khơng thể phân biệt được các các cá thể đồng hợp tử trội và các cá thể dị hợp tử. − Tính cùng nguồn (homology) đơi khi khơng rõ. Do kết quả được thường được đánh giá dựa trên điện di agarose nên các nhược điểm của điện di agarose cũng cần tính đến. Chẳng hạn, nhìn chung, các băng DNA di chuyển cùng mức trên gel agarose thường được xem là cùng locus. Tuy nhiên, nhiều nghiên cứu cho thấy ở các lồi đa bội, các băng giống nhau cĩ thể khác locus. Nhược điểm này cĩ thể được khăc phục bằng điện di polyacrylamide (cĩ mức độ phân biệt cao hơn).[6] Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 16 2.4.3. Chỉ thị phân tử RFLP (Restriction Fragment Length Polymorphism)… RFLP (Restriction fragment length polymorphism) là kỹ thuật được sử dụng lần đầu tiên vào năm 1975 để xác định đa hình DNA nhằm lập bản đồ di truyền của một đột biến mẫn cảm nhiệt độ của các serotype của adenovirus. Kỹ thuật dựa trên việc cắt bằng RE tồn bộ bộ gen của vi sinh vât. Mặc dù 2 cá thể cùng lồi nhìn chung cĩ bộ gen đồng nhất thì chúng vẫn khác nhau một số nucleotide do các nguyên nhân sau: đột biến điểm, thêm/mất, chuyển vị trí, đảo vị trí và lặp (duplication) nucleotide. Hậu quả là sản phẩm cắt DNA sẽ cĩ số lượng và kích thước thay đổi. Qui trình RFLP nhìn chung gồm các bước sau: − Cắt DNA mẫu bằng 1 hoặc nhiều RE − Tách sản phẩm cắt bằng điện di agarose − Chuyển các sản phẩm đã tách từ gel agarose sang màng bằng Southern bloting. − Phát hiện các đoạn bằng lai DNA với dị (probe) thích hợp. − Hình ảnh hĩa (autoradiography) phụ thuộc nhãn dị (bức xạ hay huỳnh quang) Ưu điểm: - Khả năng lặp lại cao (giữa các phịng thí nghiệm) − Xác định được di truyền đồng trội − Marker cĩ tính đặc hiệu locus (nên trình tự bảo thủ của các gen của các sinh vật cĩ quan hệ gần gũi cĩ thể được xác định) − Khơng yêu cầu thơng tin chuỗi Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 17 − Dễ ghi điểm do kích thước các băng thường khác nhau đáng kể Nhược điểm: - Yêu cầu số lượng và chất lượng DNA cao - Việc xây dựng bộ dị khá phức tạp - Khơng thể tự động hĩa được (nên tốn cơng sức và chi phí) - Mức độ đa hình thấp, chỉ một số ít locus được nghiên cứu trong một lần thử - Tốn thời gian, lao động và đắt - Dị yêu cầu gán nhãn bức xạ nên độc hại (hiện nay thường gán nhãn huỳnh quang an tồn hơn nhưng đắt) [3] 2.4.4. Chỉ thị phân tử SSR (=Microsatellites) Bộ gen của vi sinh vật nhân thật chứa 3 loại chuỗi DNA lặp là DNA satellite, minisatellites và microsatellites. Các chuỗi lặp nằm theo hàng (tandem) và cĩ kích thước rất khác nhau. Trong số các chuỗi lặp đơn giản này, microsatellite là một marker di truyền quan trọng, thường được sử dụng trong nghiên cứu đa dạng. Microsatellite (cịn được gọi là các chuỗi lặp đơn giản = simple sequence repeats (SSRs), các chuỗi lặp liền kề ngắn = short tandem repeats (STRs) hay các đoạn đa hình chuỗi đơn giản = simple sequence length polymorphisms (SSLPs) là nhĩm các chuỗi DNA đơn giản lặp lại nhỏ nhất. Microsatellite là các chuỗi lặp, tùy theo tác giả, 1-5, 1-6 hoặc 2 - 8 nts. Các chuỗi lặp thường đơn giản, bao gồm 2, 3, 4 nucleotid (gọi là di-, tri-, and tetranucleotide repeats). Một ví dụ phổ biến của microsatellite là 1 dãy chuỗi lặp 2 dinucleotide (CA)n, trong đĩ n là tổng số chuỗi lặp nằm trong Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 18 phạm vi từ 10 – 100. Các marker này thường tạo ra mức đa hình cao trong nội bộ lồi và giữa các lồi, đặc biệt khi số chuỗi lặp n bằng 10 hoặc lớn hơn. Microsatelite là một trong các marker phân tử được sử dụng rộng rãi nhất vì nĩ cĩ một đặc điểm quan trọng là cĩ tốc độ đột biến cao hơn các phần khác của bộ gene.[18] 2.4.4.1. Phân loại microsatellite Các microsatellite được phân loại theo loại chuỗi lặp như sau: − Microsatellite hồn hảo: gồm các chuỗi lặp đều đặn chẳng hạn TATATATATATATATA. − Microsatellite khơng hồn hảo: cĩ một bp nằm xen giữa các chuỗi lặp (Vd TATATATACTATATA). − Microsatellite gián đoạn: cĩ các chuỗi nhỏ khác nằm bên trong (Vd TATATACGTGTATATATATA). − Microsatellite phức: gồm 2 chuỗi lặp khác nhau (Vd TATATATATAGTGTGTGT) 2.4.4.2.ðặc điểm di truyền của microsatellite Ở một locus microsatellite đồng hợp tử, số các chuỗi lặp giống nhau. Ở một locus microsatellite dị hợp tử, số các chuỗi lặp khác nhau (chẳng hạn 1 microsattellite cĩ 9 chuỗi lặp cịn microsatellite cĩ 10 chuỗi lặp). Nhìn chung tại một locus microsatellite của một quần thể đa allelle (theo nghĩa alelle của microsatelite) thì microsatellite của mỗi allele sẽ khác nhau về số chuỗi lặp. ðây là đặc điểm di truyền quan trọng của microsatellite làm cho nĩ trở thành một marker cực kỳ hữu hiệu trong việc phân biệt các cá thể của 1 quần thể, được ưa thích trong nghiên cứu di truyền quần thể và tội phạm học. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 19 2.4.4.3. Cơ chế tạo đột biến của microsatellite Tốc độ đột biến của microsatellite cao hơn nhiều so với các vùng khác của bộ gen, nằm trong phạm vi từ 10-2 đến 10-6 /locus/thế hệ. Một số các cơ chế gây ra tốc độ đột biến cao của microsatellite là: lỗi trong quá trình tái tổ hợp, trao đổi chéo khơng ngang bằng, trượt (slippage) của DNA polymerase trong quá trình tái sinh và sửa chữa DNA. 2.4.4.4. Phân bố của microsatellite Trên một bộ genome, microsatellite phân bố khơng đều vì − Tần số của chúng khác nhau giữa vùng mã hĩa và vùng khơng mã hĩa. Do tốc độ đột biến cao nên vùng mã hĩa cĩ mật độ microsatellite thấp hơn so với vùng khơng mã hĩa. Người ta đã chứng minh rằng, các microsatellite với chuỗi lặp là 3 hoặc 6 bp tồn tại với mật độ tương đương ở vùng mã hĩa và khơng mã hĩa. Tuy nhiên, các microsatellite với chuỗi lặp khơng phải là bội số của 3 thì tồn tại chủ yếu ở vùng khơng mã hĩa. − Vai trị chức năng của microsatellite. Các nghiên cứu trên thực vật cho thấy, áp lực chọn lọc tác động khác nhau lên vùng 5’UTR, vùng mã hĩa và 3’UTR. − Tần số thay đổi theo đơn vị phân loại (theo nghĩa số lượng tuyệt đối các loci microsatellite và motif của chuỗi lặp). Ở thực vật, tần số microsatellite cao ở thực vật cĩ bộ gen nhỏ (vd 0.85% ở cây Arabidopsis) và thấp hơn ở cây cĩ bộ gen lớn (vd 0.37% ở ngơ). Tần số = 1.07% ở nhiễm sắc thể 22 của người và 0.21% ở tuyến trùng Caernorhabditis elegans. 2.4.4.5. Ưu nhược điểm chính của Microsattelite ưu điểm: − Là marker đồng trội, cực kỳ tuyệt vời cho phân tích di truyền quần thể đối Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 20 với các sinh vật giao phối. − Cĩ thể tự động hĩa nếu mồi được gán nhãn huỳnh quang và được phân tích trên máy sequencer tự động. − Nếu bộ mồi đã được lựa chọn thì việc áp dụng tương đối dễ dàng. nhược điểm: − Việc xây dựng thư viện microsattelite và chọn lựa mồi thích hợp là cực kỳ tốn kém cơng sức và tiền bạc. − Các sản phẩm PCR trong phân tích microsatellite thường cĩ kích thước nhỏ (một vài trăm bp) và chênh lêch kích thước nhiều khi khơng nhiều dẫn tới phải điện di agarose nồng độ cao (~3 %) hoặc điện di polyacrylamide hoặc phân tích dùng máy sequencer tự động (đắt).[3] 2.5. Một số thành tựu ứng dụng chỉ thị phân tử SSR trong chọn giống cây trồng Trong những năm gần đây, cùng với sự phát triển nhanh chĩng của khoa học kỹ thuật nĩi chung và cơng nghệ sinh học nĩi riêng. Việc ứng dụng chỉ thị phân tử đã được các nhà khoa học quan tâm và ngày càng trở thành một cơng cụ hữu ích. Qua đĩ đã tạo ra nhiều giống mới mang tính trạng mong muốn phù hợp với tình hình thực tiễn của sản xuất. Chỉ thị phân tử SSR đã được sử dụng rộng rãi trên nhiều đối tượng cây trồng như: ngơ, lúa, lúa mỳ, cà chua, khoai tây, đậu tương.... và mang lại nhiều thành tựu to lớn. J. C. Reif khi nghiên cứu về đa dạng di truyền của 60 dịng ngơ Mỹ bằng sử dụng chỉ thị phân tử SSR, sử dụng 19 cặp mồi SS kết quả thu được 96 alen trung bình 3.4 alen/locus với mức đa hình 0.05-0.6.[18] Các nhà khoa học Mexico khi phân tích đa dạng di truyền của 336 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 21 giống ngơ được trồng phổ biến của Rica, Mexico với 85 cặp mồi thu được 532 alen , với khoảng cách di truyền thu được của 70 giống ngơ từ 0,503- 0.58 cịn lại trung bình khoảng cách di truyền đạt từ 0,203-0.258.[27] X. C. Xia, J. C. Reif, A. E. Melchinger, M. Frisch, D. A. Hoisington, D. Beck, K. Pixley, and M. L. Warburton, Mỹ khi đánh giá đa dạng di truyền 116 giống ngơ Canada với sử dụng 79 cặp mồi SSR kết quả thu được 566 alen với trung bình 7 alen/locus với hệ số tương đồng 0.45-0.93.[32] Yao Qi-Lun1, Trung Quốc sử dụng 45 cặp mồi SSR để đánh giá đa dạng di truyền 124 giống ngơ thuộc nước này kết quả thu được 286 alen với 6.4 alen/locus. Tỷ lệ đa hình chiếm 96.8%[28] Các nhà khoa học thuộc viện nghiên cứu ngơ Châu phi, Khi sử dụng 27 cặp mồi SSR để đánh giá đa dạng di truyền 46 dịng ngơ châu phi kết quả thu được 104 alen với trung bình 3.85 alen/locus. Phân tích sơ đồ hình cây cho thấy 46 giống nghiên cứu được phân thành 3 nhĩm chính. Hệ số PIC =0.67.[19] Trên đối tượng cây lúa việc ứng dụng chỉ thị phân tử SSR trong thời gian qua cũng đạt được kết quả một cách khả quan Năm 2002 các nhà khoa học Trung Quốc phân tích đa dạng di truyền của 23 giống lúa từ 5 quốc gia khác nhau với việc sử dung 16 cặp mồi SSR. Kết quả thu được số alen/locus đạt 5,2 alen/locus với hệ số tương đồng dao động từ 0,13-0,64. ðã phân được 23 giống lúa thành 2 nhĩm chính và xác điịnh được khoảng cách di truyền.[29] W.H. Li. và cs trong nghiên cứu của mình đã sử dụng 72 cặp mồi SSR để phân tích đa hình của 358 dịng lúa cạn, kết quả thu được tổng số 928 alen/locus và chia thành 6 nhĩm chính.[30] Wu Y. S. (2004) đã sử dụng 37 cặp mồi SSR nằm trên NST 12 để nghiên cứu sự đa hình của 37 dịng duy trì kết quả thu được tổng số 157 alen với 11 alen Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 22 ở 9 locus chỉ cĩ ở dịng duy trì và 3 alen chỉ cĩ ở dịng phục hồi [31] Ngồi lúa ngơ, Ứng dụng chỉ thị phân tử cịn đạt được thành tựu trên cây bơng Ulloa và cs, 2000 đã sử dụng 65 cặp mồi để khuyếch đại 70 locus trong nhiễm sắc thể và đã sử dụng chỉ thị phân tử SSR cùng với các chỉ thị khác để lập bản đồ cây bơng.[29] Ở Việt Nam gần đây tình hình ứng dụng chỉ thị phân tử đã và đang được quan tâm, tuy nhiên kết quả đạt được chưa nhiều. Nguyễn Văn ðồng và cs (1999) đã dùng 15 cặp mồi SSR để nghiên cứu đa hình của 19 giống lúa bố mẹ. Kết quả tạo ra 53 bằn đa hình với hệ số di truyền dao động trong khoảng 0.067- 0.9 và hệ số tương đồng đạt 0,06 -1. [4] Nĩi tĩm lại, chỉ thị phân tử là một phương pháp hữu hiệu trong phân tích đa dạng di truyền là cơng cụ trợ giúp đắc lực cho phương pháp truyền thống giúp các nhà khoa học giảm bớt được khối lượng cơng việc mà phương pháp chọn lọc truyền thống khơng thể mang lại. Với ứng dụng của chỉ thị này các nhà khoa học đã chọn tạo ra được những giống mới cĩ năng suất và chất lượng cao phục vụ trong cơng tác trồng trọt cũng như trong thực tiễn. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 23 3. VẬT LIỆU, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1 Vật liệu nghiên cứu Vật liệu gồm 26 dịng ngơ nếp tự phối cĩ nguồn gốc từ các mẫu giống ngơ TPTD của Việt Nam và Lào.Trong 26 dịng ngơ nếp tự phối này cĩ 18 dịng tự phối được phát triển từ nguồn gen ngơ trong nước và 8 dịng ngơ nếp tự phối cịn lại được nhập nội từ Lào. 10 cặp mồi SSR được chọn lọc để đánh giá tính đa hình DNA được sử dụng trong đề tài dựa trên nghiên cứu về đánh giá khoảng cách di truyền của dịng ngơ Pakistani . Bảng 3.1. Nguồn vật liệu ngơ sử dụng trong đánh giá đa dạng di truyền TT Ký hiệu dịng Giống gốc Tên địa phương Ký hiệu trong thí nghiệm 1 GN 2.5.2.2.3 GN2 Khẩu li ĩn T1 2 GN 2.5.2.2.9 GN2 Khẩu li ĩn T2 3 GN 2.12.7 GN2 Khẩu li ĩn T3 4 GN 48.3 GN48 Phon sa may I ( Lào) T4 5 GN 2.5.1.2.8 GN2 Khẩu li ĩn T5 6 GN 2.5.1.2.1 GN2 Khẩu li ĩn T6 7 GN 2.5.1.3.8 GN2 Khẩu li ĩn T7 8 GN 51.1 GN51 Sá li lướng lọi T8 9 GN 2.12.2.3.5 GN2 Khẩu li ĩn T9 10 GN 2.3.4.2.6 GN2 Khẩu li ĩn T10 11 GN 2.8.3.2.2 GN2 Khẩu li ĩn T11 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 24 12 GN 9.1.1 GN9 Nếp nạc,NA T12 13 GN 47.1 GN47 Phon Khăm II, Lào T13 14 GN 47.3 GN47 Phon Khăm II, Lào T14 15 GN 48.5 GN48 Phon sa may I ( Lào) T15 16 GN 2.3.4.2.4 GN2 Khẩu li ĩn T16 17 GN 47.2 GN47 Phon Khăm II, Lào T17 18 GN 2.8.3.2.3 GN2 Khẩu li ĩn T18 19 GN 47.4 GN47 Phon Khăm II, Lào T19 20 GN 51.2 GN51 Sá li lướng lọi T20 21 GN 2.5.1.2.4 GN2 Khẩu li ĩn T21 22 GN 5.1.2.2.1 GN5 Pooc cừ lầu,ðB T22 23 GN 5.1.2.4.12 GN5 Pooc cừ lầu,ðB T23 24 GN 2.3.4.2.16 GN2 Khẩu li ĩn T24 25 GN 8.1.1 GN8 Sapơ, QT T25 26 GN 5.1.2.2.11 GN5 Pooc cừ lầu,ðB T26 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 25 Bảng 3.2. Tên locus, nhĩm liên kết, trình tự, nhiệt độ bắt cặp và kích thước của 10 cặp mồi SSR được thể hiện dưới bảng sau : Locus Trình tự mồi (5/- 3/) Nhiệt độ bắt cặp(0C) Kích thước mồi (bp) xp-umc1354 Forward: GATCAGCCCGTTCAGCAAGT Reverse: GAGTGGAGGCGGAGGATCTG 54.8 < 250-750 xp-umc1824 Forward:ATCGTGCTTAAGCGGTTATAGGAAT Reverse: TGCACATGCTTTGTATAAGATGCC 54 < 250-750 xp-umc1184 Forward: AGAAGAAGAGGAGGTTCCATGACC Reverse: GCATGTTTCCCTTTCACCTCC 54.8 < 250-750 xp-umc2281 Forward: CAATGATTGGAGCCTAACCCCT Reverse: ATGATGATCTGCAGAGCCTAGTCC 55.1 < 250-750 xp-umc1325 Forward: ATATTGTACAGGAGCAGCTGGGAC Reverse: GGAGGTCATGCGTGTAAATAGGTC 57.4 < 250-750 xp-umc1186 Forward: TCAAGAACATAATAGGAGGCCCAC Reverse: AGCCAGCTTGATCTTTAGCATTTG 54 < 250-750 xp-mmc 0411 Forward: CGATGCAAGAGTGTCAAGTA Reverse: ACTCCCTAGTGCAAAAATCA 48.3 < 250-750 xp-umc1984 Forward: CTCTGGCCTCTGATACCAGTTGAT Reverse: CATCCTCCTGCAGCTGTTAACTC 57.4 < 250-750 xp-umc1586 Forward: TAGGAGATGAGCTCGTCGGATAAG Reverse: GAGGATGAGGAGGATGGCAATGGT 57.4 < 250-750 xp-umc1154 Forward: GTAGAGATCGATTCGCTAACCTGC Reverse: AGTTGTTCCGTTCCGTCCTTATC 55.4 < 250-750 3.2. ðịa điểm và thời gian nghiên cứu ðịa điểm: Tại Viện nghiên cứu lúa, Trường ðại học nơng nghiệp Hà Nội. - Thí nghiệm 1: ðược tiến hành trong vụ Thu đơng 2009 (gieo cuối tháng 8 đầu tháng 9 năm 2009) tại trường ðại học nơng nghiệp Hà Nội gồm đánh giá đa dạng di truyền và đánh giá trên đồng ruộng và lai tạo tổ hợp lai. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 26 - Thí nghiệm 2: ðược tiến hành trong vụ Xuân 2010 (gieo cuối tháng 2 đầu tháng 3 năm 2010), tại Viện nghiên cứu lúa. 3.3. Nội dung nghiên cứu 3.3.1. Thí nghiệm 1: ðánh giá đa dạng di truyền sử dụng marker Microsatellites hay Simple Sequence Repeats (SSRs) của các dịng ngơ nếp tự phối. 3.3.1.1. Phương pháp phân tích ða dạng di truyền + Gieo trồng 26 dịng mỗi dịng 3 – 5 cây trong nhà lưới, mẫu được gieo trong khoảng 2 tuần cho đến khi cĩ 3 -4 lá thật thì thu mẫu (chú ý kiểm tra vết bệnh nếu khơng cĩ thể lẫn DNA của vết bệnh) và phân tích đa dạng di truyền tại Trung tâm Bệnh cây nhiệt đới. 3.3.1.2. Các chỉ tiêu đánh giá trong thí nghiệm 1 - Tách chiết DNA theo Doye & Doye - ðiện di kiểm tra chất lượng và nồng độ DNA tổng số. - Số phân đoạn DNA trên mỗi mồi và tổng số phân đoạn. - PCR- SSR, ðánh giá đa dạng di truyền. Phân nhĩm di truyền dựa trên số liệu về khoảng cách di truyền thu được để chọn tổ hợp lai. - Số liệu được xử lý trên phần mềm Exel và NTSYS pc version 2.1. 3.3.1.3.Quy trình tách chiết DNA theo phương pháp DOYLE & DOYLE (1987). Chuẩn bị: 1. ðệm CTAB 1. β ME 2. Chày, cối sứ sạch 3. Ethanol 70% 4. Chloroform : isoamul alcohol: (24:1) 5. Tube 1.5 ml/giá 6. Bể nhiệt 65 oC Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 27 7. Mẫu lá (sạch, non) 8. Propanpl lạnh Tiến hành: 1. Chuẩn bị đệm chiết: cho vào lọ (tube nhựa 15ml) - 12ml CTAB + 120 ul β ME - Ủ 65oC trong 10 phút 2. Trong tủ hood: - Nghiền 100 mg lá với 1ml đệm chiết cho nhuyễn bằng chày cối sứ - Chuyển vào tube 1.5ml 3. Ủ dịch chiết trong bể nhiệt 65oCtrong 30 phút 4. Ly tâm 5 phút lấy dịch trên tủa ( xấp xỉ 700ul) cho vào tube 1.5 ml mới. 5. Cho 700ul (Ch: iso lạnh ) vào tube chứa 700ul dịch chiết → ðảo đều → ly tâm 5 phút → lấy dịch trên tủa (600-650ul) cho vào tube mới 6.Cho vào 600ul (Ch: iso) lạnh vào tube →đảo đều(nên để lạnh 0 oCtrong 1-2 phút →ðảo tiếp. 7. Ly tâm 5 phút → lấy cẩn thận dịch trên tủa ( ≈ 400ul) chú ý khơng để chạm đầu tuýp vào phân giới hút rất nhẹ → cho vào tube mới 1,5ml 8. Bổ sung thể tích ⇔ 400ul propanol lạnh vào tube→đảo đều →để -20oC/60 phút 9. Ly tâm 10 phút để kết tủa DNA( 700ul) 10. Rửa cặn 2 lần bằng ethanol 70% 11. ðể khơ cặn trong khơng khí chỗ sạch 30-60 phút 12. Hịa cặn trong 100ul TE và bảo quản mẫu DNA trong tủ lạnh -20 oC [14] 3.3.1.4. Kiểm tra chất lượng và nồng độ DNA trên gel agarose 1% - Pha 1g agarose với 100ml ding dịch đệm 1x TAE. ðun trong lị vi sĩng khoảng 3 phút cho đến khi tạo thành một dung dịch đồng nhất. - ðể nguội hoặc làm lạnh nhanh dưới vịi nước cho đến khi nhiệt độ 50- Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 28 600C, thêm 3 ul ethidium bromide (10mg/ml) cho vào bình rồi lắc đều. - Khay đổ gel được dán băng dính kin hai đầu và cài lược. ðổ dung dịch agarose vào khay sao cho khơng cĩ bọt khí. - Chờ gel đơng lại trong khoảng 30 phút. Rút lược ra khỏi gel, đặt gel vào bể điện di. ðổ TAE ngập mặt gel khoảng 2mm. - Lấy 26 tube 0,5ml sạch được đánh số lần lượt từ 1 đến 26: lần lượt cho vào 2ul DNA ngơ 8ul H20 2ul 6X Loading dye - Chạy điện di ở điện thế 100 V trong 30 phút. - Soi gel trên máy soi cực tím. 3.3.1.5.Quy trình nhân PCR với cặp mồi SSR - Phản ứng PCR được thực hiện trên máy gên Ampđ PCR system 9700. Trình tự lấy hĩa chất và thành phần của mỗi phản ứng được thể hiện trong bảng sau: Bảng 3.3. Thành phần của một phản ứng PCR STT Thành phần và nồng độ dịch gốc Thể tích (ul) 1 dd H20 20.38 2 Dearm tag Buffer 2.5 3 d NTPs 0.5 4 Primer ( For.) 0.5 5 Primer (Rev.) 0.5 6 Dearm tag 0.12 7 DNA 0.5 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 29 - Pha mồi gốc 100 uM nồng độ gốc trong TE, pha mối ở nồng độ làm việc 20 uM trong TE Pha vào tube 1,5 ml : 40 ul TE 10 ul mồi gốc 100 uM 50 uL - Pha dNTPs : 60 ul H20 10 ul dATP 10 ul dGTP 10 ul dCTP 10 ul dTTP 100 ul dNTPs - Chu trình của phản ứng PCR được biểu diễn theo sơ đồ sau: Sau khi thực hiện xong phản ứng PCR tiến hành điện di sản phẩm trên gel agarose 3%. 3.3.1.6. Kiểm tra sản phẩm phản ứng PCR trên gel agarose * Nguyên tắc: Các phân tử DNA cĩ khối lượng và điện tích khác nhau sẽ được tách ra khi di chuyển từ cực âm sang cực dương trong một điện trường ổn định với một điện thế thích hợp. 94 0 C 94 0 C 72 0 C 72 0 C 55 0 C 35 chu kỳ 2 ’ 30 ” 40 ” 2 ’ 40” Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 30 * Tiến hành: Cân 3g agarose với 100ml ding dịch đệm 1x TAE. ðun trong lị vi sĩng khoảng 6 phút cho đến khi tạo thành một dung dịch đồng nhất. - ðể nguội hoặc làm lạnh nhanh dưới vịi nước cho đến khi nhiệt độ 50- 600C, thêm 5 ul ethidium bromide (10mg/ml) cho vào bình rồi lắc đều. - Khay đổ gel được dán băng dính kin hai đầu và cài lược. ðổ dung dịch agarose vào khay sao cho khơng cĩ bọt khí. - Chờ gel đơng lại trong khoảng 30 phút. Rút lược ra khỏi gel, đặt gel vào bể điện di. ðổ TAE ngập mặt gel khoảng 2mm. - Mỗi mẫu sản phẩm sau phản ứng PCR được trộn lẫn 5 ul 6X Loading dye. - Trên bản gel giếng thứ nhất tra 5ul 100bp Plus DNA ladder,các giéng tiếp theo lần lượt tra 15 ul dung dịch sản phẩm phản ứng PCR - Chạy điện di ở điện thế 120 V trong 60 phút. - Soi gel trên máy soi cực tím, và chụp lại hình ảnh. 3.3.1.7. Phương pháp xử lý số liệu + Số liệu thu được dựa trên hình ảnh xử lý trên phần mềm Exel và NTSYS pc version 2.1. + Số 1: các alen cĩ xuất hiện băng ADN + Số 0: các alen khơng xuất hiện băng ADN + Số 9: Số liệu khuyết thiếu + ðể nghiên cứu mức độ đa dạng di truyền người ta thường dựa vào 3 cơng thức tính hệ số tương đồng là: hệ số Jaccard (1908), hệ số Nei & Li (1979) hay cịn gọi là hệ số Dice (1945), hệ số SM (Sokal and Michener (1958) hay cịn gọi là hệ số phù hợp đơn giản SMC (simple matching coefficient). Trong nghiên cứu này chúng tơi sử dụng hệ số hệ số SM (Sokal and Michener (1958) để tính hệ số tương đồng. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 31 Hệ số Sokal and Michener (1958) hay cịn gọi là hệ số phù hợp đơn giản SMC (simple matching coefficient) Cơng thức tính là dcb a daS +++ + = Trong đĩ: − a : số băng giống nhau của 2 cá thể − b: số băng chỉ xuất hiện ở cá thể i − c: số băng chỉ xuất hiện ở cá thể j − d: số băng khơng xuất hiện ở cả 2 cá thể (nhưng xuất hiện ở các cá thể khác) Hệ số SMC tính cả băng khơng cĩ mặt vì cho rằng băng thiếu tương ứng với các allele đồng hợp tử lặn. Sử dụng ma trận khác nhau UPGMA để phân tích các nhĩm và so sánh các ma trận tương đồng, và ma trận giống nhau WPGMA. Trong thí nghiệm này sử dụng ma trận UPGMA để phân tích các nhĩm và so sánh các ma trận tương đồng.[16] Trong phân tích mối quan hệ dựa trên các số liệu marker phân tử, người ta thường sử dụng khoảng cách hình học (D, distance) mặc dù vẫn thường được gọi là khoảng cách di truyền. Khoảng cách hình học cĩ thể được đo trực tiếp từ hệ số tương đồng S (similarity index) theo cơng thức D = 1 – S. [17] 3.3.2. Thí nghiệm 2: Thí nghiệm ngồi đồng ruộng. - Thí nghiệm khảo sát khơng lặp lại, diện tích ơ thí nghiệm 10 m2 - Vật liệu thí nghiệm : gồm tổ hợp lai thu được trong thí nghiệm 1 và dịng bố mẹ Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 32 3.3.2.1. ðánh giá tình hình sinh trưởng và phát triển của cây bố mẹ. + Ngày gieo + Số ngày từ gieo đến mọc + Số ngày từ gieo đến 3-4 lá + Số ngày từ gieo đến xốy nõn + Số ngày từ gieo đến trỗ cờ khi quần thể cĩ 70% số cây trỗ cờ tung phấn + Số ngày từ gieo đến phun râu khi quần thể cĩ 70% số cây phun râu 3.3.2.2. Theo dõi đánh giá một số tính trạng số lượng của dịng vật liệu bố mẹ + Chiều cao cây cuối cùng (cm): ðo từ gốc sát mặt đất đến đỉnh cờ, được tính sau khi trỗ cờ 15 ngày. + Chiều cao đĩng bắp (cm): đo từ gốc sát mặt đất đến mắt đĩng bắp trên cùng (bắp thứ nhất). 3.3.2.3. ðánh giá khả năng chống chịu sâu bệnh và khả năng chống đổ của dịng bố mẹ + Sâu đục thân (%): ðếm số cây cĩ sâu đục thân / ơ thí nghiệm theo dõi ở giai đoạn 7-9 lá thật và giai đoạn chín sữa. + Sâu xám (%): ðếm số cây cĩ sâu xám / ơ thí nghiệm theo dõi ở giai đoạn 7-9 lá thật và giai đoạn chín sữa. + Khả năng chống đổ (%): Theo dõi tất cả các lần nhắc lại sau đợt giĩ to và trước khi thu hoạch. ðổ rễ (%): Tính phần trăm số cây bị đổ nghiêng 1 gĩc >300 so với phương thẳng đứng thì được coi là đổ rễ. ðổ gẫy thân: Tính phần trăm số cây bị gẫy ở đoạn thân phía dưới bắp trước khi thu hoạch. 3.3.2.4. ðánh giá năng suất và các yếu tố cấu thành năng suất của dịng vật liệu bố mẹ. + Số bắp/ cây: Tổng số bắp/ ơ chia cho tổng số cây/ ơ. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 33 + Chiều dài bắp (cm): ðo từ gốc bắp đến đầu múp bắp. + ðường kính bắp (cm): ðo ở vị trí cĩ đường kính lớn nhất. + Số hàng hạt/ bắp. + Số hạt/ hàng. + Dạng hạt, màu sắt hạt và P1000 hạt (gam): ðể xác định khối lượng 1000 hạt, cân 2 mẫu mỗi mẫu 500 hạt, khối lượng giữa 2 lần chênh lệch nhau khơng quá 2 gam là chấp nhận được. Quy về ẩm độ 14%. + Khối lượng bắp tươi/ ơ (kg). + Khối lượng bắp khơ/ ơ (kg). Số bắp/ cây x số hạt/ bắp x P1000 hạt x mật độ + NSLT= 100000000 + Năng suất thực thu (NSTT) ở ẩm độ 14% được tính theo cơng thức, cân năng suất bắp tươi cả ơ, cân năng suất bắp khơ cả ơ, cân năng suất hạt khơ cả ơ. 3.3.2.5. Kỹ thuật trồng và chăm sĩc các dịng bố mẹ để lai - Lên luống cao để tránh ngập - Trồng 1 hàng/luống, lướng cách luống 80 cm, cây cách cây 20 cm - Phân bĩn : lượng phân bĩn 5-7 tấn phân chuồng, 100 N, 90 kg P2O5, 60 kg K2O cho dịng bố mẹ. Bĩn lĩt tịn bộ phân chuống và lân + 1/3 đạm + 1/3 kali, bĩn thúc 1 khi cây 3 – 4 lá với ½ lương đạm + 1/3 ka li, bĩn thú 2 khia cây xoắn non tồn bộ lượng phân cịn lại. Bĩn thức kết hợp với xới vun. - Tưới nước đảm bảo độ ẩm trung bình 70 – 80%, sau khi tưới thảo nước khơng để úng - Phịng trừ sâu bệnh, cỏ dại kịp thời. 3.3.2.6. ðánh giá tình hình sinh trưởng và phát triển của tổ hợp lai. + Ngày gieo Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 34 + Số ngày từ gieo đến mọc + Số ngày từ gieo đến 7-9 lá + Số ngày từ gieo đến trỗ cờ khi quần thể cĩ từ 10- 50 % số cây trỗ cờ tung phấn + Số ngày từ gieo đến phun râu khi quần thể cĩ 10-50 % số cây phun râu + Số ngày từ phun râu đến chín sinh lý. 3.3.2.7. Theo dõi đánh giá một số tính trạng số lượng của các tổ hợp lai. + Theo dõi động thái tăng trưởng chiiều cao cây 10 ngày 1 lần, đo từ mặt đất đến đỉnh lá cao nhất + Theo dõi động thái ra lá, theo dõi 10 ngày 1 lần. Số lá được tính từ lá thật thứ nhất đến cuối cùng, theo dõi bằng đánh dấu sơn. + Chiều cao cây cuối cùng (cm): ðo từ gốc sát mặt đất đến đỉnh cờ, được tính sau khi trỗ cờ 15 ngày. + Chiều cao đĩng bắp (cm): đo từ gốc sát mặt đất đến mắt đĩng bắp trên cùng (bắp thứ nhất). 3.3.2.8. ðánh giá khả năng chống chịu sâu bệnh và khả năng chống đổ của các tổ hợp lai. + Sâu đục thân (%): ðếm số cây cĩ sâu đục thân / ơ thí nghiệm theo dõi ở giai đoạn 7-9 lá thật và giai đoạn chín sữa. + Sâu xám (%): ðếm số cây cĩ sâu xám / ơ thí nghiệm theo dõi ở giai đoạn 7-9 lá thật và giai đoạn chín sữa. + Khả năng chống đổ (%): Theo dõi tất cả các lần nhắc lại sau đợt giĩ to và trước khi thu hoạch. ðổ rễ (%): Tính phần._..61 13.8 23.5 172.5 9.1.1 1.02 12 3.5 12.7 23.1 204.27 47.1 1.24 11.18 3.54 12.2 20.1 168.2 47.3 1 11.89 3.59 12.5 21.1 216.28 48.5 0.93 11.11 3.53 12.3 18.95 218.73 2.3.4.2.4 1.05 11.49 3.4 13.9 20.6 169.73 47.2 1.05 12 3.5 12.7 23.1 204.27 2.8.3.2.3 0.95 8.25 3.14 12.4 15.55 140.75 47.4 0.9 9.88 3.3 13.1 17.2 153.07 51.2 1.02 10.04 3.28 12.3 17.55 136.18 2.5.1.2.4 1.24 12.18 3.54 11.9 21.1 202.26 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 58 Bảng 4.11. Năng suất lý thuyết và năng suất thực thu của dịng vật liệu bố mẹ trong điều kiện vụ xuân 2010. Dịng NSLT (tạ/ha) NSTT (tạ/ha) Dịng NSLT (tạ/ha) NSTT (tạ/ha) 2.5.2.2.3 32.07 31.55 47.3 32.51 30.32 2.5.2.2.9 31.43 28.45 48.5 27.02 25.58 2.12.7 26.1 23.12 2.3.4.2.4 29.08 27.44 48.3 30.37 27.33 47.2 35.86 31.14 2.5.1.2.8 20.019 17.43 2.8.3.2.3 14.69 13.34 2.5.1.2.1 30.56 28.34 47.4 17.69 15.43 2.5.1.3.8 34.31 32.11 51.2 17.09 14.99 51.1 37.83 34.23 2.5.1.2.4 35.89 31.68 2.12.2.3.5 17.69 14.32 5.1.2.2.1 26.26 24.17 2.3.4.2.6 35.01 32.21 5.1.2.4.12 34.4 30.78 2.8.3.2.2 32.2 30.16 2.3.4.2.16 31.19 29.78 9.1.1 34.84 31.01 8.1.1 29.84 26.95 47.1 29.15 26.56 5.1.2.2.11 25.2 23.12 Năng suất lý thuyết được tính tốn trong điều kiện tối ưu tương quan thuận đến số hàng hạt/bắp, số hạt/hàng, P1000…là giá trị ước lượng tham khảo. Năng suất thực thu là chỉ tiêu quan trọng để đánh giá chất lượng một giống. Bảng 4.11 cho ta thấy các mẫu giống cĩ NSLT dao động từ 14.69 – 37.83 (tạ/ha). NSTT nằm trong khoảng từ 13,34 – 34,23 (tạ/ha). Cao nhất là 51.1 và thấp nhất là 2.8.3.2.3. 4.6. Kết quả đánh giá một số đặc điểm của tổ hợp lai 4.6.1. Thời gian sinh trưởng của tổ hợp lai Thời gian sinh trưởng phát triển của ngơ nĩi chung và ngơ nếp nĩi riêng từ khi gieo đến khi chín thường kéo dài trong khoảng 90 – 160 ngày. Việc nghiên cứu thời gian sinh trưởng cĩ ý nghĩa rất lớn trong nghiên cứu Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 59 khoa học và sản xuất từ đĩ chúng ta cĩ thể bố trí giống vào các cơ cấu luân canh cây trồng hợp lý. Qua theo dõi, đánh giá sinh trưởng phát triển của các THL trong điều kiện vụ Xuân 2010. Bảng 4.12. Thời gian sinh trưởng của các THL trong thí nghiệm vụ xuân 2010. ðvt: ngày G - TP G - PR THL G-M G - 7-9 lá 10% 50% 10% 50% PR-CSL THL1 5 36 60 65 61 64 45 THL2 6 37 57 61 57 60 42 THL3 5 34 56 59 58 60 37 THL4 5 36 63 67 63 68 36 THL5 6 37 58 59 59 62 36 THL6 6 37 57 59 59 61 36 THL7 7 38 57 60 57 59 38 THL8 5 36 61 63 62 65 44 THL9 6 37 59 61 59 62 36 THL10 5 36 67 71 69 74 41 THL11 5 36 57 58 57 61 42 THL12 6 36 57 60 62 64 37 THL13 8 39 57 58 59 62 40 THL14 7 37 56 58 61 65 38 CV% 11.8 11.9 9.65 LSD 3.87 2.91 3.15 Ghi chú M: Mọc ; G: Gieo; TP: Tung phấn; PR: Phun râu; CSL: Chín sinh lý Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 60 Dựa vào bảng 4.12 ta thấy các THL trong điều kiện thí nghiệm vụ Xuân 2010 tại Gia Lâm - Hà Nội cĩ thời gian sinh trưởng nằm trong khoảng từ 97- 115 ngày. Cao nhất là THL10, thấp nhất là THL7. Nhìn chung các tổ hợp lai cĩ thời gian sinh trưởng khá phù hợp, cĩ sự sai khác nhau ở mức cĩ ý nghĩa. 4.6.2. ðộng thái tăng trưởng chiều cao cây của các THL. Theo dõi động thái tăng trưởng chiều cao cây của các THL ngơ nếp ở vụ Xuân năm 2010 được tiến hành đo qua 5 lần đo. Trong 2 lần đo đầu tiên, tăng trưởng chiều cao ở các THL là tương đối đồng đều và chậm, tốc độ tăng trưởng chiều cao diễn ra nhanh nhất là vào khoảng giữa lần đo thứ 3 và thứ 4. Bước sang khoảng thời gian giữa lần đo thứ 4 và 5 ở thời kỳ trỗ cờ, phun râu nên sự tăng trưởng về chiều cao tốc giảm cao nhất là THL4 và thấp nhất là THL12. ðộng thái tăng trưởng chiều cao cây của các THL ngơ nếp ở vụ Xuân năm 2010 0 20 40 60 80 100 120 140 160 180 200 TH L1 TH L2 TH L3 TH L4 TH L5 TH L6 TH L7 TH L8 TH L9 TH L1 0 TH L1 1 TH L1 2 TH L1 3 TH L1 4 Các lần đo Ch iề u ca o câ y(c m ) Lần1 Lần2 Lần3 Lần4 Lần5 Hình 4.4. ðộng thái tăng trưởng chiều cao cây của các THL ngơ nếp ở vụ Xuân năm 2010 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 61 4.6.3.ðộng thái tăng trưởng số lá của các THL. Tốc độ tăng trưởng số lá của các THL nhanh nhất vào khoảng thời gian giữa hai lần đo 3 và 4 , giữa thời kỳ thứ 4 và 5 là thời kỳ chuyển từ sinh trưởng sinh dưỡng sang thời kỳ sinh trưởng sinh thực. Kết thúc ở lần đo thứ 5 tốc độ ra lá nhanh nhất là T11 và thấp nhất là THL1. Giữa các lần đo khác hầu hết các THL đều cĩ tốc độ ra lá chậm và khá đồng đều. ðộng thái tăng trưởng số lá của các THL và ðC vụ Xuân 2010 0 2 4 6 8 10 12 14 16 18 TH L1 TH L2 TH L3 TH L4 TH L5 TH L6 TH L7 TH L8 TH L9 TH L1 0 TH L1 1 TH L1 2 TH L1 3 TH L1 4 Các tổ hợp lai Số lá Lần1 Lần2 Lần3 Lần4 Lần5 Hình 4.5. ðộng thái tăng trưởng số lá của các THL ngơ nếp ở vụ Xuân năm 2010 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 62 4.6.4. Chiều cao cây, chiều cao đĩng bắp của các tổ hợp lai Bảng 4.13. Chiều cao cây, chiều cao đĩng bắp của các tổ hợp lai ngơ nếp ở vụ Xuân năm 2010 THL Chiều cao cây (cm) Chiều cao đĩng bắp (cm) Tỷ lệ CCðB/CCC THL1 181,5 77,5 0,426 THL2 170,94 65,89 0,385 THL3 173,2 66,14 0,381 THL4 176,24 69,14 0,392 THL5 165,4 59,96 0,362 THL6 170,7 66,12 0,387 THL7 156,66 57,28 0,365 THL8 160,32 58,25 0,363 THL9 166,52 62,89 0,377 THL10 155,51 54,69 0,351 THL11 161,13 62,45 0,387 THL12 149,24 52,37 0,35 THL13 153,27 54,12 0,353 THL14 169,48 60,17 0,355 Chiều cao đĩng bắp của các THL là khá đồng đều và cĩ chiều cao lý tưởng vì vậy các THL cĩ khả năng chống đổ cao. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 63 4.6.5. Tỷ lệ sâu bệnh và khả năng chống đổ gãy của các tổ hợp lai. Trong điều kiện vụ Xuân 2010 tại Gia Lâm – Hà Nội hầu hết các THL đều bị sâu đục thân và sâu xám phá hại, bắt đầu từ giai đoạn ngơ cĩ từ 7-9 lá cho đến cuối vụ. Tỷ lệ sâu đục thân và sâu xám phá hại mạnh nhất ở THL1, THL2, THL14. Bảng 4.14. Tỷ lệ sâu đục thân và sâu xám của 14 tổ hợp lai ngơ nếp ở vụ Xuân năm 2010 THL Tổng cây/ơ SðT/ơ Tỷ lệ Sâu xám/ơ Tỷ lệ (%) THL1 25 4 16 1 4 THL2 25 3 12 1 4 THL3 25 1 4 0 0 THL4 25 0 0 1 4 THL5 25 0 0 0 0 THL6 25 0 0 0 0 THL7 25 1 4 0 0 THL8 25 1 4 1 4 THL9 25 2 8 1 4 THL10 25 3 12 1 4 THL11 25 0 0 0 0 THL12 25 2 8 2 8 THL13 25 2 8 1 4 THL14 25 3 12 2 8 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 64 Bảng 4.15. Tỷ lệ cây đổ gãy của 14 tổ hợp lai ngơ nếp ở vụ Xuân năm 2010 THL Tổng cây/ơ Số cây đổ gãy /ơ Tỷ lệ (%) THL1 25 0 0 THL2 25 0 0 THL3 25 0 0 THL4 25 0 0 THL5 25 0 0 THL6 25 0 0 THL7 25 0 0 THL8 25 0 0 THL9 25 0 0 THL10 25 1 4 THL11 25 0 0 THL12 25 1 4 THL13 25 0 0 THL14 25 1 4 Tỷ lệ đổ gãy của các tổ hợp lai khơng lớn do cĩ chiều cao cuối cùng và chiều cao đĩng đĩng bắp khá lý tưởng nên khả năng chống dổ cao. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 65 4.7. Năng suất và các yếu tố cấu thành năng suất của các THL Bảng 4.16. Các yếu tố cấu thành năng suất của các THL trong thí nghiệm vụ Xuân 2010 THL Số bắp/cây (bắp/cây) Dài bắp (cm) ðK bắp (cm) Số hàng hạt/bắp (hàng/bắp) Số hạt/hàng (hạt/hàng) P1000 (g) THL1 1,04 12,1 3,58 12,4 22,1 153,7 THL2 1 11,34 3,18 11,4 22,35 216,42 THL3 0,9 14,8 3,42 12,2 29,2 172,6 THL4 0,98 0,88 3,3 13,1 17,2 153,07 THL5 1,02 16,4 3,5 13,5 22,3 232,8 THL6 1,01 11,5 3,62 13,2 23,1 171,5 THL7 1 17,12 4,09 12,3 31,8 174,3 THL8 1,07 12,2 3,14 11,9 23,9 180,2 THL9 1 12,12 3,72 13 24,7 169,5 THL10 1,2 12 3,52 13,6 24,1 172,4 THL11 0,98 12,11 3,51 12,8 24,5 188,22 THL12 1 12,5 3,21 12,1 22,9 177,8 THL13 0,97 12,8 3,15 11 21,5 186,3 THL14 1,02 14,42 3,65 12 21,2 190,3 Khối lượng nghìn hạt của các tổ hợp lai dao động trong khoảng 153.7- 216.42. Cao nhất ở THL2 và thấp nhất ở THL4. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 66 Bảng 4.17. Năng suất lý thuyết và năng suất thực thu của các THL trong thí nghiệm vụ Xuân 2010 THL NSLT ( Tạ/ha) NSTT ( Tạ/ha) THL1 24,24 22,91 THL2 32,68 31,32 THL3 35,04 34,88 THL4 17,69 16,42 THL5 39,14 37,29 THL6 30,4 28,12 THL7 39,63 36,92 THL8 29,21 25,77 THL9 33,19 31,97 THL10 32,2 30,89 THL11 40,37 38,78 THL12 27,52 24,32 THL13 25,11 20,18 THL14 26,76 23,44 CV% 19.7 21.03 LSD 6.47 6.88 Năng suất lý thuyết và năng suất thực thu của các tổ hợp lai cĩ sự sai khác nhau ở mức cĩ ý nghĩa, hệ số CV% =19.7, và CV%= 21.03 số liệu thí nghiệm là đáng tin cậy. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 67 4.8. Tương quan giữa khoảng cách di truyền và ưu thế lai của các THL về tính trạng năng suất lý thuyết và năng suất thực thu. Dựa vào kết quả phân tích đa dạng di truyền bằng sử dụng chỉ thị phân tử SSR, chúng tơi đã xác định được khoảng cách di truyền của 26 dịng ngơ nếp nghiên cứu. Theo một số nghiên cứu, các nhà khoa học đã xác định những dịng cĩ khoảng cách di truyền lớn thì cho khả năng kết hợp là cao và ngược lại. Tuy nhiên khoảng cách di truyền cao chỉ ở một ngưỡng nào đĩ tùy thuộc vào từng đối tượng nghiên cứu. Dựa trên khoảng cách di truyền trong phân tích đa dạng di truyền của 26 dịng ngơ thí nghiệm chúng tơi đã lựa chọn những dịng bố mẹ cĩ khoảng cách di truyền từ thấp đến cao để so sánh tương quan giữa khoảng cách di truyền và mức độ thể hiện tính trạng của các tổ hợp lai. Trong khuơn khổ của đề tài chúng tơi chỉ so sánh tương quan giữa khoảng cách di truyền và ưu thế lai của con lai về tính trạng năng suất lý thuyết và năng suất thực thu để đánh giá ưu thế lai của con lai F1 so với bố mẹ. Ưu thế lai của con lai F1 thu được là do cĩ sự tương tác giữa các gen – alen trong nhân cũng như tương tác giữa nhân và nội bào, là kết quả biểu hiện của gen ở mức độ trội một phần, trội hồn tồn, siêu trội, lấn át hay tính cộng của bố mẹ. Ưu thế lai của con lai F1 thể hiện cao hơn bố mẹ ở những bố và mẹ cĩ nguồn gốc xa nhau về gen, về địa lý, độ xa cách di truyền… Thơng qua bảng 4.18 chúng tơi thấy rõ mối tương quan giữa khoảng cách di truyền và ưu thế lai của các tổ hợp lai về tính trạng năng suất lý thuyết và năng suất thực thu. Kết quả cho thấy THL3,THL5,THL7,THL9,THL11đều cho ưu thế lai dương khi khoảng cách di truyền dao động trong khoảng 0.33-0.67 và các tổ hợp lai cịn lại đều cho ưu thế lai âm và ta thấy được mối quan hệ tỷ lệ thuận giữa khoảng cách di truyền và tính trạng năng suất. Những dịng cĩ khoảng Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 68 cách di truyền lớn thì năng suất cao và ngược lại. Những dịng bố mẹ cĩ khoảng cách di truyền từ 0.33 bắt đầu cho ưu thế lai dương. Bảng 4.18. Tương quan giữa khoảng cách di truyền và ưu thế lai của các tổ hợp lai về tính trạng năng suất lý thuyết trong thí nghiệm vụ Xuân 2010 THL KCDT năng suất lý thuyết ƯTL năng suất lý thuyết (%) THL1 0.12 24,24 -27.7 THL2 0.27 32,68 -2.29 TH3 0.39 35,04 7,48 THL4 0.1 17,69 -34,86 THL5 0,56 39,14 19,85 THL6 0.19 30,4 -12,95 THL7 0,48 39,63 11,79 THL8 0.22 29,21 -12,85 THL9 0.33 33,19 2,63 THL10 0.24 32,2 -2,7 THL11 0.67 40,37 18,08 THL12 0.17 27,52 -13,61 THL13 0.13 25,11 -19,15 THL14 0.16 26,76 -16,68 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 69 Bảng 4.19. Tương quan giữa khoảng cách di truyền và ưu thế lai của các tổ hợp lai về tính trạng năng suất thực thu trong thí nghiệm vụ Xuân 2010 THL KCDT năng suất lý thuyết ƯTL năng suất thực thu (%) THL1 0.12 22,91 -28,87 THL2 0.27 31,32 -5,69 THL3 0.39 34,88 5,02 THL4 0.1 16,42 -49 THL5 0,56 37,29 15,77 THL6 0.19 28,12 -12,69 THL7 0,48 36,92 14,62 THL8 0.22 25,77 -16,89 THL9 0.33 31,97 3,09 THL10 0.24 30,89 -0,038 THL11 0.67 38,78 24,53 THL12 0.17 24,32 -19,78 THL13 0.13 20,18 -35,19 THL14 0.16 23,44 -23,84 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 70 5. KẾT LUẬN VÀ ðỀ NGHỊ 5.1. Kết luận 1. Phân tích đa dạng di truyền bằng chỉ thị phân tử SSR của 26 dịng ngơ nếp tự phối được thu thập tại Việt Nam và Lào cho thấy mức tương đồng di truyền khá cao dao động (0,61-0.9). Dựa trên kết quả băng điện di của 10 cặp mồi SSR đã thu được được tổng số 18 alen /10 locus, trung bình 1,8 alen/ 1 locus. Hầu hết các cặp mồi đều thu được đa hình với tỷ lệ đa hình khá cao 80% chỉ riêng cặp xp-umc1984, và xp-umc1186 khơng thu được alen đa hình. Phân tích cây di truyền đã phân nhĩm 26 dịng ngơ thí nghiệm thành 3 nhĩm chính quy tụ ở hệ số tương đồng khác nhau. Trên cơ sở khoảng cách di truyền chọn ra và đánh giá 14 tổ hợp lai cĩ khoảng cách di truyền từ thấp đến cao dao động trong khoảng 0.1 -0.67. 2. Xác định được tương quan giữa khoảng cách di truyền và ưu thế lai của các tổ hợp lai về tính trạng năng suất. Những dịng cĩ khoảng cách di truyền lớn thì năng suất cao và ngược lại. Và xác định được ngưỡng cho ưu thế lai với những dịng bố mẹ cĩ khoảng cách di truyền từ 0.33 bắt đầu cho ưu thế lai. 3. ðề tài đã đề xuất được một số THL cĩ nhiều đặc điểm tốt hơn dịng bố mẹ cĩ khả năng cho năng suất cao và chống chịu tốt. 5.2. ðề nghị - Tiếp tục sử dụng chỉ thị SSR trong đánh giá đa dạng di truyền chọn tạo giống ngơ cho ưu thế lai cao. - 26 dịng ngơ nếp tự phối này cĩ hệ số tương đồng khá cao dẫn đến khoảng cách di truyền hẹp do vậy cần chọn lọc những dịng vật liệu bố mẹ cách xa nhau hơn để tìm được những THL triển vọng. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 71 TÀI LIỆU THAM KHẢO 1. Ngơ Hữu Tình (2009), Chọn lọc và lai tạo giống ngơ. Nxb nơng nghiệp. 2. Nguyễn Thế Hùng, Ngơ Hữu Tình, Phùng Quốc Tuấn,1993, Một số nhận xét về phương pháp tạo dịng thuần ở ngơ, NXB Nơng nghiệp. 3. Hà Viết Cường (2009), Giáo trình cơng nghệ sinh học trong bệnh cây. Nxb Nơng nghệp 4. Nguyễn Văn ðồng và cs (1999), ứng dụng chỉ thị phân tử SSR trong chọn tạo giống lúa, Tạp chí Khoa học Kỹ Thuật Nơng Nghiệp 5. Ngơ Hữu Tình, Nguyễn ðình Hiền, Các phương pháp lai thử và phân tích khả năng kết hợp trong các thí nghiệm về ưu thế lai, NXB Nơng nghiệp 6. Phan hữu Tơn (2004), Giáo trình cơng nghệ sinh học trong chọn tạo giống cây trồng. Nxb nơng nghiệp 7. Vũ Văn Liết và cs (2003). “Sự đa dạng nguồn gen cây lúa, ngơ ở một số địa phương miền núi phía Bắc Việt Nam”, Tạp chí khoa học kỹ thuật nơng nghiệp –Trường ðại học Nơng nghiệp I, Số 1, Tập 1 8. Vũ Văn Liết và Nguyễn Văn Hoan (2007). “Giáo trình sản xuất giống và cơng nghệ hạt giống”, Nhà xuất bản Nơng Nghiệp, Hà Nội 9. Balestre M, Machado JC, Lima JL, Souza JC, et al. (2008). Genetic distance estimates among single cross hybrids and correlation with specific combining ability and yield in corn double cross hybrids. Genet. Mol. Res. 7: 65-73. 10. Barata C and Carena MJ (2006). Classification of North Dakota maize inbred lines into heterotic groups based on molecular and testcross data. Euphytica 151: 339-349. 11. B. W. Legesse et al. Hereditas 144 (2007) maize (Zea mays L.): comparison with data from RFLP and pedigree. _ Theor. Appl. Genet. 95: 163_173. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 72 12. Chitra Bahadur Kunwar and Krisda Samphantharak, (2003). “Alternate S1 and Diallel Cross Selection for High Yield and High combining Ability Maize ( Zea mays L.) Inbred”, Kasetsart J. (Nat.Sci.) 37:247-2535. 13. Doebley, John. 1994. Genetics and the morphological evolution of maize. pp. 66-77 In M. Freeling and V. Walbot (eds.) The maize handbook, New York : Springer-Verlag. 14. Doyle, J. J. and Doyle, J. L. 1987. Genomic plant DNA preparation from fresh tissue- the CTAB method. Pytochem. Bull. 19: 11. 15. F. J. Betrán*,a, J. M. Ribautb, D. Beckb and D. Gonzalez de Leĩn,2002, Genetic Diversity, Specific Combining Ability, and Heterosis in Tropical Maize under Stress and Nonstress Environment, Corn Breeding and Genetics Program, Texas A&M University, College Station, TX 77845, International Maize and Wheat Improvement Center (CIMMYT), Apdo. Postal 6-641, 06600 México D.F., México, Paseo del Atardecer 360. 16. Hintze, J. L. 1998. STATISTICAL system for Windows.Number Chuncher Statistical Systems Kayville, Utah.Jiang, C., Edmeades, G. O., Armstead, I. et al. 1999. Geneticanalysis of adaptation differences between highland and lowland tropical maize using molecular markers.Theor. Appl. Genet. 99: 1106_1119. 17. Godshalk, E.B., M. Lee, and K.R. Lamkey. 1990. Relationship of Gonza´lez-de-Leo´ n. 1996. Identification of quantitative trait loci restriction length polymorphisms to single-cross hybrid perfor- under drought conditions in tropicalmaize: I. Flowering parameters mance of maize. Theor. Appl. Genet. 80:273–280. and the anthesis-silking interval. Theor. Appl. Genet. 92:905–914.Goodman, M.M. 1985. Exotic maize germplasm: Status, Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 73 18. J. C. Reif, A. E. Melchinger,* X. C. Xia, M. L. Warburton, D. A. Hoisington, S. K. Vasal,G. Srinivasan, M. Bohn, and M. Frisch, Genetic Diversity among CIMMYT Maize Inbred Lines Investigated with SSR Markers:II. Subtropical, Tropical Midaltitude, and Highland Maize Inbred Lines and theirRelationships with Elite U.S. and European Maize. Crop Sci. 39:943–954. 19. Legesse, B. W., Myburg, A. A., Pixley, K. V. and Botha, A. M. 2006. Genetic diversity of African maize inbred lines revealed by SSR markers. * Hereditas 144: 10_ 17. Lund, Sweden. eISSN 1601-5223. Received June 22, 2005. Accepted August 23, 2006 20. Liu, Z. W., Biyashev, R. and Saghai-Maroof, M. 1996.Development of simple sequence repeats DNA markers and their integration into a barley linkage map. _ Theor.Appl. Genet. 93: 869_876. 21. Max A. Glover, David B. Willmot, Larry L. Darrah,* Bruce E. Hibbard, and Xiaoyang Zhu, 2005, Diallel Analyses of Agronomic Traits Using Chinese and U.S. Maize Germplasm Crop Sci 45:1096-1102. 22. Matsuoka, Y., Mitchell, S. E. and Kresovich, S. 2002.Microsatellites in Zea _ variability, patterns of mutations and use for evolutionary studies. _Theor. Appl. Genet.104: 436_450. 23. Slavko Borojevíc, 1990, Principle and methods of Plant Breeding, Elsevier, p 234. 24. Sprague,2003, Analysis of Genetic Diversity in Crop Plants – Salient Stastistical Tools and Considerations, Crop Science 43 : 1235 -1248 (2003), Crop Science Society of America. 25. Smith, J. S. C., Chin, E. C. L., Shu, H. et al. 1997. An evaluation the utility of SSR loci as molecular markers in maize. Theor. Appl. Genet. 83:1003–1012 Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 74 26. Stuber, C.W. 1989. Marker-based selection for quantitative traits. p. 31–49. In G. Robbelen (ed.) Proc XII Congr. EUCARPIA. Parey,Berlin Hamburg. 27. Pejic, I., P. Ajmone-Marsan, M. Morgante, V. Kovumplick, P. Castigliported by funds from the German “Bundesministerium fu ¨ r oni, G. Taramino, and M. Motto. 1998. Comparative analysis of wirtschaftliche Zusammenarbeit und Entwicklung” Projekt genetic similarity among maize inbred lines detected by RFLPs, No. 98.7860.4- 001-01. RAPDs, SSRs, and AFLPs. Theor. Appl. Genet. 97:1248–1255. 28. YAO QI-LUN1, FANG PING1, KANG KE-CHENG2 and PAN GUANG-TANG2, Genetic diversity based on SSR markers in maize (Zea mays L.)landraces from Wuling mountain region in China 29. Ulloa,m.,and Cs. Merediuth(2000), genetic linkage map and QTL analysis of agronomicanf fiber quliyt trails in an population. The joural of cotton science,4:161-170 30. W.H. Li. và cs(2004),. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. 31. Wu Y. S., Zheng Y. L., Sun R., Wu S. Y., Gu H. B. and Bi Y. H. 2004 Genetic diversity of waxy corn and popcorn land-races in Yunnan by SSR markers. Acta Agrono. Sinica 30, 36–42. 32. X. C. Xia, J. C. Reif, A. E. Melchinger, M. Frisch, D. A. Hoisington, D. Beck, K. Pixley, and M. L. Warburton , (2008). “Classifying MaizeInbred Lines into Heterotic Groups using a Factorial Mating Design”, Published in Agron J 101:106-112 (2009), DOI: 0.2134/agronj2008.0217 33. 34. 35. Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 75 PHỤ LỤC KẾT QUẢ XỬ LÝ THỐNG KÊ BALANCED ANOVA FOR VARIATE B/C FILE THAO 16/ 9/10 5:34 ------------------------------------------------------------------ :PAGE 1 THI NGHIEM DANH GIA TO HOP LAI VARIATE V003 B/C LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 THL$ 13 .113043 .869561E-02 0.00 1.000 3 2 R 1 .123148E-18 .123148E-18 0.00 1.000 3 * RESIDUAL 13 *********** *********** ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 27 .113043 .418677E-02 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE DB FILE THAO 16/ 9/10 5:34 ------------------------------------------------------------------ :PAGE 2 THI NGHIEM DANH GIA TO HOP LAI VARIATE V004 DB LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 THL$ 13 85.4855 6.57580 ****** 0.000 3 2 R 1 .171474E-14 .171474E-14 0.00 0.995 3 * RESIDUAL 13 .198906E-05 .153005E-06 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 27 85.4855 3.16613 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE DKB FILE THAO 16/ 9/10 5:34 ------------------------------------------------------------------ :PAGE 3 THI NGHIEM DANH GIA TO HOP LAI VARIATE V005 DKB LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 THL$ 13 1.82659 .140507 ****** 0.000 3 2 R 1 .547325E-19 .547325E-19 0.00 0.996 3 * RESIDUAL 13 .425113E-07 .327010E-08 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 27 1.82659 .676513E-01 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE HH/B FILE CUOI 16/ 9/10 5:34 ------------------------------------------------------------------ :PAGE 4 THI NGHIEM DANH GIA TO HOP LAI VARIATE V006 HH/B LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 THL$ 13 15.5043 1.19264 ****** 0.000 3 2 R 1 .109062E-18 .109062E-18 0.00 0.996 3 * RESIDUAL 13 .116832E-05 .898704E-07 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 27 15.5043 .574233 ----------------------------------------------------------------------------- Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 76 BALANCED ANOVA FOR VARIATE H/B FILE THAO 16/ 9/10 5:34 ------------------------------------------------------------------ :PAGE 5 THI NGHIEM DANH GIA TO HOP LAI VARIATE V007 H/B LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 THL$ 13 316.636 24.3566 ****** 0.000 3 2 R 1 .125509E-14 .125509E-14 0.00 0.996 3 * RESIDUAL 13 .110087E-04 .846825E-06 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 27 316.636 11.7273 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE P1000 FILE THAO 16/ 9/10 5:34 ------------------------------------------------------------------ :PAGE 6 THI NGHIEM DANH GIA TO HOP LAI VARIATE V008 P1000 LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 THL$ 13 12101.6 930.896 ****** 0.000 3 2 R 1 .587124E-14 .587124E-14 0.00 0.996 3 * RESIDUAL 13 .724909E-03 .557622E-04 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 27 12101.6 448.209 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE NSLT FILE THAO 16/ 9/10 5:34 ------------------------------------------------------------------ :PAGE 7 THI NGHIEM DANH GIA TO HOP LAI VARIATE V009 NSLT LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 THL$ 13 1090.13 83.8559 ****** 0.000 3 2 R 1 .188681E-14 .188681E-14 0.00 0.996 3 * RESIDUAL 13 .583862E-04 .449124E-05 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 27 1090.13 40.3751 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE NSTT FILE THAO 16/ 9/10 5:34 ------------------------------------------------------------------ :PAGE 8 THI NGHIEM DANH GIA TO HOP LAI VARIATE V010 NSTT LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 THL$ 13 1232.11 94.7774 ****** 0.000 3 2 R 1 .434151E-14 .434151E-14 0.00 0.996 3 * RESIDUAL 13 .210054E-04 .161580E-05 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 27 1232.11 45.6335 ----------------------------------------------------------------------------- Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 77 TABLE OF MEANS FOR FACTORIAL EFFECTS FILE THAO 16/ 9/10 5:34 ------------------------------------------------------------------ :PAGE 9 THI NGHIEM DANH GIA TO HOP LAI MEANS FOR EFFECT THL$ ------------------------------------------------------------------------------- THL$ NOS B/C DB DKB HH/B THL1 2 1.01000 12.1000 3.58000 12.4000 THL2 2 1.04000 11.3400 3.18000 11.4000 THL3 2 1.00000 14.8000 3.42000 12.2000 THL4 2 0.900000 12.8800 3.30000 13.1000 THL5 2 0.980000 16.4000 3.50000 13.5000 THL6 2 1.02000 11.5000 3.62000 13.2000 THL7 2 1.02000 17.1200 4.09000 12.3000 THL8 2 1.00000 12.2000 3.14000 11.9000 THL9 2 1.07000 12.1200 3.72000 13.0000 THL10 2 1.00000 12.0000 3.52000 13.6000 THL11 2 1.20000 12.1100 3.51000 12.8000 THL12 2 0.980000 12.5000 3.21000 12.1000 THL13 2 1.00000 12.8000 3.15000 11.0000 THL14 2 0.970000 14.4200 3.65000 12.0000 SE(N= 2) 0.000000 0.276591E-03 0.404358E-04 0.211979E-03 5%LSD 13DF 0.000000 0.845056E-03 0.123542E-03 0.647652E-03 THL$ NOS H/B P1000 NSLT NSTT THL1 2 22.1000 153.700 24.2400 22.9100 THL2 2 22.3500 216.420 32.6800 31.3200 THL3 2 29.2000 172.600 35.0400 34.8800 THL4 2 17.2000 153.070 17.6900 16.4200 THL5 2 22.3000 232.800 39.1400 37.2900 THL6 2 23.1000 171.500 30.4000 28.1200 THL7 2 31.8000 174.300 39.6300 36.9200 THL8 2 23.9000 180.200 29.2100 25.7700 THL9 2 24.7000 169.500 33.1900 31.9700 THL10 2 24.1000 172.400 32.2000 30.8900 THL11 2 24.5000 188.220 40.3700 38.7800 THL12 2 22.9000 177.800 27.5200 24.3200 THL13 2 21.5000 186.300 25.1100 20.1800 THL14 2 21.2000 190.300 26.7600 23.4400 SE(N= 2) 0.650701E-03 0.528026E-02 0.149854E-02 0.898834E-03 5%LSD 13DF 0.198806E-02 0.161326E-01 0.457843E-02 0.274617E-02 ------------------------------------------------------------------------------- MEANS FOR EFFECT R ------------------------------------------------------------------------------- R NOS B/C DB DKB HH/B 1 14 1.01357 13.1636 3.47071 12.4643 2 14 1.01357 13.1636 3.47071 12.4643 SE(N= 14) 0.000000 0.104541E-03 0.152833E-04 0.801206E-04 5%LSD 13DF 0.000000 0.319401E-03 0.466944E-04 0.244789E-03 R NOS H/B P1000 NSLT NSTT 1 14 23.6321 181.365 30.9414 28.8007 2 14 23.6321 181.365 30.9414 28.8007 SE(N= 14) 0.245942E-03 0.199575E-02 0.566395E-03 0.339727E-03 5%LSD 13DF 0.751417E-03 0.609754E-02 0.173048E-02 0.103796E-02 ------------------------------------------------------------------------------- Trường ðại học Nơng nghiệp Hà Nội – Luận văn thạc sĩ nơng nghiệp …………….... 78 ANALYSIS OF VARIANCE SUMMARY TABLE FILE THAO 16/ 9/10 5:34 ------------------------------------------------------------------ :PAGE 10 THI NGHIEM DANH GIA TO HOP LAI F-PROBABLIITY VALUES FOR EACH EFFECT IN THE MODEL. SECTION - 1 VARIATE GRAND MEAN STANDARD DEVIATION C OF V |THL$ |R | (N= 28) -------------------- SD/MEAN | | | NO. BASED ON BASED ON % | | | OBS. TOTAL SS RESID SS | | | B/C 28 1.0136 0.64705E-01 0.00000 0.0 1.0000 1.0000 DB 28 13.164 1.7794 0.39116E-03 0.0 0.0000 0.9955 DKB 28 3.4707 0.26010 0.57185E-04 0.0 0.0000 0.9957 HH/B 28 12.464 0.75778 0.29978E-03 0.0 0.0000 0.9957 H/B 28 23.632 3.4245 0.92023E-03 0.0 0.0000 0.9956 P1000 28 181.37 21.171 0.74674E-02 0.0 0.0000 0.9957 NSLT 28 30.941 6.3541 0.21193E-02 0.0 0.0000 0.9956 NSTT 28 28.801 6.7553 0.12711E-02 0.0 0.0000 0.9956 ._.

Các file đính kèm theo tài liệu này:

  • pdfCH2266.pdf
Tài liệu liên quan